Telomere dynamics during aging in polygenic left ventricular hypertrophy

Abstract

Short telomeres are associated with increased risk of cardiovascular disease. Here we studied cardiomyocyte telomere length at key ages during the ontogeny of cardiac hypertrophy and failure in the hypertrophic heart rat (HHR) and compared these with the normal heart rat (NHR) control strain. Key ages corresponded with the pathophysiological sequence beginning with fewer cardiomyocytes (2 days), leading to left ventricular hypertrophy (LVH) (13 wk) and subsequently progression to heart failure (38 wk). We measured telomere length, tissue activity of telomerase, mRNA levels of telomerase reverse transcriptase (Tert) and telomerase RNA component (Terc), and expression of the telomeric regulator microRNA miR-34a. Cardiac telomere length was longer in the HHR compared with the control strain at 2 days and 38 wk, but shorter at 13 wk. Neonatal HHR had higher cardiac telomerase activity and expression of Tert and miR-34a. Telomerase activity was not different at 13 or 38 wk. Tert mRNA and Terc RNA were overexpressed at 38 wk, while miR-34a was overexpressed at 13 wk but downregulated at 38 wk. Circulating leukocytes were strongly correlated with cardiac telomere length in the HHR only. The longer neonatal telomeres in HHR are likely to reflect fewer fetal and early postnatal cardiomyocyte cell divisions and explain the reduced total cardiomyocyte complement that predisposes to later hypertrophy and failure. Although shorter telomeres were a feature of cardiac hypertrophy at 13 wk, they were not present at the progression to heart failure at 38 wk.

telomeres, the specialized DNA-protein complexes located at the ends of eukaryotic chromosomes, are essential for chromosomal stability and cell viability. Telomere length and its age-dependent shortening are regarded as markers of age-associated diseases in general and cardiovascular disease in particular (36). This is strongly supported by investigations showing that patients with atherosclerosis, coronary artery disease, chronic heart failure, and stroke have shorter leukocyte telomere length (LTL) (4, 12, 15, 41, 44). There are, however, some paradoxical findings that are not understood in regards to telomere length and left ventricular (LV) hypertrophy, one of the key indicators of target-organ damage in cardiovascular disease (23). For example, population-based studies have shown that LV mass and thickness were associated with longer, rather than shorter, telomeres (18, 42). This is difficult to explain since LV mass represents the time-averaged exposure to several cardiovascular risk factors that also decrease telomere length, such as age, inflammation, oxidative stress, blood pressure (BP), and obesity, combined with genetic factors (6, 7, 22).

Less well studied is the importance of cardiac telomere dynamics to the developmental changes in cardiac mass leading to failure. Indeed, shorter telomeres at an early age can lead to impairment in cell division, enhanced cardiomyocyte death, and hypertrophy, all of which are concomitant with cardiac dysfunction and failure (21). Animal models have been be used to assess changes in telomeres (21), but in the case of LV hypertrophy this maybe hindered by the associated increased BP (11, 29) and, hence, mask the genetic origin of this disease. All of the above highlight the need to elucidate specific pathways that affect telomere length throughout the lifespan in the absence of increased BP. Crucial to our understanding of the molecular mechanisms that underlie the development of LV hypertrophy and heart failure and to the design of preventive and therapeutic regimens are animal models that are bred to genetically develop LV hypertrophy leading to heart failure. One such model is the hypertrophic heart rat (HHR), which develops LV hypertrophy independently of hypertension (14).

