Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2016 Apr 26;113(19):E2589–E2597. doi: 10.1073/pnas.1519458113

Canonical and noncanonical intraflagellar transport regulates craniofacial skeletal development

Kazuo Noda a,1,2, Megumi Kitami a,2, Kohei Kitami a,b, Masaru Kaku c, Yoshihiro Komatsu a,d,3
PMCID: PMC4868419  PMID: 27118846

Significance

Intraflagellar transport (IFT) plays a critical role in assembling primary cilia that mediate growth factor signaling. The disruption or dysfunction of IFT components can generate multiple diseases, including skeletal dysplasia. However, the mechanism by which IFT regulates skeletogenesis remains elusive. In the present study, we show that neural crest-specific deletion of the gene that encodes intraflagellar transport 20 (IFT20) in mice compromises ciliogenesis and the intracellular transport of collagen, leading to osteopenia in the face. Our findings highlight a unique function of IFT beyond its role in cilium assembly during craniofacial development, suggesting that IFT20 is indispensable for the regulation of not only ciliogenesis but also the intracellular trafficking of collagen in the unique multipotent stem cell population of cranial neural crests.

Keywords: cranial neural crest cells, intracellular trafficking, intraflagellar transport, PDGF signaling, primary cilia

Abstract

The primary cilium is a cellular organelle that coordinates signaling pathways critical for cell proliferation, differentiation, survival, and homeostasis. Intraflagellar transport (IFT) plays a pivotal role in assembling primary cilia. Disruption and/or dysfunction of IFT components can cause multiple diseases, including skeletal dysplasia. However, the mechanism by which IFT regulates skeletogenesis remains elusive. Here, we show that a neural crest-specific deletion of intraflagellar transport 20 (Ift20) in mice compromises ciliogenesis and intracellular transport of collagen, which leads to osteopenia in the facial region. Whereas platelet-derived growth factor receptor alpha (PDGFRα) was present on the surface of primary cilia in wild-type osteoblasts, disruption of Ift20 down-regulated PDGFRα production, which caused suppression of PDGF-Akt signaling, resulting in decreased osteogenic proliferation and increased cell death. Although osteogenic differentiation in cranial neural crest (CNC)-derived cells occurred normally in Ift20-mutant cells, the process of mineralization was severely attenuated due to delayed secretion of type I collagen. In control osteoblasts, procollagen was easily transported from the endoplasmic reticulum (ER) to the Golgi apparatus. By contrast, despite having similar levels of collagen type 1 alpha 1 (Col1a1) expression, Ift20 mutants did not secrete procollagen because of dysfunctional ER-to-Golgi trafficking. These data suggest that in the multipotent stem cells of CNCs, IFT20 is indispensable for regulating not only ciliogenesis but also collagen intracellular trafficking. Our study introduces a unique perspective on the canonical and noncanonical functions of IFT20 in craniofacial skeletal development.


Intraflagellar transport (IFT) proteins are required for the assembly of primary cilia (1, 2), which coordinate signaling pathways that are critical for governing cell proliferation, differentiation, survival, and homeostasis (3, 4). Mutations in ciliary proteins result in a diverse set of clinical disorders, termed ciliopathies, which include a wide variety of skeletal phenotypes (5, 6). IFT proteins organize into two complexes, IFT-A and IFT-B (2, 7). IFT-B proteins mediate anterograde transport from the cell body to the cilium tip, whereas IFT-A proteins regulate retrograde trafficking. Genes encoding IFT-A proteins are commonly altered in skeletal ciliopathies. For example, IFT122, IFT140, and IFT144 are frequently mutated in Sensenbrenner and Jeune syndromes, indicating that all six IFT-A components are linked to skeletal ciliopathies (8–10). Conversely, with the exception of IFT80 and IFT172 in Jeune asphyxiating thoracic dystrophy (11, 12), the function of IFT-B complexes in skeletal diseases is unknown.

Intraflagellar transport 20 (IFT20) is the smallest IFT protein in the IFT-B complex and interacts with IFT57/Hippi and the kinesin-II subunit KIF3B (13). Conventional Ift57 and Kif3a/Kif3b null mutations in mice lead to early embryonic lethality due to left–right axis defects, accompanied by a loss of nodal cilia (14–16), suggesting that the IFT-B complex is critical for ciliogenesis. Supporting this idea, the deletion of Ift20 in mouse kidney causes a lack of primary cilia and leads to polycystic kidney disease (17). In addition to the traditional role of IFT in cilium assembly, recent studies have found that an IFT-like particle organized by IFT20 is recruited to the immune synapse for T-cell receptor recycling (18, 19). These studies suggest that IFT proteins participate in intracellular membrane trafficking in immune cells; however, it remains unclear how IFT20 governs developmental processes, including skeletal formation, and how it functions in other cell types, such as multipotent stem cells.

Several rare pleiotropic diseases that affect craniofacial skeletal formation show disruption in primary cilia (20, 21), and oral-facial-digital (OFD) syndrome and Bardet–Biedl syndrome (BBS) are related to ciliary dysfunction (22, 23). Consistent with the findings in humans, mutations in Ofd1 in mice and zebrafish cause severe craniofacial abnormalities, including cleft palate and shortened Meckel’s cartilage (22, 24). Both patients and mice with a mutant BBS6 gene display similar broad midfacial malformation and nasal hypoplasia (23). Disrupting ciliogenic components in cranial neural crest cells (CNCCs) frequently results in embryonic and/or postnatal craniofacial abnormalities (25, 26), indicating a tight relationship between primary cilia and craniofacial morphogenesis. Because CNCCs are multipotent stem cells essential for forming craniofacial skeletal components (27, 28), it is important to understand how primary cilia function in CNCCc during facial development.

The purpose of this study is to investigate the molecular function of IFT20 in a multipotent stem cell population during craniofacial development. We found that IFT20 plays a vital role in controlling not only ciliogenesis but also the intracellular trafficking of collagen in CNCCs, demonstrating a function of IFT beyond its role in ciliogenesis during facial skeletal formation.

Results

Disruption of Ift20 in Neural Crest Cells Results in Craniofacial Malformation.

To characterize the function of IFT20 in facial development, we disrupted Ift20 in a neural crest-specific manner using the wingless-related MMTV integration site 1 (Wnt1)-Cre driver line (17, 29) (Fig. S1 A and B; Ift20:Wnt1-Cre or cKO hereafter). Neural crest-specific deletion of Ift20 led to severe craniofacial malformation in mice (Fig. 1). Ift20:Wnt1-Cre embryos were born at Mendelian ratios (Table S1), but had hypertelorism and frontonasal dysplasia with 100% phenotypic penetrance (Fig. 1A). Ift20:Wnt1-Cre mice were found dead with no milk spot, indicating that they died shortly after birth due to difficulties in feeding and breathing. Histological analysis revealed that Ift20:Wnt1-Cre embryos had an abnormal expansion of the facial midline and lacked major craniofacial components, including the palatal shelves and a tongue, at embryonic day (E) 18.5 (Fig. 1A and Fig. S1C). Skeletal staining of Ift20:Wnt1-Cre mice found either a loss or a truncation of craniofacial bones (Fig. 1B). The maxillary and mandibular bones and palatal process of the maxilla in Ift20:Wnt1-Cre mice were hypoplastic, whereas the palatal process of the palatine and pterygoid were absent (Fig. 1B). Ift20:Wnt1-Cre mice had malformed nasal and frontal bones, with an opening in the metopic suture (Fig. 1B), suggesting that cranial neural crest (CNC)-derived facial bones were severely compromised. Mice with neural crest-specific inactivation of Kif3a, a member of the kinesin superfamily required for ciliogenesis, also show bifid nasal cartilage, severe cleft palate, and widely separated frontal bones (30, 31), similar to the features observed in our Ift20:Wnt1-Cre embryos. Because IFT20 appears to bridge the kinesin-II complex (KIF3A/KIF3B) (13), the phenotypic analysis of Ift20:Wnt1-Cre mice further reinforces the idea that there is a link between IFT20 and KIF3A, demonstrating that ciliary dysfunction due to IFT components contributes to a range of craniofacial abnormalities.

