Skip to main content
Endocrinology logoLink to Endocrinology
. 2016 Mar 7;157(5):1728–1735. doi: 10.1210/en.2015-2077

Hepatic PPARγ Is Not Essential for the Rapid Development of Steatosis After Loss of Hepatic GH Signaling, in Adult Male Mice

Rhonda D Kineman 1,✉, Neena Majumdar 1, Papasani V Subbaiah 1, Jose Cordoba-Chacon 1,✉
PMCID: PMC4870866  PMID: 26950202

Abstract

Our group has previously reported de novo lipogenesis (DNL) and hepatic triglyceride content increases in chow-fed male mice within 7 days of hepatocyte-specific GH receptor knockdown (aLivGHRkd). Here, we report that these changes are associated with an increase in hepatic expression of peroxisome proliferator-activated receptor γ (PPARγ), consistent with previous reports showing steatosis is associated with an increase in PPARγ expression in mice with congenital loss of hepatic GH signaling. PPARγ is thought to be an important driver of steatosis by enhancing DNL, as well as increasing the uptake and esterification of extrahepatic fatty acids (FAs). In order to determine whether hepatic PPARγ is critical for the rapid development of steatosis in the aLivGHRkd mouse model, we have generated aLivGHRkd mice, with or without PPARγ (ie, adult-onset, hepatocyte-specific double knockout of GHR and PPARγ). Hepatic PPARγ was not required for the rapid increase in liver triglyceride content or FA indexes of DNL (16:0/18:2 and 16:1/16:0). However, loss of hepatic PPARγ blunted the rise in fatty acid translocase/CD36 and monoacylglycerol acyltransferase 1 expression induced by aLivGHRkd, and this was associated with a reduction in the hepatic content of 18:2. These results suggest that the major role of PPARγ is to enhance pathways critical in uptake and reesterification of extrahepatic FA. Because FAs have been reported to directly increase PPARγ expression, we speculate that in the aLivGHRkd mouse, the FA produced by DNL enhances the expression of PPARγ, which in turn increases extrahepatic FA uptake, thereby further enhancing PPARγ activity and exacerbating steatosis overtime.


De novo lipogenesis (DNL) is the metabolic process that converts acetyl-CoA into fatty acids (FAs) (1), where acetyl-CoA (coenzyme A) is mainly provided by glycolysis. Hepatic DNL has been shown to be inappropriately elevated in patients with nonalcoholic fatty liver disease (NAFLD) (2–4), a condition that is now appreciated as the leading cause of chronic liver disease and the third most common reason for liver transplants in the United States (5, 6). Our laboratory recently reported that just 7 days after knockdown of the GH receptor (GHR) in hepatocytes of adult mice (aLivGHRkd), glycolysis-driven, hepatic DNL increases, leading to an increase in hepatic triglyceride (TG) content (steatosis), without changes in whole-body insulin sensitivity, white adipose tissue (WAT) lipolysis or hepatic very low density lipoprotein release (7). These novel results indicate that GH directly inhibits hepatic DNL. This action of GH may in fact be clinically relevant because NAFLD is associated with reduced/impaired GH signaling (8–20) and GH treatment can reverse steatosis in GH deficient patients (18, 21–23). A negative relationship between GH signaling and steatosis has also been reported in rodent models (24–29).

Elevated expression of peroxisome proliferator-activated receptor γ (PPARγ) is observed in humans with NAFLD (30) and mouse models with steatosis (31–36), including those with congenital loss of hepatic GH signaling (37–39). As shown in the current report, PPARγ expression is also increased in aLivGHRkd mice. It is thought that PPARγ is critical to drive hepatic fat accumulation, because liver-specific knockout of PPARγ reduces hepatic fat accumulation in diet-induced obese, ob/ob, and AZIP mice (32–35). The mechanism by which PPARγ promotes hepatic fat accumulation remains to be clearly established; however, a number of studies have suggested that hepatic PPARγ promotes DNL (33, 40–42) and enhances FA uptake and esterification (43). In order to determine whether PPARγ is essential to promote DNL and the subsequent hepatic TG accumulation after loss of hepatocyte GH signaling, we have generated aLivGHRkd mice, with or without PPARγ (ie, adult-onset, hepatocyte-specific double knockout of GHR and PPARγ; aLivGHR/PPARγdkd).

Materials and Methods

Generation of aLivGHRkd and aLivGHR/PPARγdkd and littermate controls

All mouse studies were approved by the Institutional Animal Care and Use Committee of the Jesse Brown Veterans Affairs Medical Center. Mice were bred and housed in a temperature (22°C–24°C) and humidity-controlled-specific pathogen-free barrier facility with 12-hour light, 12-hour dark cycle (lights on at 6 am) and fed standard laboratory rodent chow (FormuLab Diet; Purina Mills, Inc). Initial analysis of PPARγ expression was conducted on control and aLivGHRkd liver samples previously reported (7). In order to generate double knockout mice, GHRfl/fl mice (44) were crossbred with PPARγfl/fl mice (Strain B6.129-Ppargtm2Rev/J, stock number 004584; The Jackson Laboratory) for several generations to generate GHRfl/fl/PPARγwt/wt and GHRfl/fl/PPARγfl/fl littermates. Eight- to 10-week-old male GHRfl/fl/PPARγwt/wt and GHRfl/fl/PPARγfl/fl mice were injected in the lateral-tail vein with 100-μL saline containing 1.5 × 1011 genome copies of an adeno-associated virus (AAV8) bearing a liver-specific thyroxine-binding globulin (TBG)-promoter driving a Cre recombinase transgene (AAV8-TBGp-Cre) or a null allele (AAV8-TBGp-Null, controls). Vectors were supplied by Penn Vector Core (University of Pennsylvania). Mice were killed 7 days after AAV injection at 12 pm after food removal at 8 am. Liver was snap frozen, fat depots weighted, and trunk blood collected for plasma TG and non-esterified fatty acids (NEFA) analysis (Wako Chemicals USA, Inc).