Given the established link between telomere dysfunction and cardiomyocyte proliferative defects (21), we postulated that cardiac telomere homeostasis will be perturbed in the HHR. To test this hypothesis, we first measured telomere length in the heart of the HHR at key ages corresponding to the pathophysiological sequence of fewer cardiomyocytes (2 days), cardiac hypertrophy (13 wk), and subsequently progression to heart failure (38 wk). In the search for the molecular basis of perturbed telomere homeostasis in the HHR heart, we first measured changes in the telomere-lengthening enzyme telomerase and quantified its two main subunits, telomerase reverse transcriptase (Tert) and telomerase RNA component (Terc). We also investigated whether changes in telomere length are due to changes in the newly discovered telomeric regulator microRNA (miRNA) miR-34a (3, 33). Our findings are the first to describe telomere dynamics in cardiac hypertrophy independent of BP. They point to a key involvement of miR-34a and Tert as direct drivers of telomeres and, hence, the dynamic regulation of cardiomyocyte growth and function.

MATERIALS AND METHODS

Animal models.

The HHR is a polygenic model of LV hypertrophy developed by cross-breeding the spontaneously hypertensive rat, a model of hypertension and LV hypertrophy, and the Fischer 334 rat, which has normal BP and cardiac size. The progeny were selectively interbred over 13 generations to create the HHR, which presents with pathological LV hypertrophy in the absence of a pressure load at maturity. The sister strain used as a control is the normal heart rat (NHR), which has normal heart size and BP (14). The HHR is born with a smaller heart containing fewer cardiomyocytes (31). By 12 wk of age, however, the HHR presents with established LV hypertrophy, which leads to premature death due to heart failure as early as 48 wk of age (14, 31).

Samples and tissue collection.

We euthanized 2-day-old HHR (n = 7) and NHR (n = 9) by decapitation. We euthanized 13 wk old (n = 9 HHR and n = 11 NHR) and 38 wk old (n = 9 HHR and n = 7 NHR) rats with an overdose of pentobarbitone (Lethobarb) (Table 1). Hearts were immediately removed, and LV dissected from the atria. Cardiac weight index (CWI, mg/g) was calculated from the total heart weight (mg) relative to total body weight (g) of the animal. Circulating leukocytes were collected in heparin tubes from 13 wk old rats only. Tissues were first preserved in liquid nitrogen and later transferred to a −80°C freezer. Cardiomyocytes were isolated from snap-frozen tissue. The protocol was adapted from a publication (26) and personal communication with Professor Cris dos Remedios (University of Sydney). In brief, the tissue was sectioned into 300 μm sections and stored at −20°C for 4 h. We then added 1 ml of digestion buffer (PBS, 1 mg/ml collagenase B, 1 mg/ml collagenase D, and 30 mM 2,3-butanedione 2-monoxime, filtered through a 0.22 μm filter) for every 300 μm cardiac section, and digested immediately for 20 min on an incubated rocking plate (37°C, 99 RPM). The tubes containing the tissue were placed on ice and manually digested by pipetting the solution up and down repeatedly (∼20 times with a 10 ml sterile pipette). This was repeated three times. The solution was then passed through a 100 μm mesh filter, and increasing volumes of rat cardiac myocyte growth medium (Lonza) were added (0.1, 0.1, 0.3 and 0.5 volumes), with 10 min rest intervals on ice. The cell pellet was collected by centrifugation at 200 RPM for 4 min at 4°C, and this was used for extractions described below. The study was approved by the Animal Ethics Committees of the University of Melbourne and Deakin University and ratified at Federation University Australia.

Table 1.

Characteristics of HHR and NHR samples used in this study

	NHR				HHR
Age	n	Body Weight, g	Heart Weight, mg	CWI, mg/g	n	Body Weight, g	Heart Weight, mg	CWI, mg/g
2 days	9	5.9 ± 0.2	44.1 ± 2.0	7.4 ± 0.1	7	5.3 ± 0.3	34.3 ± 2.4†	6.4 ± 0.2‡
13 wk	11	205.2 ± 15.9	697.0 ± 44.8	3.4 ± 0.1	9	186.2 ± 13.0	890.8 ± 46.8†	4.9 ± 0.3‡
38 wk	9	355.0 ± 35.7	1188.6 ± 83.0	3.4 ± 0.1	7	253.1 ± 20.5*	1038.5 ± 108.8	4.5 ± 0.5*

HHR, hypertrophic heart rat; NHR, normal heart rat; CWI, cardiac weight index.