Fig. S1.

Fig. S1.

Generation of mice with a conditional deletion of Ift20 in neural crest cells. (A) Schematic illustration of the mating strategy to obtain Ift20:Wnt1-Cre (cKO) mice. (B) Ift20 expression in nasal and frontal bones at E17.5 was examined by quantitative RT-PCR (data are represented as mean ± SD, n = 3 in each group; *P < 0.01). Expression levels were normalized to Gapdh expression. (C) H&E staining of sections from control (WT) and cKO embryos at the indicated stage. (Scale bar: 1 mm.)

Fig. 1.

Fig. 1.

Neural crest cell-specific Ift20 deletion causes craniofacial abnormalities in mice. (A, Left and Middle) Lateral and frontal views of the face of a control (WT) and a Ift20:Wnt1-Cre (cKO) mouse at birth (NB). (A, Right) H&E staining of sections from WT and cKO embryos at E18.5. (Scale bar: 1 mm.) (B) Alcian blue- and Alizarin red-stained skulls of a WT and a cKO mouse at NB. Arrows indicate bifid nasal cartilage. Note that the frontal bones of Ift20:Wnt1-Cre mice are not only separated by a large open space but are also less mineralized (asterisk). bo, basioccipital; bs, basisphenoid; eo, exoccipital; fb, frontal bone; ib, interparietal bone; jb, jugal bone; md, mandible; mx, maxilla; nb, nasal bone; p, palatine; pb, parietal bone; pmx, premaxilla; ppmx, palatal process of maxilla; ppp, palatal process of palatine; ptg, pterygoid; tr, tympanic ring. (Scale bar: 2 mm.)

Table S1.

Genotype analysis of Ift20:Wnt1-Cre mice

Stage Ift20F/+:Cre− Ift20F/F:Cre− Ift20F/+:Cre+ Ift20F/F:Cre+ Total
E12.5 6 (18.2%) 13 (39.4%) 7 (21.2%) 7 (21.2%) 33
E13.5 1 (12.5%) 3 (37.5%) 1 (12.5%) 3 (37.5%) 8
E14.5 5 (20.8%) 6 (25.0%) 8 (33.3%) 5 (20.8%) 24
E16.5 4 (9.1%) 19 (43.2%) 14 (31.8%) 7 (15.9%) 44
E17.5 5 (10.6%) 7 (14.9%) 18 (38.3%) 17 (36.2%) 47
E18.5 22 (22.9%) 32 (33.3%) 28 (29.2%) 14 (14.6%) 96
 Total 43 (15.7%) 80 (32.2%) 76 (27.7%) 53 (24.4%) 252

Because epithelial–mesenchymal interactions are essential in craniofacial morphogenesis (21, 27), we also deleted Ift20 in an epithelial cell-specific manner using the keratin 14 (K14)-Cre driver line (32). Epithelial-specific deletion of Ift20 (Ift20:K14-Cre) did not induce overt abnormalities in the craniofacial regions (Fig. S2), but Ift20:K14-Cre mice displayed abnormal skin phenotypes, including fewer hair follicles than control mice (Fig. S3). These results suggest that IFT20 is indispensable for facial development in CNC-derived mesenchymal cells, but not in epithelial cells. In this study, we focused on the analysis of the molecular mechanisms of IFT20 in CNC-derived bones during skull development.

Fig. S2.

Fig. S2.

Epithelial cell-specific deletion of Ift20 does not affect craniofacial development. (A and B) Alcian blue- and Alizarin red-stained skulls of the WT and Ift20:K14-Cre (cKO) mice at birth (NB). (Scale bars: 2 mm.) (C) H&E staining of sections from WT and Ift20:K14-Cre mice at NB. fb, frontal bone; ib, interparietal bone; md, mandible; mx, maxilla; nb, nasal bone; pb, parietal bone; pmx, premaxilla. (Scale bar: 1 mm.)

Fig. S3.

Fig. S3.

Epithelial cell-specific deletion of Ift20 causes hair follicle morphogenesis defects. (Left and Middle) Gross appearances of WT and Ift20:K14-Cre (cKO) mice at postnatal day (P) 7. (Right) H&E staining of longitudinal sections of dorsal skin in WT and Ift20:K14-Cre mice at NB. (Scale bar: 100 μm.)

IFT20 Assembles the Primary Cilia That Induce PDGF Signaling Required for Osteogenic Proliferation and Survival During Skull Formation.

Because IFT20 is important for primary cilia assembly (17, 33), we attempted to identify the primary cilia, using immunohistochemistry, in control and Ift20:Wnt1-Cre embryos. In control embryos at E12.5, CNC-derived osteogenic cells, which were labeled with RUNX2, a key regulator of osteoblasts, had primary cilia (Fig. 2A, Left). On the other hand, Ift20:Wnt1-Cre embryos had no primary cilia in their CNC-derived osteogenic cells (Fig. 2A, Right), demonstrating that IFT20 is essential for ciliogenesis in CNC derivatives.

Fig. 2.

Fig. 2.

IFT20 is indispensable for ciliogenesis, PDGFRα signaling, and the proliferation and survival of osteoblasts. (A) Immunostaining for RUNX2 (orange), acetylated tubulin (Ac-Tu, green), and gamma-tubulin (γ-Tu) (magenta) on sections from WT and cKO embryos at E12.5. Arrows show primary cilia. (Scale bars: Upper, 200 μm; Lower, 5 μm.) (B–H) Primary osteoblasts were harvested from E18.5 calvaria (nasal and frontal bones) of WT and cKO embryos. For further analysis, cells were cultured for 9 d in osteogenic medium. (B) Immunofluorescence images of primary osteoblasts labeled with Ac-Tu (green), γ-Tu (magenta), and PDGFRα (cyan). Arrows show primary cilia. (Scale bar: 5 μm.) (C) Quantitative RT-PCR analysis for Ift20 and Pdgfra. Expression levels were normalized to Gapdh expression. (D) Immunoblot analysis of cell lysates. (E) Quantification of the relative protein levels of PDGFRα. (F) WT and cKO osteoblasts were treated with PDGF-ascorbic acid (AA) (50 ng/mL) and harvested to analyze the activation of PDGFRα (P-PDGFRα). (G) Akt phosphorylation (P-Akt) was examined by Western blot after PDGF-AA stimulation. (H) Quantification of the relative protein levels of P-Akt in the cells treated with PDGF-AA for 10 min. (I) Coronal sections at E16.5 of WT and cKO frontal bones were double-labeled with OSX (green) and Ki-67 (magenta) to detect osteoblastic cells and proliferative cells, respectively. Asterisks show nonspecific staining of blood cells. (Scale bar: 50 μm.) (J) Quantification of Ki-67–positive cells in OSX-positive cell populations at the indicated stages. (K) TUNEL staining of sections of WT and cKO frontal bones at E16.5. (Scale bar: 50 μm.) (L) Quantification of TUNEL-positive cells in the frontal bone area at the indicated stage. Data in C, E, H, J, and L are represented as mean ± SD, n = 3 in each group. *P < 0.05. N.S., not significant.