Hepatic gene expression analysis

Hepatic RNA was extracted using TRIzol reagent (Life Technologies) and treated with RQ1 ribonuclease-free deoxyribonuclease (Promega). Random hexamer primers were used to retrotranscribe 100 ng/μL of DNA-free RNA into cDNA (RevertAid First Strand cDNA Synthesis kit; Thermo Fisher Scientific). Resulting cDNA was amplified in a MxPro 3000P quantitative polymerase chain reaction (qPCR) system (Agilent Technologies, Inc) by quantitative real-time PCR, using Brilliant III SYBR green QPCR Master Mix (Agilent Technologies, Inc). Primers were selected that amplified 100- to 250-bp targets and displayed no autocomplementation or nonspecific amplifications (assessed by sequencing and melting curves). qPCR primer sequences were reported previously (7, 45). Additional qPCR primer sequences used in this report include: Pparγ (NM_001127330.1 Pparγ1, NM_011146.3 Pparγ2) sense primer (Se), AGACCACTCGCATTCCTTTG and antisense primer (As), CCTGTTGTAGAGCTGGGTCTTT, 214 bp; monoacylglycerol acyltransferase 1 (Mogat1) (NM_026713.3) Se, TCTGGTTCTGTTTCCCGTTG and As, ACATTGCCACCTCCATCCTT, 109 bp; and CD36 (fatty acid translocase) (NM_001159558) Se, GGAGCCATCTTTGAGCCTTC and As, TGGATCTTTGTAACCCCACAAG, 201 bp. An internal standard curve using dilutions of the gene-specific PCR products (106-101 copies of starting DNA template) were run in the same PCR plate to estimate efficiency of the PCR reaction and linearity of the standard curve. Cycles threshold/Cts obtained for each sample were converted to cDNA (mRNA) copy number/reaction, based on the standard curve. Values were normalized using a normalization factor generated by the algorithm geNorm (46), calculated based on the expression levels of 3 housekeeping genes in each sample (cyclophilin A, β-actin, hypoxanthine-guanine phosphoribosyltransferase). Relative values of gene expression are shown as mean ± SEM, with AAV8-TBGp-Null-treated GHRfl/fl mice set at 100% in Figure 1A and AAV8-TBGp-Null-treated GHRfl/fl/PPARγwt/wt mice set at 100% in Figure 1, B and C, an Figure 3 below.

Figure 1.

Figure 1.

Enhanced PPARγ transcriptional activity in livers of aLivGHRkd mice is blunted by loss of hepatocyte PPARγ expression. Expression of hepatic PPARγ (A and B), GHR (B), and Cd36 and Mogat1 (C) in genotype-matched controls (open columns), aLivGHRkd (black columns, Kd), and aLivGHR/PPARγdk (gray columns, dKd). Values are represented as mean ± SEM of 4–6 mice/group and analyzed using a 2 tailed-Student's t test (A) or two-way ANOVA followed by a Bonferroni's post hoc comparisons (B and C). Asterisks indicate differences between aLivGHRkd or aLivGHR/PPARγdkd and their respective littermate controls. *, P < .05; ***, P < .0001. Letters indicate differences between GHRfl/fl/PPARγwt/wt and GHRfl/fl/PPARγfl/fl treated with AAV8-TBGp-Null (controls) or between aLivGHRkd and aLivGHR/PPARγdkd, to evaluate the effect of background (floxed gene) or loss of PPARγ in aLivGHRkd, respectively. a, P < .05; b, P < .01; c, P < .0001. Cd36, FA translocase.

Figure 3.

Figure 3.

Impact of hepatic PPARγ knockdown in aLivGHRkd-induced regulation of glycolytic and DNL gene expression. Expression of hepatic glycolytic genes: Glut-2, Gck, and Pklr (A) and DNL genes Acc1, Fasn, Elovl6, and Scd1 (B) in genotype-matched controls (open columns), aLivGHRkd (black columns, Kd), and aLivGHR/PPARγdk (gray columns, dKd). Values are represented as mean ± SEM of 4–6 mice/group and analyzed using two-way ANOVA followed by a Bonferroni's post hoc comparisons as described in Figure 1. Asterisks indicate differences between aLivGHRkd or aLivGHR/PPARγdkd with their respective littermate controls. *, P < .05; **, P < .01; ***, P < .0001. Letters indicate differences between aLivGHRkd and aLivGHR/PPARγdkd. a, P < .05. Glut-2, glucose transporter-2; Gck, glucokinase; Pklr, pyruvate kinase; Acc1, acetyl-CoA carboxylase 1; Elovl6, FA elongase 6; Scd1, stearoyl-CoA desaturase 1.