Values are represented as means ± SE.

^*P < 0.05,

^†P < 0.01,

^‡P < 0.001.

DNA and RNA extraction.

DNA from leukocytes, cardiomyocytes, and LV tissue was extracted using the PureLink Genomic Extraction kit (Life Technologies). RNA was extracted using the miRNeasy kit (Qiagen). Both RNA and DNA were quantified by spectrophotometry using a NanoDrop ND-100 spectrophotometer (Thermo Scientific).

Telomere length measurement.

The telomere-repeat copy number (T) to single-copy gene (a gene with only one locatable region on a DNA molecule) copy number (S) ratio (T/S ratio) was determined by real-time quantitative PCR (qPCR) using SensiMix SYBR No-Rox (Bioline) in a Viia7 instrument (Life Technologies), as previously described (5). We then used the formula [3,274 + 2,413 * (T/S)] to convert T/S ratio to base pairs (28). Telomere length was given as T/S ratio and base pairs.

Telomerase activity.

Telomerase activity was measured using the TRAPeze Kit RT Telomerase Detection Kit (Merck Millipore) and Platinum Taq DNA Polymerase (Life Technologies) according to the supplier. Briefly, protein was extracted with the CHAPS Lysis Buffer (Merck Millipore), and 1 μg of protein was added to each reaction. Samples were measured in duplicate, and telomerase activity was quantified relative to a standard curve by qPCR in a Viia7 instrument (Life Technologies). The activity of the enzyme telomerase was given as a number of copies determined based on the standard curve supplied by Merck Millipore.

miRNA and gene expression.

The levels of Tert and Terc, both components of telomerase, the enzyme responsible for the elongation of telomeres, and protein phosphatase 1 regulatory subunit 10 (Ppp1r10, also known as Pnuts) mRNA, and miR-34a were measured by qPCR. For mRNA levels, the first-strand complementary synthesis reaction was performed using the High Capacity cDNA Reverse Transcription Kit (Life Technologies). Primers were designed to flank an exon-exon junction using Primer3 (35) and NCBI tool Primer Blast. Amplification reactions used the SensiFast SYBR Low-ROX Kit qPCR reagent (Bioline). The specificity of qPCRs was ensured by melting curve analysis and DNA gel electrophoresis (data not shown). For miR-34a expression, RNA was transformed to cDNA using the TaqMan MicroRNA Reverse Transcription Kit for miRNA cDNA (Life Technologies). Amplification reactions used TaqMan assays and the TaqMan Fast Advanced Master Mix (Life Technologies). For both mRNA and miRNA expression, all samples were run in duplicates in a Viia7 qPCR instrument (Life Technologies). Glyceraldehyde 3-phosphate dehydrogenase (Gapdh) was used as reference transcript for mRNA levels, and the miRNAs RNU6, 4.5S, and Sno87 for miRNA expression. Primers, probe assays, and conditions are listed in Table 2. Significance was assessed using 2^−ΔΔCT for both mRNA and miRNA expression calculations (37).

Table 2.

Primers, probe assays, and conditions used to validate microarray miRNA and gene expression

Official Gene Symbol	Primer Sequence (5′→3′)	Annealing Temperature, °C	Concentration, nM	Product Length, bp
Gapdh	F: GGGGCTCTCTGCTCCTCCCTG	58	200	108
	R: ACGGCCAAATCCGTTCACACC		200
Pnuts	F: CTCAAGCAGAACAACACAGCG	58	200	125
	R: CTACTCTGGGAGCGGATGAC		200
Tert	F: AACTACGAGCGGACCAAACA	58	200	150
	R: CCCTGTCACATCTGCCTTAAC		200
Terc	F: TGTTATAGCTGTGGGTTCTGTTCTT	58	200	91
	R: CCGCTGCAGGTCTGAACTTT		200

Official miRNA Symbol	TaqMan Assay ID	Annealing Temperature, °C
rno-miR-34a	000426	60
4.5S	001716	60
Sno87	AF272707	60
RNU6B	001973	60

miRNA, microRNA; F, forward; R, reverse.