Ciliary defects lead to craniofacial abnormalities due to disruptions in Hedgehog signaling (8, 23, 30). However, it remains elusive whether ciliary-mediated Hedgehog is the sole signal axis to govern facial bone development. For instance, neural crest-specific Smoothened (Smo) mice display skull abnormalities (34); therefore, one might predict that Smo in primary cilia transduces the Hedgehog signaling in skull formation. However, it is not known if Smo is present on cilia in CNC derivatives. This notion raises the question of whether the phenotypes in Smo mutants are attributed to the alterations of ciliary-dependent Hedgehog signaling. Importantly, our analyzed Ift20 mutants showed a skull phenotype distinct from the phenotype in other cilia-deficient mice. Whereas neural crest-specific Kif3a mutants display a metopic craniosynostosis with the alteration of Hedgehog signaling (30, 35), Ift20 mutants did not show any premature suture fusions (Fig. 1B). These notions let us hypothesize that other ciliary-dependent signaling, rather than Hedgehog, would be responsible for skull malformation in Ift20 mutants. To address this hypothesis, we examined platelet-derived growth factor (PDGF) signaling in Ift20:Wnt1-Cre embryos.

PDGF receptor alpha (PDGFRα) is localized on the surface of primary cilia in fibroblasts (36). The disruption of PDGFRα-PI3K signaling in CNCCs causes cleft palate and separated frontal bones (37). Thus, we hypothesized that PDGFRα on the surface of primary cilia in CNCCs regulates osteogenic proliferation and cell survival during skull formation. To investigate this idea, we established cultures of primary osteoblasts from nasal and frontal bones, which are CNC-derived (27). Consistent with a previous report (36), PDGFRα localized to the primary cilia in control osteoblasts (Fig. 2B); however, due to the absence of primary cilia, it was not observed in Ift20:Wnt1-Cre osteoblasts but was still present on the cell surface (Fig. 2B). Quantitative RT-PCR and Western blot analysis confirmed that the transcriptional and translational levels of PDGFRα were reduced in Ift20:Wnt1-Cre osteoblasts (Fig. 2 C–E). To determine whether the loss of PDGFRα in primary cilia attenuated PDGF-driven intracellular signaling, we measured the activation of PDGFRα and the induction of Akt phosphorylation, one of the effectors of PDGF signaling (38). Control osteoblasts stimulated with PDGF ligand [PDGF-AA] robustly activated PDGFRα and induced Akt phosphorylation, but Ift20:Wnt1-Cre osteoblasts did not (Fig. 2 F–H). These results suggest that PDGFRα, localized to primary cilia, regulates Akt phosphorylation through PDGFRα activation, which may govern multiple cascades of cellular events in osteoblasts.

To investigate these cellular events, we first evaluated osteogenic differentiation by using preosteoblast markers RUNX2 and Osterix (OSX). At E12.5, the RUNX2-positive area in frontal bone primordia was comparable between control and Ift20:Wnt1-Cre embryos (Fig. S4A). During middle to late gestation, OSX-positive cells in the frontal bone were also equally distributed between the two groups (Fig. S4B). Next, we examined cell proliferation in embryonic skulls using Ki-67 immunohistochemistry and costaining with OSX. Whereas the levels of OSX were normal, Ift20:Wnt1-Cre embryos had reduced cell proliferation compared with controls at E16.5 (Fig. 2 I and J). We further analyzed osteogenic cell survival using a TUNEL assay. Compared with controls, there was a significant increase in the amount of cell death in Ift20:Wnt1-Cre embryos (Fig. 2 K and L), suggesting that primary cilia-mediated PDGF signaling in osteoblasts plays a critical role in regulating both osteogenic cell proliferation and cell survival. Together, these results indicate that IFT20 is essential for primary cilia formation and controls both osteoblast proliferation and survival through PDGF signaling during skull formation.

Fig. S4.

Fig. S4.

Osteogenic differentiation is normal in cKO embryos. (A) Immunostaining for RUNX2 of sections from WT and cKO embryos at E12.5. Three individual (#1, #2, and #3) WT and cKO embryos were examined. (Scale bar: 200 μm.) (B) Quantification of OSX-positive cell populations in the areas shown in Fig. 2I at the indicated stages. Data are represented as mean ± SD, n = 3 in each group. N.S., not significant.

Attenuation of IFT20 Does Not Influence Osteogenic Differentiation, but Leads to Abnormal Bone Mineralization in the Skull.

Because IFT20 may regulate the onset of craniofacial skeletogenesis in middle to late gestation, we examined bone mineralization in control and Ift20:Wnt1-Cre embryos at E16.5. H&E staining showed continuous bone tissues in control skulls but not in Ift20:Wnt1-Cre skulls (Fig. 3A). The von Kossa staining revealed discontinuous calcium deposition in Ift20:Wnt1-Cre calvaria (Fig. 3A). OSX and collagen type 1 alpha 1 (Col1a1), both markers of osteoblast differentiation, were also analyzed using immunohistochemistry and section in situ hybridization. Both OSX and Col1a1 were normally produced and expressed in osteogenic tissues in control and Ift20:Wnt1-Cre skulls (Fig. 3A). Quantitative RT-PCR further confirmed that the expression of osteogenic differentiation genes, such as Runx2, Osx, Ibsp, and Ocn, was unchanged in the nasal and frontal bones of Ift20:Wnt1-Cre embryos (Fig. 3B), suggesting that IFT20 is not required for osteogenic differentiation but is necessary for the process of mineralization during skull development.

Fig. 3.

Fig. 3.

IFT20 is essential for osteogenic differentiation as well as for mineralization in vitro and in vivo. (A) H&E staining, von Kossa staining, immunofluorescent staining for OSX, and section in situ hybridization for Col1a1 for WT and cKO embryos at E16.5. Asterisks indicate the osteogenic front of frontal bones. Arrows show dotted calcium deposition. (Scale bars: 100 μm.) (B) Quantitative RT-PCR analysis of Runx2, Osx, Ibsp, and Ocn in WT and cKO calvaria (nasal and frontal bones) at E17.5 (data are represented as mean ± SD, n = 3 in each group). (C and D) Primary osteoblasts were harvested from E18.5 calvaria (nasal and frontal bones) of WT and cKO embryos. For advanced analysis, cells were cultured in osteogenic medium. (C) Bone nodule staining with Alizarin red. Three individual primary osteoblast cultures (#1, #2, and #3) from WT and cKO embryos were examined. (Scale bars: 100 μm.) (D) Collagen fiber organization was analyzed by picrosirius red staining after 2 wk of preosteoblast culture. (Scale bars: 100 μm.) (E) Picrosirius red staining of sections from WT and cKO embryos at E16.5. Asterisks indicate the osteogenic front of frontal bones. Arrows show reduced development of collagen fibers. (Scale bars: 100 μm.)

To address this hypothesis, we examined the process of mineralization using primary osteoblasts. After adding ascorbic acid and β-glycerol phosphate, an inducer of mineralization, both control and Ift20-mutant osteoblasts were examined. The control osteoblasts formed white clusters at 1 wk, becoming solid nodules that positively stained with Alizarin red within 2 wk (Fig. 3C). With Ift20:Wnt1-Cre osteoblasts, no cell clusters developed and few osteogenic nodules stained with Alizarin red (Fig. 3C). Because collagen fibrils are necessary for mineralization when skull bones are formed (39), we visualized the collagen in the cultured osteoblasts. Picrosirius red staining revealed that the amount of collagen produced by Ift20:Wnt1-Cre osteoblasts was less than the amount of collagen produced by control cells (Fig. 3D), and discontinuous collagen fibrils were observed in the skull of Ift20:Wnt1-Cre mice (Fig. 3E). Taken together, these results demonstrate that IFT20 is essential for normal mineralization in the skull.