Hepatic lipid analysis

Hepatic TG levels were measured using Wako Diagnostics reagents after extraction of neutral lipids (45). Levels of hepatic FA subspecies were measured using gas chromatography/mass spectrometry (GC/MS) after lipid extraction. Briefly, approximately 20 mg of liver were homogenized in 10mM Tris and 150mM NaCl (pH 7.4) on ice, and the total lipids were extracted by Bligh and Dyer procedure (47). Lipids were dissolved in 200 μL of chloroform, and 25 μL of this solution were transmethylated with 1-mL boron trifluoride-methanol (10%; Sigma-Aldrich) and 0.5-mL butylated hydroxytoluene (0.5 mg/mL; Sigma-Aldrich) containing 100-μg/mL docosatrienoic acid (22:3, as GC/MS standard; Nu-Chek) at 90°C for 60 minutes. The resulting FA methyl esters (FAMEs) were extracted with 2.5-mL hexane after adding 1-mL water. The analysis of FAME was carried out by GC/MS using Shimadzu QP2010SE, equipped with a Supelco Omegawax column (30 m × 0.25 mm × 0.25 μm-film thickness), and helium was used as carrier gas. The temperature program was as follows: initial temperature was 165°C for 1 minute, raised at the rate of 6.5°C per minute to 210°C, followed by raising to 240°C at the rate of 3.5°C per minute. The final temperature was maintained at 240°C for 10 minutes. The total analysis time was 26.5 minutes. The injection temperature was 250°C, ion source temperature 230°C, and the interface temperature was 250°C. The identification of individual FAME was done by comparison of retention times with the standard mixture (Polyunsaturated fatty acid Mix No. 2; Sigma-Aldrich) as well as by the characteristic fragment ions (m/z 74 for saturated, m/z 55 for monounsaturated, m/z 67 for diunsaturated, and m/z 79 for polyunsaturated). The FAMEs were quantified from the total ion current in the range of 50–400 m/z, using the 22:3 FAME as the internal standard.

Statistics

Two-tailed Student's t tests were performed to analyze the effect of aLivGHRkd vs control on expression of PPARγ in samples generated in a previous study (7), shown in Figure 1A. Data generated using aLivGHRkd and aLivGHR/PPARγdkd littermates and their respective genotype-matched controls (Figures 1, B and C, and 2–4) were evaluated by two-way ANOVA (testing the effect of genotype and PPARγ status), followed by Bonferroni's post hoc comparisons. P < .05 was considered significant. All statistical analyses were performed using GraphPad Prism 5 (GraphPad Software).

Figure 2.

Figure 2.

Loss of hepatocyte PPARγ expression does not impact accumulation of hepatic TG, plasma TG, or NEFA or relative fat depot weight in aLivGHRkd. Hepatic TG (A), plasma TG (B), NEFA (C), and unilateral fat depot weight adjusted by body weight (urogenital [UG; D], retroperitoneal [RP; E], sc [SC; F]) of genotype-matched controls (open columns), aLivGHRkd (black columns, Kd), and aLivGHR/PPARγkd (gray columns, dKd). Values are represented as mean ± SEM of 4–6 mice/group and analyzed using two-way ANOVA followed by a Bonferroni's post hoc comparisons as described in Figure 1. Asterisks indicate differences between aLivGHRkd or aLivGHR/PPARγdkd and their respective littermate controls. *, P < .05; **, P < .01; ***, P < .0001.

Figure 4.

Figure 4.

Hepatic FA ratios indicative of DNL were unchanged by loss of PPARγ in aLivGHRkd mice, whereas linoleic acid amount, as indicative of FA uptake/esterification, was reduced. DNL index (A), SCD index (B), and hepatic levels of linoleic acid (18:2[n-6]; C) in genotype-matched controls (open columns), aLivGHRkd (black columns, Kd), and aLivGHR/PPARγdk (gray columns, dKd). Values are represented as mean ± SEM of 4–6 mice/group and analyzed using two-way ANOVA followed by a Bonferroni's post hoc comparisons as described in Figure 1. Asterisks indicate differences between aLivGHRkd or aLivGHR/PPARγdkd with their respective littermate controls. *, P < .05; **, P < .01; ***, P < .0001. Letters indicate differences between aLivGHRkd and aLivGHR/PPARγdkd. b, P < .01. D, Working hypothesis. Adult-onset, reduction/loss of hepatic GH signaling (indicated by dotted line) leads to an increase in DNL, raising the concentration of intrahepatic FA that in turn induces the expression of PPARγ. The rise in PPARγ enhances genes important in extrahepatic FA uptake, which over time, further enhances PPARγ activity thereby exacerbating steatosis.

Results

Loss of hepatocyte GHR in adult mice increases the expression of PPARγ, but PPARγ is not required for TG accumulation