Statistical analyses.

GraphPad Prism (version 6) and SPSS (version 21) packages were used for graphing and statistical analyses. Data sets were tested for normal distribution by the D'Agostino and Pearson normality test, and equal variances were analyzed by the F-test. An independent sample t-test, Welch's test, or Mann-Whitney test was used to compare the data between the groups. Pearson's or Spearman's correlations were used to correlate telomere length, miR-34a and telomeric gene expression, and CWI data. Analyses of variance using Tukey's multiple-comparisons test was used to compare between ages within the same strain. Step-wise regression analyses were used to determine potential predictors of cardiac size and telomere length, including age and sex as independent variables (F-entry probability, 0.05; removal, 0.1). Significance was set at P < 0.05.

RESULTS

Cardiac size.

Table 1 provides the characteristics of the samples used in this study. Neonatal 2-day-old HHR had significantly smaller hearts (P = 0.0008), while 13 and 38 wk old animals had significantly larger hearts (all P < 0.05) relative to age-matched NHR (Table 1, Fig. 1A).

Fig. 1.

Telomere length of hypertrophic heart rat (HHR) and normal heart rat (NHR). A: heart growth of the HHR and NHR samples used in the present study. Heart size of HHR is represented as cardiac weight index (mg/g), showed as a percentage difference to NHR (normalized to 100%). Body weight, heart weight, and cardiac weight index values are shown in Table 1 (n = 7–11 per group per age). B: neonatal HHR has significantly longer heart telomere compared with NHR. In 13 wk old animals, HHR has shorter telomeres than age-matched NHR. At 38 wk of age, telomeres are once again longer in HHR than NHR. The shortening of telomeres in the HHR happened early in life (†) compared with NHR (#), where telomere shortening occurred in late adulthood. C: blood telomere length was shorter in 13 wk old HHR compared with age-matched NHR, similar to heart telomere length. D: circulating telomere length is correlated to heart telomere length in 13 wk old animals. Graphs represent means, error bars represent SE. *P < 0.05, †P < 0.05, ##P < 0.01.

LV telomere length.

There was a positive correlation between telomere length of isolated cardiomyocytes and whole LV at all ages (r = 0.295, P = 0.017). LV telomere length was significantly longer in 2-day-old HHR (NHR T/S ratio 3.23 ± 0.07 vs. HHR 3.51 ± 0.1, NHR 11,068 bp vs. HHR 11,743 bp, P = 0.023), but shorter in 13 wk old HHR (NHR 3.38 ± 0.04 vs. HHR 3.26 ± 0.03, NHR 11,430 bp vs. HHR 11,140 bp, P = 0.024) compared with age-matched NHR (Fig. 1B). In 38 wk old HHR, LV telomere length was significantly longer than the NHR (NHR 2.88 ± 0.2 vs. HHR 3.34 ± 0.04, NHR 10,223 bp vs. HHR 11,333 bp, P = 0.009, Fig. 1B). When we compared LV telomere length within strains, 2-day-old HHR had significantly longer telomeres than 13 wk old HHR (P = 0.01, Fig. 1B). Thirty eight-week-old NHR had significantly shorter telomeres compared with 13 wk old (P = 0.004, Fig. 1B).

Leukocyte telomere length.

To investigate whether telomere length of circulating leukocytes is a marker of LV telomere length, we measured telomere length in circulating leukocytes and matching LV tissue from 13 wk old NHR and HHR. As with LV telomere length, LTL was significantly shorter in 13 wk old HHR compared with age-matched NHR (NHR 3.65 ± 0.07 vs. HHR3.47 ± 0.06, NHR 12,081 bp vs. NHR 11,647 bp, P = 0.048, Fig. 1C). Moreover, there was a positive correlation between cardiac and leukocyte telomere length (r = 0.448, P = 0.031, Fig. 1D). This correlation was driven by the HHR (r = 0.81, P = 0.026), while in the NHR we did not find a significant correlation (r = 0.18, P = 0.605).