IFT20 Controls Procollagen Trafficking from the Endoplasmic Reticulum to the Golgi Apparatus in CNC-Derived Osteoblasts.

Although the transcriptional levels of Col1a1 were comparable between control and Ift20:Wnt1-Cre embryos (Fig. 3A), the amount of collagen in the extracellular matrix was decreased in Ift20:Wnt1-Cre osteoblasts (Fig. 3 D and E). These results suggest that Col1a1 was transcribed normally and that procollagen was produced but was not secreted appropriately into the external cellular environment, thus leading to decreased collagen fibril formation. This finding prompted us to hypothesize that IFT20 participates in the intracellular trafficking of procollagen.

We first analyzed the localization of IFT20 in wild-type osteoblasts by costaining with the cis-Golgi marker GM130. Consistent with a previous report (40), IFT20 localized to the Golgi apparatus (Fig. S5). Staining of calnexin, the marker of endoplasmic reticulum (ER), further confirmed that IFT20 was not present in the ER (Fig. S6). Next, we examined whether the secretion of procollagen in Ift20-mutant osteoblasts was affected by treatment with ascorbic acid. Before ascorbic acid stimulation, procollagen was initially located in the ER (Fig. S7). After 2 h of ascorbic acid stimulation, the procollagen was smoothly transported into the Golgi in 80% of control osteoblasts. On the other hand, only 40% of Ift20-mutant osteoblasts showed collagen I transition to the Golgi, suggesting that procollagen secretion is slower than for the control cells. Procollagen secretion was still hampered at 3 h in Ift20-mutant osteoblasts. Although there were tendencies to delay procollagen secretion, Ift20-mutant osteoblasts could secrete procollagen to a similar extent as controls after 4 h of ascorbic acid stimulation (Fig. 4 A and B). These data suggest that procollagen transfer to the Golgi was slow at an early phase of collagen secretion, but once the osteoblasts started to secrete collagen I, there were not so many differences in intracellular collagen I localization between control and Ift20-mutant osteoblasts. Western blot analysis further verified that the procollagen in Ift20-mutant osteoblasts remained intracellularly much longer than in controls (Fig. 4 C and D), indicating that procollagen secretion is hampered by the dysfunction of ER-to-Golgi trafficking.

Fig. S5.

Fig. S5.

IFT20 is localized in the Golgi. Colocalization of IFT20 (green) and GM130 (magenta) was examined in control osteoblasts. (Scale bar: 20 μm.)

Fig. S6.

Fig. S6.

IFT20 is not localized in the ER. Colocalization of IFT20 (magenta) and calnexin (green) was examined in control osteoblasts. (Scale bar: 20 μm.)

Fig. S7.

Fig. S7.

Collagen I localizes in the ER without ascorbic acid stimulation. Colocalization of collagen I (red) and calnexin (green) was examined in control osteoblasts. (Scale bar: 20 μm.)

Fig. 4.

Fig. 4.

IFT20 is critical for the secretion of intracellular type I collagen by regulating its ER-to-Golgi trafficking in osteoblasts. (A and B) WT and cKO osteoblast cultures were treated with AA (50 µg/mL) for the indicated time and compared with untreated cells. (A) Coimmunostaining of type I collagen (collagen I) and GM130. Arrows show localization of intracellular collagen I in the Golgi. (Scale bar: 5 μm.) (B) Quantification of the percentage of the cells with collagen I in the Golgi. (C) Immunoblot analysis of intracellular collagen I. (D) Quantification of the relative protein levels of intracellular collagen I. Protein levels were normalized to α-tubulin. (E and F) Control and Ift20:Wnt1-Cre osteoblasts were transfected with the plasmid for VSVG-GFP. After incubation at 40 °C for 24 h, cells were shifted to 32 °C to allow VSVG-GFP transport from the ER into the Golgi. Cells were fixed at 0, 2.5, 5, and 10 min after shifting to 32 °C, followed by immunostaining for GFP and GM130. (E) Representative images of immunostaining at 5 min. Arrows show localization of VSVG-GFP to the Golgi. (Scale bar: 20 μm.) (F) Quantification of the percentage of coimmunostained cells in VSVG-GFP–positive cell populations. (G) Coimmunostaining of collagen I and GM130 in a WT skull and a cKO skull at E16.5 and E18.5. Arrows show the localization of intracellular collagen I in the Golgi. Asterisks show the osteogenic front. (Scale bar: 5 μm.) (H) Quantification of the percentage of cells with collagen I in the Golgi at the indicated stage. Data in B, D, F, and H are represented as mean ± SD, n = 3 in each group. *P < 0.05.

To monitor the dynamics of intracellular protein transport from the ER to the Golgi, we used a plasmid encoding vesicular stomatitis virus G protein tagged with EGFP (VSVG-GFP) (41). VSVG-GFP is a powerful tool used in the study of membrane transport because of its reversible misfolding and retention in the ER at 40 °C, and its ability to move out of the ER and into the Golgi upon reducing the temperature to 32 °C (41). We transfected control and Ift20-mutant osteoblasts with the VSVG-GFP plasmid and examined the movement of GFP using immunocytochemical costaining with GM130. After temperature reduction from 40 °C to 32 °C, GFP colocalized with GM130 within 5 min in the majority (84%) of control cells (Fig. 4 E and F). On the other hand, in the same time course, only 51% of Ift20-mutant osteoblasts showed colocalization (Fig. 4 E and F).

To gain further insight into the potential cellular mechanisms underlying the defective mineralization in Ift20:Wnt1-Cre embryos, we monitored the ER-to-Golgi transport of VSVG-GFP with time-lapse imaging. Live imaging revealed that GFP accumulated more slowly in the Golgi apparatus of Ift20 mutants than in the Golgi apparatus of control osteoblasts (Movies S1 and S2). Finally, we examined whether the transport of procollagen into the Golgi was affected in Ift20-mutant skulls in vivo. We noted that only osteoblasts near the osteogenic front of wild-type skulls were enriched for procollagen in the Golgi. Therefore, we focused on the area close to the osteogenic front. At E16.5, 55% of wild-type osteoblasts contained procollagen in the Golgi, whereas only 8% of Ift20-mutant osteoblasts had procollagen (Fig. 4 G and H). At E18.5, 50% of Ift20-mutant osteoblasts had procollagen in the Golgi compared with 70% of wild-type osteoblasts (Fig. 4 G and H), indicating that there is catching up, to some extent, of the delayed ossification in Ift20 mutants at E18.5, which is consistent with in vitro observations. These results suggest that IFT20 is required for the ER-to-Golgi transport of procollagen, which is a critical first step of procollagen intracellular trafficking during skull mineralization.

Taken together, we conclude that IFT20 plays a pivotal role in skull development through (i) the formation of primary cilia, which are required for mediating the PDGF signaling that controls both osteogenic proliferation and cell survival, and (ii) the regulation of the ER-to-Golgi transport critical for collagen secretion during skull development (Fig. 5).

Fig. 5.

Fig. 5.

Canonical and noncanonical IFT20 regulates craniofacial skeletal development. IFT20 is critical for regulating (i) the formation of primary cilia required for mediating PDGF signaling, which controls both osteogenic proliferation and cell survival, and (ii) ER-to-Golgi transport in the process of collagen secretion during skull development.