We previously reported, just 7 days after knockdown of the GHR in hepatocytes of chow-fed, adult male mice, steatosis develops due to an increase in DNL, associated with an increase in glycolysis (7). In samples taken from that study, we report herein that aLivGHRkd also increases PPARγ expression (Figure 1A), consistent with previous reports of mouse models of steatosis (31–34), including those with congenital knockout of hepatic GHR signaling (37–39). Because the rise in PPARγ has been predicted to be a major driver of steatosis in congenital mouse models of hepatocyte-specific GHR signaling defects (37–39), we sought to determine whether adult-onset knockdown of hepatocyte PPARγ would block the development of steatosis observed in aLivGHRkd mice. Treating GHRfl/fl/PPARγwt/wt and GHRfl/fl/PPARγfl/fl littermates with AAV8-TBGp-Cre produced a more than 99% knockdown in GHR mRNA (Figure 1B), where validation studies were previously reported demonstrating this knockdown was hepatocyte specific (7). In this group of mice, aLivGHRkd alone was also effective in increasing hepatic PPARγ expression (Figure 1B). AAV8-TBGp-Cre treatment of GHRfl/fl/PPARγfl/fl littermates reduced the expression of hepatic PPARγ (aLivGHR/PPARγdkd), to approximately 20% of controls (Figure 1B). The inability of AAV8-TBGp-Cre to completely suppress PPARγ mRNA levels can be explained by the fact that PPARγ is expressed at high levels in macrophages (33, 48), which would not be impacted by AAV8-TBGp-Cre treatment. In aLivGHRkd, the expression levels of Cd36 and Mogat1, direct target genes of PPARγ (43, 49), were increased, whereas simultaneous knockdown of PPARγ (aLivGHR/PPARγdkd) blunted this rise (Figure 1C), indicative of the loss of PPARγ transcriptional activity.

Of note, simultaneous knockdown of hepatocyte GHR and PPARγ did not impact the previously described (7) increase in hepatic TG content (Figure 2A) and plasma TG levels (Figure 2B), observed in aLivGHRkd. Also, there was no significant impact of single or double knockdown, on plasma NEFA levels (Figure 2C) or fat depot weight (Figure 2, D–F), indicating an increase in adipose tissue lipolysis does not play a major role in the rapid accumulation of TG observed after short-term aLivGHRkd, as previously reported (7).

Loss of hepatocyte PPARγ signaling in adult mice minimally impacts lipogenic gene expression after loss of GH signaling

We have previously reported that hepatic TG accumulation observed in aLivGHRkd is due to enhanced glycolysis-mediated DNL (7). Although PPARγ is thought to be important in maintaining hepatic DNL (33, 40–42), loss of PPARγ had no impact on the aLivGHRkd-mediated increase in expression of glucose transporter-2, acetyl-CoA carboxylase 1, FA elongase 6, or stearoyl-CoA desaturase 1 (Figure 3, A and B). However, loss of PPARγ did blunt the rise in glucokinase (Gck) and FA synthase (Fasn). Of note, PPARγ transcriptionally activates Gck promoter (50). However, to the best of our knowledge, Fasn promoter is not activated directly by PPARγ.

Lipid analysis of FA by GC/MS indicates that hepatocyte PPARγ expression is not required for DNL, but it is required for hepatic FA uptake after loss of GH signaling

Gene expression may not translate directly into enzymatic activity. Therefore, to determine whether aLivGHRkd-mediated DNL activity was impaired by loss of PPARγ signaling (aLivGHR/PPARγdkd), we measured the relative levels of specific FA by GC/MS, and from these data calculated the DNL index (16:0/18:2) (51–54) and the stearoyl-CoA desaturase (SCD) index (16:1/16:0) (51–54), where both indexes have been shown to be indicative of hepatic DNL. As shown in Figure 4, A and B, the DNL index and the SCD index were increased in aLivGHRkd mice, consistent with our previous report showing aLivGHRkd increases hepatic DNL, as measured by D2O incorporation into TG-associated FA (7). Importantly, the rise in both indexes was not altered by PPARγ knockdown. Taken together, these data indicate that PPARγ is not essential to promote glycolysis-driven DNL and hepatic TG accumulation observed after short-term loss of hepatic GH signaling in the adult mouse.

However, in addition to DNL, hepatic PPARγ is thought to be important in FA uptake and reesterification (32–34). It has been shown that PPARγ directly increases the expression of the FA transporter, CD36 (49, 55), as well as increasing the expression of monoacylglycerol acyltransferase (Mogat1) (43), which is important for FA reesterification through the monoacylglycerol pathway (43). Of note, the expression of both CD36 and Mogat1 was increased in aLivGHRkd mice and loss of PPARγ significantly blunted this effect (Figure 1C). In order to determine whether changes in CD36 and Mogat1 gene expression translated into changes in the level of FA derived from extrahepatic sources, we measured the level of linoleic acid (18:2) in the liver, a FA that cannot be produced de novo by animal cells and is only derived from plant sources. The levels of 18:2 were increased by aLivGHRkd, and this rise was significantly blunted in the absence of PPARγ (Figure 4C), indicating hepatic PPARγ is required to promote FA uptake and reesterification by the liver of aLivGHRkd mice.

Discussion

Our laboratory has recently reported that knockdown of hepatic GHR expression in adult mice rapidly leads to an increase in hepatic TG accumulation, associated with an increase in DNL, without changes in whole-body insulin sensitivity, WAT lipolysis, or hepatic very low density lipoprotein release (7). The results of the current report clearly demonstrate that PPARγ increases in aLivGHRkd livers, but it is not required to drive the related DNL and the rapid development of steatosis. These results are at odds with the commonly accepted belief that hepatic PPARγ promotes DNL. However, in most reports, the positive association between PPARγ and DNL is based only on changes in hepatic gene expression, without any assessment of DNL activity (33–35, 40). To our knowledge, only 2 reports have directly measured endpoints of DNL. One report demonstrated overexpression of PPARγ in a hepatic cell line, AML12, increased DNL as measured by 3H-acetate labeling (41). However, overexpression systems may not accurately represent the actions of endogenous PPARγ. In another report, mice that express human apolipoprotein B (ApoB), but lack brown adipose tissue (ApoB/BATless mice), develop steatosis associated with enhanced DNL (measured by 3H2O labeling), as compared with human ApoB mice alone (42). In this model, hepatic DNL could be suppressed by ip delivery of PPARγ antisense oligonucleotides (42); however, this strategy is not hepatocyte specific. Given the limitations of the previous reports, coupled with the strengths of our current model system that includes hepatocyte specificity, adult-onset (thus avoiding confounding effects due to developmental changes in other metabolically relevant tissues), and analysis shortly after PPARγ knockdown (thus reducing secondary effects mediated by changes in systemic metabolism), our results minimize a central role of PPARγ in promoting hepatic DNL, at least in the context of hepatic GH resistance.