Telomerase activity.

In accordance to telomere length, neonatal HHR had significantly higher telomerase activity (NHR 13,768 ± 1,254 vs. HHR 51,040 ± 4,618, P < 0.0001, Fig. 2A); however, at 13 (NHR 1,416 ± 350.6 vs. HHR 786.8 ± 181.1, P = 0.146) and 38 wk old (NHR 808.1 ± 307.2 vs. HHR 809.3 ± 213.4, P = 0.997) we did not discover significant difference in telomerase activity between strains (Fig. 2A). Neonatal NHR and HHR had significantly higher telomerase activity than all other ages (all P < 0.01, Fig. 2A). Moreover, telomerase activity was correlated to telomere length (r = 0.27, P = 0.035, Fig. 2B), especially in the control strain (r = 0.51, P = 0.005, Fig. 2C).

Fig. 2.

Cardiac telomerase activity in ageing HHR and NHR. A: neonatal HHR has significantly higher left ventricular telomerase activity compared with NHR. At 13 and 38 wk, we did not discover significant difference in telomerase activity between strains (n = 7–11 per group per age). Neonatal NHR (#) and HHR (†) had significantly higher telomerase activity than all other ages. B: telomerase activity was correlated to telomere length (r = 0.27, P = 0.035), especially in the control strain (C) (r = 0.51, P = 0.005). D: neonatal and 38 wk old HHR had significantly higher Tert mRNA than age-matched NHR. Neonatal NHR had significantly higher Tert mRNA than all other ages (#). Thirteen-week-old HHR had significantly lower Tert mRNA than other ages (†). E: we did not discover significant difference in Terc RNA between HHR and NHR at any of the ages studied. Thirty eight-week-old NHR (#) and HHR (†) had significantly higher Terc RNA levels than other ages. Graphs represent means, error bars represent SE. *P < 0.05, †††P < 0.001, ##P < 0.01, ###P < 0.001.

Genes involved in telomere maintenance.

Tert mRNA was upregulated in 2 days (+1.4, P = 0.021) and 38 wk old HHR (+19.0, P < 0.001) (Fig. 2D) compared with age-matched NHR, while we did not discover significant difference at 13 wk (+1.3, P = 0.07). In the NHR, Tert mRNA was the lowest at 38 wk of age, at the same that the shorter telomeres were observed (Fig. 2D). In the HHR, Tert mRNA was highest in 2 days and 38 wk old. In accordance to telomere length, Tert mRNA was the lowest at 13 wk of age (Fig. 2D).

Terc RNA levels did not significantly differ between the HHR and NHR in 2-day (−1.1, P = 0.264) and 13 wk old animals (−2.1, P = 0.098) (Fig. 2E). Thirty eight-week-old HHR had significantly higher Terc RNA (+1.94, P = 0.018, Fig. 2E). In both NHR and HHR, Terc RNA was significantly higher at 38 wk of age compared with all other age groups (Fig. 2E).

miR-34a and Ppp1r10 expression.

The miRNA miR-34a was significantly overexpressed in HHR compared with the NHR at 2 days (+1.9, P = 0.004) and 13 wk (+1.8, P < 0.0001), but downregulated at 38 wk (−6.9, P = 0.019) of age (Fig. 3A). In regards to miRNA levels within strains, miR-34a had the highest expression at 38 wk of age compared with other ages in the both the NHR (Fig. 3A) and HHR strains (Fig. 3A) (all P < 0.01).

Fig. 3.

The expression of microRNA (miR)-34a and its target gene Ppp1r10 in the development of left ventricular hypertrophy. A: miR-34a was significantly overexpressed at 2 days and 13 wk old HHR, and downregulated at 38 wk of age compared with age-matched NHR (n = 7–11 per group per age). Thirty eight-week-old HHR (†) and NHR (#) had significantly higher levels of miR-34a compared with other ages. B: 38 wk old HHR had significantly higher Ppp1r10 mRNA levels than age-matched NHR. Thirteen-week-old HHR (†) had significantly lower Ppp1r10 mRNA than other ages. Neonatal NHR (#) had significantly higher Ppp1r10 mRNA than other ages. Graphs represent means, error bars represent SE. *P < 0.05, ††P < 0.01, †††P < 0.001, #P < 0.05, ###P < 0.001.

Ppp1r10 was previously described as a target of miR-34a in the mouse heart (3). It also plays a role in the regulation of antiapoptotic effects in cardiomyocytes (3). Since miR-34a is overexpressed in the HHR, we measured Ppp1r10 levels. Ppp1r10 mRNA was nonsignificantly downregulated in the HHR compared with the NHR at 2 days (−1.2, borderline P = 0.062) and 13 wk (−1.35, P = 0.14, Fig. 3B), but overexpressed at 38 wk (+28.1, P < 0.001) of age (Fig. 3B). In regards to Ppp1r10 expression within strains, mRNA levels in the HHR were significantly lower at 13 wk of age (P < 0.0001, Fig. 3B). In the NHR, Ppp1r10 mRNA levels were significantly higher at 2 days (P < 0.0001) and lower at 38 wk of age (P = 0.012, Fig. 3B). Ppp1r10 mRNA was borderline negatively correlated with miR-34a levels in all ages besides 38 wk (2-day r = −0.38, P = 0.067 and 13 wk old r = −0.35, P = 0.067).

Regression analyses.

In a step-wise regression analysis, Tert mRNA and miR-34a levels were the only statistically significant predictors of heart telomere length in both strains at all ages (Table 3). According to the standardized β-coefficients, miR-34a effect was stronger than Tert levels. In a similar analysis of the development of hypertrophy (2 days and 13 wk old), Tert was the only determinant of cardiac telomere length (β = 0.02, SE = 0.008, P = 0.01). In postneonatal development, miR-34a was the only molecular variable negatively associated with telomere length [β = −0.02, SE = 0.003, 95% confidence interval (CI) −0.031 to −0.017, P = 0.001], suggesting its effects are independent of telomerase activity at this age. Similar results were found in 38 wk old HHR (β = −0.02, SE = 0.005, 95% CI −0.031 to −0.011, P = 0.001).

Table 3.

Association between cardiac telomere length and molecular variables

Variable	β ± SE	Standardized β	95% CI	P Value
miR-34a	−0.02 ± 0.003	−0.62	−0.03 to −0.14	<0.001
Tert mRNA	0.015 ± 0.007	0.22	0.001 to 0.03	0.036

Results are from a step-wise regression analyses used to determine the predictors of cardiac telomere length, including miR-34a, Ppp1r10, Terc, Tert, telomerase activity, and strain as independent variables (F-entry probability: 0.05, removal: 0.1).

CI, confidence interval.

DISCUSSION

Dissecting the effect of telomere length on polygenic LV hypertrophy and heart failure has been hindered by the difficulty of obtaining human cardiac tissue and by the lack of animal models for the disease that are not affected by pressure overload. Here we set out to investigate the changes in telomere length during the development of polygenic LV hypertrophy and progression to heart failure. The hypertrophic model is born with longer telomeres, higher telomerase activity, and smaller hearts compared with the normal strain. This is followed by accelerated shortening of telomeres paralleled to an increase in LV mass. Changes in telomere length were linked to dysregulation of the telomeric regulators miR-34a and Tert mRNA in the hypertrophic strain. Other molecular changes associated with telomere length at some ages included fluctuations in Ppp1r10 mRNA, Terc RNA, and telomerase activity. These findings indicate an increased impairment in cell division (21) during a crucial age for heart development (27, 32), which then restricts the response of the remaining cardiomyocytes to hypertrophy and predisposes the heart to failure (16).

The concept of being born smaller and having longer telomeres, as observed in the HHR, is consistent with results found in young men born small due to intrauterine growth restriction (19). The longer telomeres in 2-day-old HHR could, at least in part, be genetically determined and be due to fewer cell divisions in the heart during embryogenesis. This would also explain the fewer cardiomyocytes previously found in this strain (31). Furthermore, recent studies in mice have shown that cardiomyocytes proliferate until postnatal day 7 (32), which is followed by another proliferative burst in the third week of life (27). In this regard, it is possible that cardiomyocytes in the HHR may be forced to divide more to compensate for their lower cell number, which would contribute to the accelerated telomere attrition between 2 days and 13 wk of age. Furthermore, cardiomyocytes produced from cells with short telomeres inherit this defect and quickly acquire the senescent phenotype (16). This limits the adaptive response of these cells to hypertrophy (16, 34), highlighting the possible causal involvement of short telomeres in cardiomyocyte hypertrophy.

In the current study we also found significantly higher telomerase activity in neonatal HHR, which could contribute to the longer telomeres in these animals. In the HHR, telomerase activity decreased by 60 times between 2 days and 38 wk of age, while in the NHR this was phenomenon was less accentuated (17 times less telomerase activity at 38 wk). This acute decrease in telomerase activity is likely to contribute to the reduced telomere length in the HHR as well as possibly reduce cell viability independently of telomere length as previously found in endothelial cells (13, 39, 43).

Another key finding of this study was the overexpression of miR-34a since neonatal age in the HHR. During normal development, overexpression of miR-34a was only previously reported in the ageing heart, a phenomenon that leads to cell death (14). This suggests that the upregulation of this miRNA early in life could be involved in the reduced complement of cardiomyocytes of this strain (31), thereby inducing compensatory hypertrophy in the remaining cardiomyocytes (16, 34). After 2 days, postnatally accelerated telomere shortening is driven by miR-34a, and this is likely to contribute to the development of LV hypertrophy. Indeed, therapies targeting miR-34a or miR-34 family, such as the ones administered by Bernardo and colleagues (1, 2), were shown to have beneficial effects in the diseased heart. Furthermore, we found that Ppp1r10 mRNA, a target of miR-34a, was downregulated in the HHR, and this gene is known to have an important role in telomere maintenance by directly interacting with nonredundant shelterin protein, telomeric repeat binding factor 2 (Trf2) (17, 30). Indeed, in primary rat cardiomyocytes, defective expression of Trf2 causes accelerated telomere attrition and increased apoptosis (30). Furthermore, Trf2 protects against apoptosis even in nondividing cells (20), highlighting its importance in the mostly nonmitotic heart.

Consistent with the documented positive correlation between LV mass and longer LTL in humans (18, 42), 38 wk old HHR had significantly longer telomeres than the age-matched controls. Importantly, however, our data indicate that telomere length in the HHR does not show significant increase with ageing (2 days old 11,743 bp vs. 38 wk old 11,333 bp). Instead, telomeres were longer at birth and then become shorter early in development, with no significant changes observed thereafter. Indeed, cardiomyocyte division in adulthood happens at a slower pace, accounting for only a fraction of the telomere attrition observed throughout the lifespan (32). In the NHR, however, telomeres got significantly shorter later in life, between 13 and 38 wk of age. These findings suggest that the relative importance of the various mechanisms involved in telomere maintenance differ between normal and hypertrophic hearts.

The longer telomere length in the presence of LV hypertrophy may seem paradoxical, but the adaptive response of the heart to stress is a ubiquitous theme in the literature. For instance, cardiomyocyte division and telomerase activity in dogs were increased with the onset and further again with the progression of ventricular dysfunction (24). Similar results have been found in human hearts after myocardial infarction (40). Furthermore, in a mouse model of Akt-induced LV hypertrophy, increased expression of angiogenic growth factors is found in the adaptive phase of hypertrophy, but a reduction in the transition to heart failure (38). Taken together, these findings demonstrate that acute stress on the heart induces compensatory mechanisms that become attenuated and then exhausted if the disease progresses. In this regard, it would be interesting to determine telomere length in the HHR at the time of death due to heart failure, which begins to occur around 48 wk of age (31), but unfortunately samples were not available. Based on this explanation, we would expect a sharp decrease in telomere length in the failing heart, which has been well documented previously (30, 41, 45).

Although the use of qPCR to measure relative telomere length is widely used in the literature (6, 7, 10), this needs to be acknowledged as a limitation. Previous studies, however, have shown that this method is reliable, and the results are highly comparable to other techniques, such as mean terminal restriction fragment length (5), Southern blots and single telomere length analysis (25). Moreover, we have previously shown that telomere length varies according to the method of DNA extraction (9). In the present study, all samples were collected, processed, and extracted by the same method, and samples were run in the same qPCR plate to minimize variation. Therefore, we believe the results presented here are highly robust.

In this study we showed a correlation between LTL and telomere length in both LV tissue and isolated cardiomyocytes. Consistent with the established phenomenon of telomere synchrony (8), our findings support the use of LTL as a marker of LV telomere length in hypertrophic hearts (r = 0.81, P = 0.026), although we did not find a correlation in the control strain. Furthermore, the accelerated shortening of telomeres early in the life of the hypertrophic model suggests that telomere attrition plays an important role in the development of LV hypertrophy. Our data also support the hypothesis that Tert mRNA and miR-34a are the main determinants of telomere length. We found dysregulation of miR-34a from an early age, which may play a role in both telomere attrition and cell death, further predisposing to the development of LV hypertrophy.

Short telomeres in leukocytes are associated with increased heart disease. LV hypertrophy is one of the main risk factors for heart disease, yet the effect of telomere length on this condition is still poorly understood, mainly due to the influence of BP on cardiac mass. This study demonstrates that telomeres in cardiomyocytes have an important role in the development of LV hypertrophy in a normotensive model. There is accelerated shortening of telomeres after 2 days of birth paralleled with increased cardiac mass. Combined with previous studies, our data support the notion that the mechanisms for these telomeric changes are likely to be due to perturbations in Tert and miR-34a expression. This miRNA could also be potentially used for therapeutic intervention for LV hypertrophy before the development of end-stage disease.

GRANTS

This work was supported by National Health & Medical Research Council of Australia (NHMRC) Project Grant APP1034371, National Heart Foundation Grant G10M5155, and the Federation University Australia “Self-sustaining Regions Research and Innovation Initiative,” an Australian Government Collaborative Research Network. S. A. Booth is supported by an Australian Postgraduate Award scholarship. F. Z. Marques is supported by NHMRC Grant APP1052659 and National Heart Foundation Grant PF12M6785 coshared Early Career Fellowships. P. R. Prestes is supported by a Robert HT Smith Fellowship from Federation University.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

AUTHOR CONTRIBUTIONS

Author contributions: F.Z.M., L.M.D.D., S.B.H., and F.J.C. conception and design of research; F.Z.M., S.A.B., P.R.P., C.L.C., and P.L. performed experiments; F.Z.M. and S.A.B. analyzed data; F.Z.M. and S.A.B. interpreted results of experiments; F.Z.M. prepared figures; F.Z.M. and S.A.B. drafted manuscript; F.Z.M., S.A.B., P.R.P., C.L.C., L.M.D.D., P.L., S.B.H., and F.J.C. edited and revised manuscript; F.Z.M., S.A.B., P.R.P., C.L.C., L.M.D.D., P.L., S.B.H., and F.J.C. approved final version of manuscript.