Discussion

IFT plays a crucial role in the assembly of primary cilia, which are highly conserved organelles that project from the surface of many cells. However, the details of how IFT governs craniofacial skeletal development remain elusive. In this study, we showed that IFT20 is required for assembling the primary cilia that control skeletogenic proliferation and cell survival through the precise regulation of PDGF signaling during craniofacial formation. We also found a potential link between IFT20 and procollagen trafficking, which may be important for the secretion of collagen. Our study introduces a unique perspective on the canonical and noncanonical functions of IFT20 in craniofacial skeletal formation.

IFT20 Is Essential for Assembling Primary Cilia That Transduce PDGF Signaling During Craniofacial Skull Formation.

Growth factor signaling in CNCCs regulates the patterning and growth of facial primordia (21, 27, 28). Although it has been widely recognized that primary cilia are projected like antennas and serve as either chemosensory or mechanosensory organelles, their role in CNCCs remains unclear. Because neural crest-specific loss of Pkd2, which encodes a mechanoreceptor in cilia, leads to multiple craniofacial anomalies at postnatal ages, but not in mice embryos (42), one might speculate that primary cilia predominantly function as chemosensors that mediate numerous growth factor signals during embryonic development (36, 43, 44). Consistent with a previous report analyzing the disruption of IFT20 in kidney development (17), IFT20 was required for the formation of primary cilia in CNC-derived osteogenic cells (Fig. 2 A and B), demonstrating that IFT20 plays an important role in assembling primary cilia that may transduce growth factor signaling in facial development.

During skull development, primary cilia might predominantly participate in the regulation of PDGF signaling, rather than in Hedgehog signaling. Supporting this idea, we found that one of the PDGF receptors, PDGFRα, clearly localized to the cilium surface in primary osteoblasts (Fig. 2B). In addition, we found that PDGF-Akt signaling through primary cilia is required for osteoblast proliferation and survival (Fig. 2 B–L). In agreement with the phenotype of mouse embryos with a CNCC-specific inactivation of Pdgfra (45), the control and Ift20-mutant embryos had a similar number of proliferating CNCC-derived osteogenic cells during early-middle gestation, but a much lower number during middle-late gestation in Ift20 mutants (Fig. 2J), indicating that PDGF signaling via primary cilia in CNCCs may not be essential at the early stage of osteoblastogenesis, but is required for cell proliferation and survival during late-stage skull development. However, we cannot exclude the possibility that Hedgehog signaling may also be involved in the molecular pathogenesis, because dysregulation of Hedgehog signaling has been frequently observed in ciliary mutants displaying skeletal dysmorphogenesis (46, 47). Although the localization of Smo to primary cilia has been identified in nodal cilia (44), a key question would be whether Hedgehog signaling mediators, including Smo, are present in the primary cilia of CNC-derived osteoblasts. This alternative possibility will need to be addressed to understand the synergistic regulatory mechanisms of growth factor signaling (e.g., PDGF and Hedgehog signaling) in primary cilia during skull formation.

IFT20 Is Critical for Regulating the Trafficking of Procollagen in CNC-Derived Osteoblasts.

Compared with other IFT-B proteins, IFT20 has an unusual distribution. In addition to being found in both primary cilia and the centrosome pool, it is present in the Golgi apparatus (40). This finding raises the possibility that IFT20 might participate in intracellular membrane trafficking, in addition to its role in ciliary assembly. Supporting this hypothesis, recent studies have demonstrated that IFT20 is associated with the trafficking of ciliary membrane proteins from the Golgi to the cilium, opsin trafficking, and membrane trafficking in lymphoid and myeloid cells (18, 19, 33, 48); however, it remains unclear whether IFT20 functions as a noncanonical IFT system during craniofacial skeletal development.

Ift20:Wnt1-Cre embryos showed immature bone mineralization (Fig. 1), but this phenotype was not simply explained by the down-regulation of osteogenic differentiation activities (Fig. 3). Osteoblastic differentiation genes, including Col1a1, were expressed normally; however, Ift20-mutant osteoblasts were not capable of mineralization to the same degree as controls. Our study suggests that this defect is because Ift20-mutant cells cannot secrete procollagen molecules into the external cellular environment within the same time course as controls (Fig. 4), demonstrating that IFT20 may be involved in procollagen trafficking of osteoblasts. Meanwhile, noncollagen factors secreted by bones may also be affected in Ift20:Wnt1-Cre mutants. For example, bioactivity of both bone morphogenetic protein-15 (BMP-15) and growth differentiation factor-9 (GDF-9) is tightly regulated by the Golgi-mediated secretory pathway (49, 50). Therefore, IFT20 might participate in the regulation of the secreting pathway of those growth factors in skull formation; this possibility needs to be clarified in the future.

In humans, mutations in SEC23A, a gene encoding a component of the coat protein complex II (COPII), cause craniolenticulosutural dysplasia (CLSD) (51, 52). CLSD is an autosomal recessive disorder characterized by skeletal defects and separated frontal bones, along with hypertelorism (53), resembling the features of Ift20:Wnt1-Cre embryos. COPII-coated vesicle formation is critical in anterograde protein trafficking from the ER to the Golgi apparatus (54). Whereas procollagen bundles exiting from the ER have a length of 300 nm, a much larger size than COPII can generally transport (39), studies suggest that large procollagen cargo might be transported to the Golgi by a specialized ER-Golgi intermediate compartment, known as the vesicular tubular cluster (VTC) complex, in a COPII-dependent manner (55). Because ER export complexes are composed of arrays of budding vesicles and cytoplasmic VTCs (56), this finding prompted us to hypothesize that IFT20 participates in the composition of VTCs and plays a role in procollagen trafficking from the ER to the Golgi, which is essential for the initial process of procollagen transport. Correspondingly, we found that procollagen transport from the ER to the Golgi was delayed in Ift20-mutant osteoblasts (Fig. 4). VSVG-GFP time-lapse imaging further revealed that the transport machinery was affected in Ift20 mutants (Movies S1 and S2), suggesting that IFT20 may be involved in ER export complexes.

The golgin GMAP210/TRIP11 anchors IFT20 to the Golgi complex, and both molecules function together in the trafficking of ciliary membrane proteins (40). An initial report suggests that loss of GMAP210/TRIP11 in mice alters glycosylation in the Golgi, leading to the intracellular accumulation of Perlecan in chondrocytes and resulting in a neonatal lethal form of skeletal dysplasia (57). However, recent studies suggest that GMAP210/TRIP11 is required for efficient membrane trafficking because it regulates vesicle tethering from the ER (56, 58, 59). Therefore, the IFT20–GMAP210 complex in CNC-derived osteoblasts may act in ER-to-Golgi trafficking.

In summary, our study introduces a unique perspective for canonical and noncanonical IFT function in craniofacial skeletal formation. Our findings may also contribute to our understanding of the molecular pathogenesis of skeletal ciliopathies.

Experimental Procedures

Animals.

Ift20-floxed mice (17), Wnt1-Cre mice (29), and K14-Cre mice (32) were obtained from The Jackson Laboratory. All mice were maintained in the animal facility of The University of Texas Medical School at Houston. The experimental protocol was reviewed and approved by the Animal Welfare Committee and the Institutional Animal Care and Use Committee of The University of Texas Medical School at Houston.

Skeletal Preparations, Histological Analysis, Immunofluorescent Staining, and TUNEL Assays.