Although PPARγ is not required to enhance DNL or steatosis observed after short-term aLivGHRkd, the current results do indicate PPARγ is required to support maximal uptake/esterification of extrahepatic FA. We might speculate that over time, this action of PPARγ could further exacerbate steatosis in the absence of hepatic GH signaling. This action may in fact be important for the fatty liver observed in mice with congenital, liver-specific knockout of the GHR or its downstream effectors (Janus kinase 2 and signal transducer and activator of transcription 5 [Stat5]) (37–39, 56–58). In contrast to the aLivGHRkd model, the steatosis observed in congenital knockdown models is thought to be solely due to the indirect actions of GH. Specifically, in the congenital knockout models the reduction in IGF-1, leads to a rise in circulating GH that is thought to promote systemic insulin resistance and WAT lipolysis, thereby shifting the flux of FA to the liver (38, 39). In striking contrast and supporting a direct role of GH in mediating hepatic DNL (7), restoration of hepatic IGF-1 in a congenital model with hepatocyte-specific GHR knockout, restored peripheral insulin sensitivity, but did not prevent liver steatosis (59).

The question arises, what triggers the rise in PPARγ after hepatic knockdown of the GHR? It has been previously reported that Stat5b (a major downstream effector induced by GHR activation) directly promotes the translation of the PPARγ gene in a preadipocyte cell line (60), thus reducing the possibility that loss of GHR signaling in the hepatocyte is directly involved in enhanced PPARγ observed in the aLivGHRkd model. This is supported by the observation that expression of a dominant-negative Stat5 in the hepatocyte cell line, AML12, did not increase PPARγ expression (37). Alternatively, the expression and activation of PPARγ has been shown to be induced by FA (61, 62). Based on the results of the current study, we propose the following working hypothesis (Figure 4D). Adult-onset reduction/loss of hepatic GH signaling leads to an increase in DNL, raising the concentration of intrahepatic FA that in turn induces the expression of PPARγ. The rise in PPARγ enhances genes important in extrahepatic FA uptake, which over time further enhances PPARγ activity thereby exacerbating steatosis. Given both DNL and enhanced extrahepatic uptake/reesterification of FA are increased in patients with NAFLD (2–4), coupled with the fact that reduced GH production and signaling is negatively associated with NAFLD (8–19), it is possible that a reduction in hepatic GH signaling could directly contribute to the progression of NAFLD observed in the general population by directly regulating DNL (7) and indirectly by a FA-dependent increase in PPARγ expression and activity.

Acknowledgments

We thank Dr John Kopchick (Edison Biotechnology Institute and Department of Biomedical Sciences, Heritage College of Osteopathic Medicine, Ohio University, Athens, OH) for kindly providing the GHRfl/fl mouse model.

Author contributions: R.D.K. and J.C.-C. designed, performed the experiments, analyzed the data, and wrote the manuscript; N.M. performed experiments; P.V.S. performed experiments and provided key technical assistance on GC/MS analysis; and all authors reviewed and approved the final version of the manuscript.

This work was supported by the Department of Veterans Affairs, Office of Research and Development Merit Award BX001114; the National Institutes of Health Grant R01DK088133 (to R.D.K.), the Department of Veterans Affairs, Office of Research and Development Merit Award BX001090; National Institutes of Health Grants R21AT008457 and S10OD010660 (to P.V.S.); Chicago Biomedical Consortium with support from the Searle Funds at The Chicago Community Trust Grant PDR-033; and 2014 Endocrine Scholar Award in Growth Hormone Research (The Endocrine Society) (to J.C.-C.).

Disclosure Summary: The authors have nothing to disclose.

Footnotes

Abbreviations:
ApoB
apolipoprotein B
As
antisense primer
CD36
fatty acid translocase
CoA
coenzyme A
DNL
de novo lipogenesis
FA
fatty acid
FAME
FA methyl ester
Fasn
FA synthase
Gck
glucokinase
GC/MS
gas chromatography/mass spectrometry
GHR
GH receptor
Mogat1
monoacylglycerol acyltransferase 1
NAFLD
nonalcoholic fatty liver disease
NEFA
non-esterified fatty acids
PPAR
peroxisome proliferator-activated receptor
qPCR
quantitative polymerase chain reaction
SCD
stearoyl-CoA desaturase
Se
sense primer
Stat5
signal transducer and activator of transcription 5
TBG
thyroxine-binding globulin
TG
triglyceride
WAT
white adipose tissue.

References

  • 1. Rui L. Energy metabolism in the liver. Compr Physiol. 2014;4(1):177–197. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Lambert JE, Ramos-Roman MA, Browning JD, Parks EJ. Increased de novo lipogenesis is a distinct characteristic of individuals with nonalcoholic fatty liver disease. Gastroenterology. 2014;146(3):726–735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Donnelly KL, Smith CI, Schwarzenberg SJ, Jessurun J, Boldt MD, Parks EJ. Sources of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic fatty liver disease. J Clin Invest. 2005;115(5):1343–1351. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Donnelly KL, Margosian MR, Sheth SS, Lusis AJ, Parks EJ. Increased lipogenesis and fatty acid reesterification contribute to hepatic triacylglycerol stores in hyperlipidemic Txnip−/− mice. J Nutr. 2004;134(6):1475–1480. [DOI] [PubMed] [Google Scholar]
  • 5. Younossi ZM, Stepanova M, Afendy M, et al. Changes in the prevalence of the most common causes of chronic liver diseases in the United States from 1988 to 2008. Clin Gastroenterol Hepatol. 2011;9(6):524–530.e521; quiz e60. [DOI] [PubMed] [Google Scholar]
  • 6. Zezos P, Renner EL. Liver transplantation and non-alcoholic fatty liver disease. World J Gastroenterol. 2014;20(42):15532–15538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Cordoba-Chacon J, Majumdar N, List EO, et al. Growth hormone inhibits hepatic de novo lipogenesis in adult mice. Diabetes. 2015;64(9):3093–3103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Arturi F, Succurro E, Procopio C, et al. Nonalcoholic fatty liver disease is associated with low circulating levels of insulin-like growth factor-I. J Clin Endocrinol Metab. 2011;96(10):E1640–E1644. [DOI] [PubMed] [Google Scholar]
  • 9. Fusco A, Miele L, D'Uonnolo A, et al. Nonalcoholic fatty liver disease is associated with increased GHBP and reduced GH/IGF-I levels. Clin Endocrinol (Oxf). 2012;77(4):531–536. [DOI] [PubMed] [Google Scholar]
  • 10. Cianfarani S, Inzaghi E, Alisi A, Germani D, Puglianiello A, Nobili V. Insulin-like growth factor-I and -II levels are associated with the progression of nonalcoholic fatty liver disease in obese children. J Pediatr. 2014;165(1):92–98. [DOI] [PubMed] [Google Scholar]
  • 11. García-Galiano D, Sánchez-Garrido MA, Espejo I, et al. IL-6 and IGF-1 are independent prognostic factors of liver steatosis and non-alcoholic steatohepatitis in morbidly obese patients. Obes Surg. 2007;17(4):493–503. [DOI] [PubMed] [Google Scholar]
  • 12. Hribal ML, Procopio T, Petta S, et al. Insulin-like growth factor-I, inflammatory proteins, and fibrosis in subjects with nonalcoholic fatty liver disease. J Clin Endocrinol Metab. 2013;98(2):E304–E308. [DOI] [PubMed] [Google Scholar]
  • 13. Ichikawa T, Nakao K, Hamasaki K, et al. Role of growth hormone, insulin-like growth factor 1 and insulin-like growth factor-binding protein 3 in development of non-alcoholic fatty liver disease. Hepatol Int. 2007;1(2):287–294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Runchey SS, Boyko EJ, Ioannou GN, Utzschneider KM. Relationship between serum circulating insulin-like growth factor-1 and liver fat in the United States. J Gastroenterol Hepatol. 2014;29(3):589–596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Sesti G, Hribal ML, Procopio T, et al. Low circulating insulin-like growth factor-1 levels are associated with high serum uric acid in nondiabetic adult subjects. Nutr Metab Cardiovasc Dis. 2014;24(12):1365–1372. [DOI] [PubMed] [Google Scholar]
  • 16. Sirbu A, Gologan S, Arbanas T, et al. Adiponectin, body mass index and hepatic steatosis are independently associated with IGF-I status in obese non-diabetic women. Growth Horm IGF Res. 2013;23(1–2):2–7. [DOI] [PubMed] [Google Scholar]
  • 17. Sumida Y, Yonei Y, Tanaka S, et al. Lower levels of insulin-like growth factor-1 standard deviation score are associated with histological severity of non-alcoholic fatty liver disease. Hepatol Res. 2015;45(7):771–781. [DOI] [PubMed] [Google Scholar]
  • 18. Hazlehurst JM, Tomlinson JW. Non-alcoholic fatty liver disease in common endocrine disorders. Eur J Endocrinol. 2013;169(2):R27–R37. [DOI] [PubMed] [Google Scholar]
  • 19. Xu L, Xu C, Yu C, et al. Association between serum growth hormone levels and nonalcoholic fatty liver disease: a cross-sectional study. PLoS One. 2012;7(8):e44136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Madsen M, Krusenstjerna-Hafstrøm T, Møller L, et al. Fat content in liver and skeletal muscle changes in a reciprocal manner in patients with acromegaly during combination therapy with a somatostatin analog and a GH receptor antagonist: a randomized clinical trial. J Clin Endocrinol Metab. 2012;97(4):1227–1235. [DOI] [PubMed] [Google Scholar]
  • 21. Takahashi Y, Iida K, Takahashi K, et al. Growth hormone reverses nonalcoholic steatohepatitis in a patient with adult growth hormone deficiency. Gastroenterology. 2007;132(3):938–943. [DOI] [PubMed] [Google Scholar]
  • 22. Nishizawa H, Iguchi G, Murawaki A, et al. Nonalcoholic fatty liver disease in adult hypopituitary patients with GH deficiency and the impact of GH replacement therapy. Eur J Endocrinol. 2012;167(1):67–74. [DOI] [PubMed] [Google Scholar]
  • 23. Gardner CJ, Irwin AJ, Daousi C, et al. Hepatic steatosis, GH deficiency and the effects of GH replacement: a Liverpool magnetic resonance spectroscopy study. Eur J Endocrinol. 2012;166(6):993–1002. [DOI] [PubMed] [Google Scholar]
  • 24. Owen C, Lees EK, Mody N, Delibegovic M. Regulation of growth hormone induced JAK2 and mTOR signalling by hepatic protein tyrosine phosphatase 1B. Diabetes Metab. 2014;41(1):95: 95–101. [DOI] [PubMed] [Google Scholar]
  • 25. Bielohuby M, Sawitzky M, Stoehr BJ, et al. Lack of dietary carbohydrates induces hepatic growth hormone (GH) resistance in rats. Endocrinology. 2011;152(5):1948–1960. [DOI] [PubMed] [Google Scholar]
  • 26. Qin Y, Tian YP. Preventive effects of chronic exogenous growth hormone levels on diet-induced hepatic steatosis in rats. Lipids Health Dis. 2010;9:78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Yang T, Householder LA, Lubbers ER, et al. Growth hormone receptor antagonist transgenic mice are protected from hyperinsulinemia and glucose intolerance despite obesity when placed on a HF diet. Endocrinology. 2014;155(2):555–564. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. List EO, Palmer AJ, Berryman DE, Bower B, Kelder B, Kopchick JJ. Growth hormone improves body composition, fasting blood glucose, glucose tolerance and liver triacylglycerol in a mouse model of diet-induced obesity and type 2 diabetes. Diabetologia. 2009;52(8):1647–1655. [DOI] [PubMed] [Google Scholar]
  • 29. Tateno C, Kataoka M, Utoh R, et al. Growth hormone-dependent pathogenesis of human hepatic steatosis in a novel mouse model bearing a human hepatocyte-repopulated liver. Endocrinology. 2011;152(4):1479–1491. [DOI] [PubMed] [Google Scholar]
  • 30. Pettinelli P, Videla LA. Up-regulation of PPAR-γ mRNA expression in the liver of obese patients: an additional reinforcing lipogenic mechanism to SREBP-1c induction. J Clin Endocrinol Metab. 2011;96(5):1424–1430. [DOI] [PubMed] [Google Scholar]
  • 31. Inoue M, Ohtake T, Motomura W, et al. Increased expression of PPARγ in high fat diet-induced liver steatosis in mice. Biochem Biophys Res Commun. 2005;336(1):215–222. [DOI] [PubMed] [Google Scholar]
  • 32. Matsusue K, Haluzik M, Lambert G, et al. Liver-specific disruption of PPARγ in leptin-deficient mice improves fatty liver but aggravates diabetic phenotypes. J Clin Invest. 2003;111(5):737–747. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Morán-Salvador E, López-Parra M, García-Alonso V, et al. Role for PPARγ in obesity-induced hepatic steatosis as determined by hepatocyte- and macrophage-specific conditional knockouts. FASEB J. 2011;25(8):2538–2550. [DOI] [PubMed] [Google Scholar]
  • 34. Gavrilova O, Haluzik M, Matsusue K, et al. Liver peroxisome proliferator-activated receptor γ contributes to hepatic steatosis, triglyceride clearance, and regulation of body fat mass. J Biol Chem. 2003;278(36):34268–34276. [DOI] [PubMed] [Google Scholar]
  • 35. Yamazaki T, Shiraishi S, Kishimoto K, Miura S, Ezaki O. An increase in liver PPARγ2 is an initial event to induce fatty liver in response to a diet high in butter: PPARγ2 knockdown improves fatty liver induced by high-saturated fat. J Nutr Biochem. 2011;22(6):543–553. [DOI] [PubMed] [Google Scholar]
  • 36. Vidal-Puig A, Jimenez-Liñan M, Lowell BB, et al. Regulation of PPAR γ gene expression by nutrition and obesity in rodents. J Clin Invest. 1996;97(11):2553–2561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Barclay JL, Nelson CN, Ishikawa M, et al. GH-dependent STAT5 signaling plays an important role in hepatic lipid metabolism. Endocrinology. 2011;152(1):181–192. [DOI] [PubMed] [Google Scholar]
  • 38. Sos BC, Harris C, Nordstrom SM, et al. Abrogation of growth hormone secretion rescues fatty liver in mice with hepatocyte-specific deletion of JAK2. J Clin Invest. 2011;121(4):1412–1423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Fan Y, Menon RK, Cohen P, et al. Liver-specific deletion of the growth hormone receptor reveals essential role of growth hormone signaling in hepatic lipid metabolism. J Biol Chem. 2009;284(30):19937–19944. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Matsusue K, Aibara D, Hayafuchi R, et al. Hepatic PPARγ and LXRα independently regulate lipid accumulation in the livers of genetically obese mice. FEBS Lett. 2014;588(14):2277–2281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Schadinger SE, Bucher NL, Schreiber BM, Farmer SR. PPARγ2 regulates lipogenesis and lipid accumulation in steatotic hepatocytes. Am J Physiol Endocrinol Metab. 2005;288(6):E1195–E1205. [DOI] [PubMed] [Google Scholar]
  • 42. Zhang YL, Hernandez-Ono A, Siri P, et al. Aberrant hepatic expression of PPARγ2 stimulates hepatic lipogenesis in a mouse model of obesity, insulin resistance, dyslipidemia, and hepatic steatosis. J Biol Chem. 2006;281(49):37603–37615. [DOI] [PubMed] [Google Scholar]
  • 43. Lee YJ, Ko EH, Kim JE, et al. Nuclear receptor PPARγ-regulated monoacylglycerol O-acyltransferase 1 (MGAT1) expression is responsible for the lipid accumulation in diet-induced hepatic steatosis. Proc Natl Acad Sci USA. 2012;109(34):13656–13661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. List EO, Berryman DE, Funk K, et al. The role of GH in adipose tissue: lessons from adipose-specific GH receptor gene-disrupted mice. Mol Endocrinol. 2013;27(3):524–535. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Cordoba-Chacon J, Gahete MD, McGuinness OP, Kineman RD. Differential impact of selective GH deficiency and endogenous GH excess on insulin-mediated actions in muscle and liver of male mice. Am J Physiol Endocrinol Metab. 2014;307(10):E928–E934. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Vandesompele J, De Preter K, Pattyn F, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3(7):RESEARCH0034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol. 1959;37(8):911–917. [DOI] [PubMed] [Google Scholar]
  • 48. Tontonoz P, Spiegelman BM. Fat and beyond: the diverse biology of PPARγ. Annu Rev Biochem. 2008;77:289–312. [DOI] [PubMed] [Google Scholar]
  • 49. Tontonoz P, Nagy L, Alvarez JG, Thomazy VA, Evans RM. PPARγ promotes monocyte/macrophage differentiation and uptake of oxidized LDL. Cell. 1998;93(2):241–252. [DOI] [PubMed] [Google Scholar]
  • 50. Kim TH, Kim H, Park JM, et al. Interrelationship between liver X receptor α, sterol regulatory element-binding protein-1c, peroxisome proliferator-activated receptor γ, and small heterodimer partner in the transcriptional regulation of glucokinase gene expression in liver. J Biol Chem. 2009;284(22):15071–15083. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51. Chong MF, Hodson L, Bickerton AS, et al. Parallel activation of de novo lipogenesis and stearoyl-CoA desaturase activity after 3 d of high-carbohydrate feeding. Am J Clin Nutr. 2008;87(4):817–823. [DOI] [PubMed] [Google Scholar]
  • 52. Silbernagel G, Kovarova M, Cegan A, et al. High hepatic SCD1 activity is associated with low liver fat content in healthy subjects under a lipogenic diet. J Clin Endocrinol Metab. 2012;97(12):E2288–E2292. [DOI] [PubMed] [Google Scholar]
  • 53. Peter A, Cegan A, Wagner S, et al. Hepatic lipid composition and stearoyl-coenzyme A desaturase 1 mRNA expression can be estimated from plasma VLDL fatty acid ratios. Clin Chem. 2009;55(12):2113–2120. [DOI] [PubMed] [Google Scholar]
  • 54. Lee JJ, Lambert JE, Hovhannisyan Y, et al. Palmitoleic acid is elevated in fatty liver disease and reflects hepatic lipogenesis. Am J Clin Nutr. 2015;101(1):34–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Zhou J, Febbraio M, Wada T, et al. Hepatic fatty acid transporter Cd36 is a common target of LXR, PXR, and PPARγ in promoting steatosis. Gastroenterology. 2008;134(2):556–567. [DOI] [PubMed] [Google Scholar]
  • 56. Cui Y, Hosui A, Sun R, et al. Loss of signal transducer and activator of transcription 5 leads to hepatosteatosis and impaired liver regeneration. Hepatology. 2007;46(2):504–513. [DOI] [PubMed] [Google Scholar]
  • 57. List EO, Berryman DE, Funk K, et al. Liver-specific GH receptor gene-disrupted (LiGHRKO) mice have decreased endocrine IGF-I, increased local IGF-I, and altered body size, body composition, and adipokine profiles. Endocrinology. 2014;155(5):1793–1805. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Mueller KM, Kornfeld JW, Friedbichler K, et al. Impairment of hepatic growth hormone and glucocorticoid receptor signaling causes steatosis and hepatocellular carcinoma in mice. Hepatology. 2011;54(4):1398–1409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Liu Z, Cronstein B, Liu H, et al. IGF-1-independent actions of liver growth hormone receptor in male mice. The Endocrine Society's 98th Annual Meeting, Expo Boston, Boston, MA, 2016. OR40–2. [Google Scholar]
  • 60. Wakao H, Wakao R, Oda A, Fujita H. Constitutively active Stat5A and Stat5B promote adipogenesis. Environ Health Prev Med. 2011;16(4):247–252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Grygiel-Gorniak B. Peroxisome proliferator-activated receptors and their ligands: nutritional and clinical implications–a review. Nutr J. 2014;13:17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62. Chen L, Wang C, Huang S, et al. Effects of individual and multiple FAs (palmitate, oleate and docosahaexenoic acid) on cell viability and lipid metabolism in LO2 human liver cells. Mol Med Rep. 2014;10(6):3254–3260. [DOI] [PubMed] [Google Scholar]

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES