A Fast Method for DEFB1 - 44C/G SNP Genotyping in Brazilian Patients with Periodontitis

Abstract

Aim

Defensins are cationic antimicrobial peptides expressed in epithelial cells. Such peptides exhibit antibacterial, antifungal and antiviral properties, and are a component of the innate immune response. It has been suggested that they have a protective role in the oral cavity. This study evaluated the DEFB1 polymorphism in diabetic patients with or without periodontitis in comparison to healthy controls.

Material and Methods

We used Hairpin-Shaped Primer (HP) assay to study the distribution of the -44 C/G SNP (rs1800972) in 119 human DNAs obtained from diabetic patients and healthy control patients.

Results

The results indicate that there are no differences in distribution between groups and that in diabetic periodontitis patients the homozygous mutant could be found more frequently.

Conclusion

Further studies are necessary in order to investigate the role of DEFB1 polymorphisms in diabetic periodontitis patients and the influence of the peptide in periodontal pathogens.

INTRODUCTION

Human beta-defensins (hBD) are a family of small peptides, encoded by a gene cluster located on human chromosome 8p22-23 (1), exhibit a broad spectrum of antimicrobial activity against Gram-positive and Gram-negative bacteria, fungi and viruses. The antimicrobial action is postulated to be a disruption of the microbial membrane by pore formation (2). β-defensins are part of the innate immune system and act as the first line of human defence (3) and are primarily expressed by epithelial cells of the skin, kidneys and trachea-bronquial. β-defensins are released upon microbial invasion and are located at the host environment interface, such as mucosa and skin (4). Within β-defensins the human beta defensin 1 (hBD-1) is also known to play a direct role on inflammation pathway (5). In addition to their broad spectrum antimicrobial properties, there is evidence that hBD-1 act as chemokine for immature dendritic cells and memory T cells, and thus may serve as an important bridge between the innate and adaptive immune systems (6).

Single nucleotide polymorphisms (SNPs) are the most abundant form of genetic variation between individuals; some have been observed to cause several diseases (7) and have been proven to be useful tools for identifying genes involved in common polygenic and multifactorial diseases (8). Moreover, they are useful in understanding the pathogenesis of several diseases (9). Three SNPs localized at positions -52G>A (rs1799946), -44C>G (rs1800972), and -20G>A (rs11362) in the 5’ untranslated region (UTR) of DEFB1 gene have been reported to promote the same functional alteration of the hBD-1 expression in different cellular models (10, 11).

The C→G transversion at position -44 of the 5’ un-translated (UTR) region DEFB1 gene (which encodes human β-defensin 1) has been associated with Candida sp. carriage in the mouth (12) and with the risk of human immunodeficiency virus type 1 infection in the Caucasian population (1). However, there has not been an established association for two different ethnic groups for early-onset periodontal disease, Caucasian and African-Americans (9). The three 5’UTR DEFB1 gene SNPs exhibit differences in frequency between ethnic groups (12).

Periodontitis is a chronic inflammatory disease that affects the supporting tissues of the teeth (13) and has it been reported to be the sixth classic complication of the diabetic patient (14). It is generally accepted that the presence of bacteria is a necessary but not sufficient condition for the development of periodontitis. Host immune responses, genetic and environmental factors determine part of the susceptibility and severity of periodontitis (15). The development of periodontal disease seems to be determined by the relationship between the periodontopathogenic potential of the plaque and the immune response of the host (16).

Considering that the immune system plays a crucial role in the pathogenesis of periodontitis, the aim of this study was to analyze the presence of DEFB1 gene polymorphism in codon -44 C/G in a Brazilian patient sample with type 2 diabetes mellitus with and without chronic periodontitis compared with systemically and periodontally healthy patients.

Material and Methods

Study Population

This study is a case control design with a total of 118 participants. Eighty-four cases of type 2 diabetic patients were enrolled and followed up at the Department of Endocrinology of the Federal University of Pernambuco Hospital. Thirty-four unmatched healthy control patients were also enrolled. Free and informed written consent had been obtained from all patients. The research project was approved by the Ethics in Research Committee of the Federal University of Pernambuco.

Inclusion criteria for diabetic patients were: diagnosis of type 2 diabetes; having at least eight natural teeth. Exclusion criteria were: have used antibiotics for the last six months; have undergone periodontal treatment for the last six months, being pregnant or breastfeeding. Inclusion criteria for controls: no history of periodontitis, absence of any ≥ 3mm clinical attachment loss (CAL); absence of any ≥ 4mm probing pocket depth (PPD), no history of diabetes. All patients have registered socioeconomic data and underwent a clinical examination using a millimeter North Carolina-type periodontal probe (Trinity®, Brazil). Six sites per tooth were evaluated for PPD, BOP, CAL. Periodontal disease was defined as four or more sites with a loss of attachment of 5mm or more with one or more of those sites having a pocket of 4mm or more (17).

DNA extraction and Genotyping

After clinical examination, the collection of scaling cells from the oral mucosa was carried out with appropriate cytobrush-type brushes (Kolplast®, Sao Paulo, Brazil), which were subsequently stored in 1 ml of saline solution of 0.9% chloride sodium (Laboratory Tayuyna, Ltda – Nova Odessa, Sao Paulo, Brazil), the collected material was stored at -20şC for DNA extraction and performed with Geneclean® (GeneClean® kit, Bio 101, La Jolla, CA, USA) kit following manufacturer’s protocols.

The detection of polymorphism in position -44 C/G of 5’UTR region of DEFB1 was conducted by the technique Q-PCR and hairpin-shaped primer (HP). Sequences of the forward C- and G- allele specific HPs were: GGCTGGACCTCCAATGGAGCCAGCC (wild template) and CGCTGGACCTCCAATGGAGCCAGCG (mutant template), respectively. The common reverse primer was: CAGGATTTCAGGAACTGGGGAG, the length of amplicon was 45-bp. For each DNA sample two real-time PCRs of 25μl were run in parallel, one with C-allele-specific HP and the other with the G-allele-specific HP. Each reaction contained 12.5 μl SYBR Green PCR Master Mix 1X (LGC, Biotechnology, Australia), 1μM of each primer, 10ng of template DNA. All PCRs were run in a Rotor-Gene Q real-time PCR instrument (Qiagen, Cologne, Germany), thermal cycling conditions were divided in three stages as follows: stage 1 – 95o. C for 10 min, 70o.C for 30s; stage 2 – 72o.C for 30s, 95o.C for 20s, 69o.C for 30s lowering 1o.C each cycle for 10 cycles; stage 3 – 72o.C for 30s, 95o.C for 20s, 60o.C for 30s for 40 cycles. Data were collected in the last step of stage 3 in order to calculate the Ct of each amplification curve. This methodology was previously described (9).

Statistical Analysis

The confidence interval considered was 95%, so p-values less than 0.05 were accepted. The results which did not attain this value were considered to be without significance. All data analyses were performed using the statistical package SPSS version 13.0 (SPSS Inc., Chicago, IL, USA).

RESULTS

The mean age of the patients was 45.5 (18 – 82) years, 68.9% being female. The mean CAL of the diabetic patients group was 3.44mm, median 3.08mm and standard deviation of 1.45mm.

For the HP assay, the three possible genotypes were identified in a Brazilian sample of 119 patients; Figure 1 shows that the HP assays allows a clear discrimination of the three different genotypes, using human DNA.

Figure 1.

A, B, C. HP assay for detection of the -44 DEFB1 SNP. Genotypes C/C, C/G and G/G respectively, in the sample evaluated.

Regarding the distribution of genotypes, the sample presented 68 (57.1%) subjects with C/C, 39 (32.8%) C/G and 12 (10.1%) G/G. There were no significant differences between diabetic with or without periodontitis and healthy controls (Table 1). The genotype homozygous mutant was more frequently found in diabetic patients with periodontitis.

Table 1. Genotypes frequencies in DEFB1 gene in a Brazilian diabetic population and healthy controls.

Genotypes	Patients			P value*
	Diabetic patients		Healthy controls
	Periodontitis %	Without periodontitis %	%
C / C C / G G / G	50.0 (22/44) 34.1(15/44) 15.9 (7/44)	68.3 (28/41) 29.3 (12/41) 2.4 (1/41)	53.0 (18/34) 35.3 (12/34) 11.7 (4/34)	=0.232

* Chi-Square test, significance level at 5%, confidence level at 95%

The allele frequency is shown in Table 2. The allele mutant G was more frequently found in the diabetic periodontitis group. Considering allele frequencies there were no significant differences among the groups.

Table 2. Frequencies of the alleles -44 DEFB1 gene in a Brazilian diabetic population and healthy controls.

Allele	Patients
	Diabetic		Healthy Controls n (%)
	Periodontitis n (%)	Without periodontitis n (%)
C G	67.0 (59/88) 33.0 (29/88)	83.0 (68/82) 17.0 (14/82)	70.6 (48/68) 29.4 (20/68)

When considering the mean CAL in diabetic patients and healthy controls in relation to genotypes, no differences were established (p=0.49). Among the three groups, a higher percentage of the genotype C/C was found; in the group with diabetes and periodontitis the percentages between homozygous (C/C) and heterozygous (C/G) were similar (Figure 2).

Figure 2.

Allele frequency.

DISCUSSION

In the present study the HP assay was used to evaluate the polymorphism in codon -44 DEFB1 gene in a sample of diabetic Brazilian adult population in comparison with healthy controls. This method allowed distinguishing the three possible genotypes in the sample. Through amplification curve it was possible to identify the genotype in each patient. Samples which showed an earlier Ct with C HP were considered allele C homozygous, samples that had an earlier Ct with G HP were considered allele G homozygous and heterozygous samples showed similar Cts in both reactions.

The technique was simple, feasible, and previous authors reported that HPs increase the specificity and the sensitivity of PCRs assay (9, 18). Other authors used different techniques such as PCR-RFLP (19-21), real time PCR and probes (21) to evaluate the SNP in DEFB1 gene. In these methods manipulation after the PCR run is needed, and the superiority of the primers used in HP assay, over conventional linear primers for SNP detection, has previously been demonstrated (22).

The β-defensins are a family of antimicrobial peptides that have been implicated in the innate host defence system. Genetic variation in genes DEFB1 may underline changes in expression or configuration of the peptide. Such changes may be associated with alteration in innate response to pathologic challenge and may also result in susceptibility or resistance to certain types of infections (2). The association of DEFB1 -44C/G polymorphism in a Brazilian diabetic population with or without periodontitis in comparison to healthy control patients was evaluated in the study and no differences were observed among groups. The healthy control group exhibited a higher percentage of genotype homozygous wild (C/C), while the diabetic periodontitis group exhibited higher percentages of homozygous mutant (G/G) when compared to the other groups.

The genetic variability may cause differences in frequency of genotypes, alleles and, consequently, changes in host response according to ethnicity (12), but Jurevic et al. (2) have shown no differences considering ethnics in relation to SNP in site -44 of DEFB1 gene.

DEFB1 -44C/G polymorphism has been associated with many pathologic conditions such as chronic obstructive pulmonary disease, Candida carriage in the mouth (23), risk of human immunodeficiency virus type 1 in the Caucasian population (24), sepsis (25), Crohn´s disease (12), atopic dermatitis (26), lepromatous leprosy (21) and diabetes (3). A small number of studies have been made targeting DEFB1 polymorphism considering periodontal conditions, such as Boniotto et al. (9) that evaluated SNP of DEFB1 gene and periodontitis using HP assay. The present study is the first report of the application of a HP assay to SNP genotyping in a diabetic population with or without periodontitis and healthy controls.

Considering the total patient sample, the results of the present research, regarding genotypes, are in agreement with Boniotto et al. (9) but it disagrees with some previous researches (3, 24, 25, 27). In relation to alleles frequencies this research shows a higher percentage of G allele than others (2, 3, 9, 23-25, 27). This finding could be explained by ethnic differences that may influence the frequency and distribution of the SNP considering the sample was constituted by a Northeast Brazilian population, and a few studies have been made in such population to evaluate genetic factors interference in periodontal disease (16). In a previous study, Jurevic et al. (23) tried to demonstrate that G allele was associated with protective effect in diabetic patients in relation to Candida carriage, but no significant differences were found between diabetic and non-diabetic populations. The diabetic periodontitis group exhibited the most frequencies of genotype and allele mutant.

The lack of significant differences may be explained by the fact that human beta-defensin 1 is not active against periodontal bacteria and does not play a role in periodontal disease. Previous studies demonstrated that Treponemas may serve as a physical barrier protection between epithelium derived antimicrobial peptides and other defensins-sensitive bacteria involved in periodontal disease, contributing to the survival of these and other bacteria in the gingival crevice (28, 29). And also that Treponema denticola is resistant to peptide β-defensin-1 (29). Nevertheless, no data are available regarding the biological activity of this peptide against Aggregatibacter actinomycetemcomitans, Porphyromonas gingivalis, Tannerella forsythia, viruses and other microorganisms implicated in the pathogenesis of the periodontal disease.

CONCLUSION

In conclusion, the presence of SNP DEFB1 was evaluated in diabetic patients with or without periodontitis in comparison to healthy controls, being the first report investigating a possible association between DEFB1 in diabetic patients in relation to their periodontal condition. No significant differences were found and further studies should be performed in order to elucidate the role of DEFB1 polymorphisms in relation to periodontal disease, mainly its biological activity against the microorganisms involved in periodontitis.