Staining of bone and cartilage of embryos with Alizarin red/Alcian blue was carried out as described previously (60). H&E staining, immunofluorescent staining, and TUNEL assays of paraffin sections were performed as described previously (61). The von Kossa staining was performed using a von Kossa staining kit (Abcam; ab150687). Picrosirius red staining was performed using 1% picrosirius red solution (Sigma-Aldrich; 365548 and P6744). Section in situ hybridization was performed as previously described (62). Primary antibodies used in immunofluorescent staining were as follows: RUNX2 (1:400, Cell Signaling; no. 12556), acetylated tubulin (1:1,000, Sigma-Aldrich; T6793), gamma-tubulin (1:1,000, Sigma-Aldrich; T5326), OSX (1:200, Abcam; ab22552), Ki-67 (1:100, BD Biosciences; 550609), GM130 (1:200, BD Biosciences; 610822), calnexin (1:100, EMD Millipore; MAB3126), and collagen type I (1:200, Cedarlane; CL50151AP). Slides were viewed with an Olympus FluoView FV1000 laser scanning confocal microscope using the software FV10-ASW Viewer (version 3.1).

Isolation and Culture of Primary Osteoblasts.

We collected calvarial osteoblasts from control and Ift20:Wnt1-Cre embryos at E18.5. Nasal and frontal bones were subjected to five sequential digestions with an enzyme mixture containing 1 mg/mL collagenase type I (Sigma-Aldrich; C0130) and 1 mg/mL collagenase type II (Sigma-Aldrich; C6885). Cell fractions (from two to five of the sequential digestions) were collected and cultured in growth medium [α-MEM supplemented with 10% (vol/vol) FBS, 100 U/mL penicillin, and 100 mg/mL streptomycin] and in osteogenic medium (growth medium supplemented with 50 μg/mL ascorbic acid and 2 mM β-glycerol phosphate). For the analysis of PDGFRα signaling, cells were treated with 50 ng/mL PDGF-ascorbic acid (PeproTech; 315-17).

Western Blot Analysis.

We prepared the osteoblast lysates in radioimmunoprecipitation assay buffer. After centrifugation, the supernatants were separated by SDS/PAGE, blotted onto a PVDF membrane, analyzed with specific antibodies, and visualized with enhanced chemiluminescence. The antibodies used were as follows: α-tubulin (Abcam; ab7291), IFT20 (Proteintech; 13615-1-AP), PDGFRα (R&D Systems; AF1062), P-PDGFRα (Sigma-Aldrich; P8246-1VL), Akt (Cell Signaling; no. 9272), P-Akt (Cell Signaling; no. 4060), and collagen type I (Cedarlane; CL50151AP). The intensities of the immunostained bands were quantified with Image Lab Version 5.0 (Bio-Rad).

Protein Transport Assays and Immunocytochemistry.

Primary osteoblasts were transfected with the plasmid containing VSVG-GFP (Addgene; no. 11912), using Lipofectamine 3000 (Thermo Fisher Scientific), and incubated at 40 °C for 24 h. To shift the temperature from 40 °C to 32 °C, we used a Thermo Plate (Tokai Hit) for immunocytochemistry and a Stage Top Incubator (Tokai Hit) for time-lapse imaging. For quantification, 10 images were captured from one coverslip with at least 43 GFP-positive cells. This experiment was performed independently in triplicate. To analyze intracellular Col1a1, cells were cultured for 12 h after seeding and then treated or not treated with 50 μg/mL ascorbic acid. Cells were fixed with 4% (wt/vol) paraformaldehyde for 10 min at room temperature (RT) and permeabilized with 0.1% Triton X-100 in PBS (PBST) for 15 min at RT. They were then blocked in 2% (vol/vol) sheep serum in PBST for 30 min at RT before staining with primary antibodies. The primary antibodies used were as follows: acetylated tubulin (1:1,000, Sigma-Aldrich; T6793), gamma-tubulin (1:1,000, Sigma-Aldrich; T5326), PDGFRα (1:200, R&D Systems; AF1062), IFT20 (1:500, Proteintech; 13615-1-AP), GM130 (1:200, BD Biosciences; 610822), collagen type I (1:200, Cedarlane; CL50151AP), and GFP (1:500, Thermo Fisher Scientific; A-11122). Images were captured with an Olympus FluoView FV1000 laser scanning confocal microscope equipped with the software FV10-ASW Viewer (version 3.1).

Quantitative RT-PCR.

Using TRIzol Reagent (Thermo Fisher Scientific), total RNA was extracted from the nasal and frontal bones of control and Ift20:Wnt1-Cre embryos at E17.5. The total RNA was treated with DNase I (Roche) before cDNA synthesis. From the cultured osteoblasts, total RNA was purified using the RNeasy Plus Mini Kit (Qiagen). cDNA was synthesized using iScript Reverse Transcription Supermix for RT-qPCR (Bio-Rad). Quantitative RT-PCR was carried out using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad). The sequences of the specific primer sets are listed in Table S2.

Table S2.

Primer sequences for quantitative RT-PCR

Gene name Forward primer 5′→3′ Reverse primer 5′→3′
Gapdh CGTCCCGTAGACAAAATGGT TCAATGAAGGGGTCGTTGAT
Ift20 TGTGGAGCTCAAGGAGGAGT TGGCCTTCATCTTCTCGTTC
Pdgfra AGAGTTACACGTTTGAGCTGTC GTCCCTCCACGGTACTCCT
Runx2 CGACAGTCCCAACTTCCTGT CGGTAACCACAGTCCCATCT
Osx CTCTCCATCTGCCTGACTCC CCAAATTTGCTGCAGGCT
Ibsp GTCTTTAAGTACCGGCCACG TGAAGAGTCACTGCCTCCCT
Ocn AAGCAGGAGGGCAATAAGGT CAAGCAGGGTTAAGCTCACA

Statistical Analysis.

The Student’s t test was used for statistical analysis. A P value of less than 0.05 was considered statistically significant.

Supplementary Material

Supplementary File
Download video file (12.7MB, avi)
Supplementary File
Download video file (12.7MB, avi)

Acknowledgments

We thank Dr. Gregory J. Pazour and Dr. Andrew P. McMahon for Ift20-floxed, Wnt1-Cre, and K14-Cre mice; Dr. Yingzi Yang, Dr. Ernestina Schipani, and Dr. Wei Hsu for in situ plasmids; Dr. Jennifer Lippincott-Schwartz for sharing the pEGFP-VSVG plasmid; Dr. Sunny Wong for skin analysis; Dr. Trisha Castranio for the critical reading of this manuscript; and Patricia Fonseca for editorial assistance. This study was supported by Grant R00DE021054 from the National Institute of Dental and Craniofacial Research/NIH (to Y.K.) and by a fellowship from the Uehara Memorial Foundation (to K.N.).

Footnotes

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1519458113/-/DCSupplemental.

References

  • 1.Kozminski KG, Johnson KA, Forscher P, Rosenbaum JL. A motility in the eukaryotic flagellum unrelated to flagellar beating. Proc Natl Acad Sci USA. 1993;90(12):5519–5523. doi: 10.1073/pnas.90.12.5519. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Rosenbaum JL, Witman GB. Intraflagellar transport. Nat Rev Mol Cell Biol. 2002;3(11):813–825. doi: 10.1038/nrm952. [DOI] [PubMed] [Google Scholar]
  • 3.Sharma N, Berbari NF, Yoder BK. Ciliary dysfunction in developmental abnormalities and diseases. Curr Top Dev Biol. 2008;85:371–427. doi: 10.1016/S0070-2153(08)00813-2. [DOI] [PubMed] [Google Scholar]
  • 4.Eggenschwiler JT, Anderson KV. Cilia and developmental signaling. Annu Rev Cell Dev Biol. 2007;23:345–373. doi: 10.1146/annurev.cellbio.23.090506.123249. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Haycraft CJ, Serra R. Cilia involvement in patterning and maintenance of the skeleton. Curr Top Dev Biol. 2008;85:303–332. doi: 10.1016/S0070-2153(08)00811-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Yuan X, Serra RA, Yang S. Function and regulation of primary cilia and intraflagellar transport proteins in the skeleton. Ann N Y Acad Sci. 2015;1335:78–99. doi: 10.1111/nyas.12463. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Pazour GJ, Rosenbaum JL. Intraflagellar transport and cilia-dependent diseases. Trends Cell Biol. 2002;12(12):551–555. doi: 10.1016/s0962-8924(02)02410-8. [DOI] [PubMed] [Google Scholar]
  • 8.Ashe A, et al. Mutations in mouse Ift144 model the craniofacial, limb and rib defects in skeletal ciliopathies. Hum Mol Genet. 2012;21(8):1808–1823. doi: 10.1093/hmg/ddr613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Walczak-Sztulpa J, et al. Cranioectodermal Dysplasia, Sensenbrenner syndrome, is a ciliopathy caused by mutations in the IFT122 gene. Am J Hum Genet. 2010;86(6):949–956. doi: 10.1016/j.ajhg.2010.04.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Miller KA, et al. Cauli: A mouse strain with an Ift140 mutation that results in a skeletal ciliopathy modelling Jeune syndrome. PLoS Genet. 2013;9(8):e1003746. doi: 10.1371/journal.pgen.1003746. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Beales PL, et al. IFT80, which encodes a conserved intraflagellar transport protein, is mutated in Jeune asphyxiating thoracic dystrophy. Nat Genet. 2007;39(6):727–729. doi: 10.1038/ng2038. [DOI] [PubMed] [Google Scholar]
  • 12.Halbritter J, et al. UK10K Consortium Defects in the IFT-B component IFT172 cause Jeune and Mainzer-Saldino syndromes in humans. Am J Hum Genet. 2013;93(5):915–925. doi: 10.1016/j.ajhg.2013.09.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Baker SA, Freeman K, Luby-Phelps K, Pazour GJ, Besharse JC. IFT20 links kinesin II with a mammalian intraflagellar transport complex that is conserved in motile flagella and sensory cilia. J Biol Chem. 2003;278(36):34211–34218. doi: 10.1074/jbc.M300156200. [DOI] [PubMed] [Google Scholar]
  • 14.Houde C, et al. Hippi is essential for node cilia assembly and Sonic hedgehog signaling. Dev Biol. 2006;300(2):523–533. doi: 10.1016/j.ydbio.2006.09.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Nonaka S, et al. Randomization of left-right asymmetry due to loss of nodal cilia generating leftward flow of extraembryonic fluid in mice lacking KIF3B motor protein. Cell. 1998;95(6):829–837. doi: 10.1016/s0092-8674(00)81705-5. [DOI] [PubMed] [Google Scholar]
  • 16.Takeda S, et al. Left-right asymmetry and kinesin superfamily protein KIF3A: New insights in determination of laterality and mesoderm induction by kif3A-/- mice analysis. J Cell Biol. 1999;145(4):825–836. doi: 10.1083/jcb.145.4.825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Jonassen JA, San Agustin J, Follit JA, Pazour GJ. Deletion of IFT20 in the mouse kidney causes misorientation of the mitotic spindle and cystic kidney disease. J Cell Biol. 2008;183(3):377–384. doi: 10.1083/jcb.200808137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Finetti F, et al. Intraflagellar transport is required for polarized recycling of the TCR/CD3 complex to the immune synapse. Nat Cell Biol. 2009;11(11):1332–1339. doi: 10.1038/ncb1977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Finetti F, et al. Specific recycling receptors are targeted to the immune synapse by the intraflagellar transport system. J Cell Sci. 2014;127(Pt 9):1924–1937. doi: 10.1242/jcs.139337. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Zaghloul NA, Brugmann SA. The emerging face of primary cilia. Genesis. 2011;49(4):231–246. doi: 10.1002/dvg.20728. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Szabo-Rogers HL, Smithers LE, Yakob W, Liu KJ. New directions in craniofacial morphogenesis. Dev Biol. 2010;341(1):84–94. doi: 10.1016/j.ydbio.2009.11.021. [DOI] [PubMed] [Google Scholar]
  • 22.Ferrante MI, et al. Oral-facial-digital type I protein is required for primary cilia formation and left-right axis specification. Nat Genet. 2006;38(1):112–117. doi: 10.1038/ng1684. [DOI] [PubMed] [Google Scholar]
  • 23.Tobin JL, et al. Inhibition of neural crest migration underlies craniofacial dysmorphology and Hirschsprung’s disease in Bardet-Biedl syndrome. Proc Natl Acad Sci USA. 2008;105(18):6714–6719. doi: 10.1073/pnas.0707057105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Ferrante MI, et al. Convergent extension movements and ciliary function are mediated by ofd1, a zebrafish orthologue of the human oral-facial-digital type 1 syndrome gene. Hum Mol Genet. 2009;18(2):289–303. doi: 10.1093/hmg/ddn356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Goetz SC, Anderson KV. The primary cilium: A signalling centre during vertebrate development. Nat Rev Genet. 2010;11(5):331–344. doi: 10.1038/nrg2774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Chang CF, Schock EN, Attia AC, Stottmann RW, Brugmann SA. The ciliary baton: Orchestrating neural crest cell development. Curr Top Dev Biol. 2015;111:97–134. doi: 10.1016/bs.ctdb.2014.11.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Noden DM, Trainor PA. Relations and interactions between cranial mesoderm and neural crest populations. J Anat. 2005;207(5):575–601. doi: 10.1111/j.1469-7580.2005.00473.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Bronner ME, LeDouarin NM. Development and evolution of the neural crest: An overview. Dev Biol. 2012;366(1):2–9. doi: 10.1016/j.ydbio.2011.12.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Danielian PS, Muccino D, Rowitch DH, Michael SK, McMahon AP. Modification of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase. Curr Biol. 1998;8(24):1323–1326. doi: 10.1016/s0960-9822(07)00562-3. [DOI] [PubMed] [Google Scholar]
  • 30.Brugmann SA, et al. A primary cilia-dependent etiology for midline facial disorders. Hum Mol Genet. 2010;19(8):1577–1592. doi: 10.1093/hmg/ddq030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Kolpakova-Hart E, Jinnin M, Hou B, Fukai N, Olsen BR. Kinesin-2 controls development and patterning of the vertebrate skeleton by Hedgehog- and Gli3-dependent mechanisms. Dev Biol. 2007;309(2):273–284. doi: 10.1016/j.ydbio.2007.07.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Dassule HR, Lewis P, Bei M, Maas R, McMahon AP. Sonic hedgehog regulates growth and morphogenesis of the tooth. Development. 2000;127(22):4775–4785. doi: 10.1242/dev.127.22.4775. [DOI] [PubMed] [Google Scholar]
  • 33.Follit JA, Tuft RA, Fogarty KE, Pazour GJ. The intraflagellar transport protein IFT20 is associated with the Golgi complex and is required for cilia assembly. Mol Biol Cell. 2006;17(9):3781–3792. doi: 10.1091/mbc.E06-02-0133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Jeong J, Mao J, Tenzen T, Kottmann AH, McMahon AP. Hedgehog signaling in the neural crest cells regulates the patterning and growth of facial primordia. Genes Dev. 2004;18(8):937–951. doi: 10.1101/gad.1190304. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Liu B, Chen S, Johnson C, Helms JA. A ciliopathy with hydrocephalus, isolated craniosynostosis, hypertelorism, and clefting caused by deletion of Kif3a. Reprod Toxicol. 2014;48:88–97. doi: 10.1016/j.reprotox.2014.05.009. [DOI] [PubMed] [Google Scholar]
  • 36.Schneider L, et al. PDGFRalphaalpha signaling is regulated through the primary cilium in fibroblasts. Curr Biol. 2005;15(20):1861–1866. doi: 10.1016/j.cub.2005.09.012. [DOI] [PubMed] [Google Scholar]
  • 37.Fantauzzo KA, Soriano P. PI3K-mediated PDGFRα signaling regulates survival and proliferation in skeletal development through p53-dependent intracellular pathways. Genes Dev. 2014;28(9):1005–1017. doi: 10.1101/gad.238709.114. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Klinghoffer RA, Hamilton TG, Hoch R, Soriano P. An allelic series at the PDGFalphaR locus indicates unequal contributions of distinct signaling pathways during development. Dev Cell. 2002;2(1):103–113. doi: 10.1016/s1534-5807(01)00103-4. [DOI] [PubMed] [Google Scholar]
  • 39.Canty EG, Kadler KE. Procollagen trafficking, processing and fibrillogenesis. J Cell Sci. 2005;118(Pt 7):1341–1353. doi: 10.1242/jcs.01731. [DOI] [PubMed] [Google Scholar]
  • 40.Follit JA, et al. The Golgin GMAP210/TRIP11 anchors IFT20 to the Golgi complex. PLoS Genet. 2008;4(12):e1000315. doi: 10.1371/journal.pgen.1000315. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Presley JF, et al. ER-to-Golgi transport visualized in living cells. Nature. 1997;389(6646):81–85. doi: 10.1038/38001. [DOI] [PubMed] [Google Scholar]
  • 42.Khonsari RH, et al. Multiple postnatal craniofacial anomalies are characterized by conditional loss of polycystic kidney disease 2 (Pkd2) Hum Mol Genet. 2013;22(9):1873–1885. doi: 10.1093/hmg/ddt041. [DOI] [PubMed] [Google Scholar]
  • 43.Corbit KC, et al. Kif3a constrains beta-catenin-dependent Wnt signalling through dual ciliary and non-ciliary mechanisms. Nat Cell Biol. 2008;10(1):70–76. doi: 10.1038/ncb1670. [DOI] [PubMed] [Google Scholar]
  • 44.Corbit KC, et al. Vertebrate Smoothened functions at the primary cilium. Nature. 2005;437(7061):1018–1021. doi: 10.1038/nature04117. [DOI] [PubMed] [Google Scholar]
  • 45.Tallquist MD, Soriano P. Cell autonomous requirement for PDGFRalpha in populations of cranial and cardiac neural crest cells. Development. 2003;130(3):507–518. doi: 10.1242/dev.00241. [DOI] [PubMed] [Google Scholar]
  • 46.Haycraft CJ, et al. Intraflagellar transport is essential for endochondral bone formation. Development. 2007;134(2):307–316. doi: 10.1242/dev.02732. [DOI] [PubMed] [Google Scholar]
  • 47.Koyama E, et al. Conditional Kif3a ablation causes abnormal hedgehog signaling topography, growth plate dysfunction, and excessive bone and cartilage formation during mouse skeletogenesis. Development. 2007;134(11):2159–2169. doi: 10.1242/dev.001586. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Keady BT, Le YZ, Pazour GJ. IFT20 is required for opsin trafficking and photoreceptor outer segment development. Mol Biol Cell. 2011;22(7):921–930. doi: 10.1091/mbc.E10-09-0792. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Tibaldi E, et al. Golgi apparatus casein kinase phosphorylates bioactive Ser-6 of bone morphogenetic protein 15 and growth and differentiation factor 9. FEBS Lett. 2010;584(4):801–805. doi: 10.1016/j.febslet.2009.12.052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Lasa-Benito M, Marin O, Meggio F, Pinna LA. Golgi apparatus mammary gland casein kinase: Monitoring by a specific peptide substrate and definition of specificity determinants. FEBS Lett. 1996;382(1-2):149–152. doi: 10.1016/0014-5793(96)00136-6. [DOI] [PubMed] [Google Scholar]
  • 51.Boyadjiev SA, et al. Cranio-lenticulo-sutural dysplasia is caused by a SEC23A mutation leading to abnormal endoplasmic-reticulum-to-Golgi trafficking. Nat Genet. 2006;38(10):1192–1197. doi: 10.1038/ng1876. [DOI] [PubMed] [Google Scholar]
  • 52.Boyadjiev SA, et al. Cranio-lenticulo-sutural dysplasia associated with defects in collagen secretion. Clin Genet. 2011;80(2):169–176. doi: 10.1111/j.1399-0004.2010.01550.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Boyadjiev SA, et al. A novel dysmorphic syndrome with open calvarial sutures and sutural cataracts maps to chromosome 14q13-q21. Hum Genet. 2003;113(1):1–9. doi: 10.1007/s00439-003-0932-6. [DOI] [PubMed] [Google Scholar]
  • 54.Lang MR, Lapierre LA, Frotscher M, Goldenring JR, Knapik EW. Secretory COPII coat component Sec23a is essential for craniofacial chondrocyte maturation. Nat Genet. 2006;38(10):1198–1203. doi: 10.1038/ng1880. [DOI] [PubMed] [Google Scholar]
  • 55.Stephens DJ, Pepperkok R. Imaging of procollagen transport reveals COPI-dependent cargo sorting during ER-to-Golgi transport in mammalian cells. J Cell Sci. 2002;115(Pt 6):1149–1160. doi: 10.1242/jcs.115.6.1149. [DOI] [PubMed] [Google Scholar]
  • 56.Roboti P, Sato K, Lowe M. The golgin GMAP-210 is required for efficient membrane trafficking in the early secretory pathway. J Cell Sci. 2015;128(8):1595–1606. doi: 10.1242/jcs.166710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57.Smits P, et al. Lethal skeletal dysplasia in mice and humans lacking the golgin GMAP-210. N Engl J Med. 2010;362(3):206–216. doi: 10.1056/NEJMoa0900158. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Wong M, Munro S. Membrane trafficking. The specificity of vesicle traffic to the Golgi is encoded in the golgin coiled-coil proteins. Science. 2014;346(6209):1256898. doi: 10.1126/science.1256898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Sato K, Roboti P, Mironov AA, Lowe M. Coupling of vesicle tethering and Rab binding is required for in vivo functionality of the golgin GMAP-210. Mol Biol Cell. 2015;26(3):537–553. doi: 10.1091/mbc.E14-10-1450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60.Kamiya N, et al. SHP2-Deficiency in Chondrocytes Deforms Orofacial Cartilage and Ciliogenesis in Mice. J Bone Miner Res. 2015;30(11):2028–2032. doi: 10.1002/jbmr.2541. [DOI] [PubMed] [Google Scholar]
  • 61.Noda K, Mishina Y, Komatsu Y. Constitutively active mutation of ACVR1 in oral epithelium causes submucous cleft palate in mice. Dev Biol. 2015 doi: 10.1016/j.ydbio.2015.06.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Komatsu Y, Kishigami S, Mishina Y. In situ hybridization methods for mouse whole mounts and tissue sections with and without additional β-galactosidase staining. Methods Mol Biol. 2014;1092:1–15. doi: 10.1007/978-1-60327-292-6_1. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplementary File
Download video file (12.7MB, avi)
Supplementary File
Download video file (12.7MB, avi)

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES