Skip to main content
Einstein logoLink to Einstein
. 2014 Jul-Sep;12(3):336–341. doi: 10.1590/S1679-45082014AO3042
View full-text in Portuguese

Transcriptional expression study in the central nervous system of rats: what gene should be used as internal control?

Ana Carolina de Moura 1, Virgínia Meneghini Lazzari 1, Grasiela Agnes 1, Silvana Almeida 1, Márcia Giovenardi 1, Ana Beatriz Gorini da Veiga 1
PMCID: PMC4872946  PMID: 25295456

Abstract

Objective

A growing number of published articles report the expression of specific genes with different behavior patterns in rats. The levels of messenger ribonucleic acid transcripts are usually analyzed by reverse transcription followed by polymerase chain reaction and quantified after normalization with an internal control or reference gene (housekeeping gene). Nevertheless, housekeeping genes exhibit different expression in the central nervous system, depending on the physiological conditions and the area of the brain to be studied. The choice of a good internal control gene is essential for obtaining reliable results. This study evaluated the expression of three housekeeping genes (beta-actin, cyclophilin A, and ubiquitin C) in different areas of the central nervous system in rats (olfactory bulb, hippocampus, striatum, and prefrontal cortex).

Methods

Wistar rats (virgin females, n=6) during the diestrum period were used. Total ribonucleic acid was extracted from each region of the brain; the complementary deoxyribonucleic acid was synthesized by reverse transcription and amplified by real-time quantitative polymerase chain reaction using SYBR™ Green and primers specific for each one of the reference genes. The stability of the expression was determined using NormFinder.

Results

Beta-actin was the most stable gene in the hippocampus and striatum, while cyclophilin A and ubiquitin C showed greater stability in the prefrontal cortex and the olfactory bulb, respectively.

Conclusion

Based on our study, further studies of gene expression using rats as animal models should take into consideration these results when choosing a reliable internal control gene.

Keywords: Rats, Wistar; Brain; Gene expression; Real-time polymerase chain reaction; Genes, essential

INTRODUCTION

Structures in the central nervous system (CNS) such as olfactory bulb (OB), hippocampus (HP), striatum (ST), prefrontal cortex (PFC), posterodorsal medial amygdala (MePD), and medial preoptic area (MPOA) are responsible for the appearance and maintenance of different behaviors.(1, 2) Understanding the molecular mechanisms involved in the regulation of signaling pathways in the CNS has been the basis of many studies, which aimed to address how a pattern of behavior is controlled by the expression of a candidate gene or group of genes.(3)-5) Therefore, gene expression assays have been increasingly employed in behavioral studies using animal models, based on analysis of specific transcripts in the CNS and their association with different patterns of behavior.

Levels of expressed genes within a cell can be altered by a variety of conditions, such as the cell cycle phase or upon exposure to drugs, hormones, cytokines or other stimuli. Therefore, gene expression analysis requires precise and reproducible measurements of specific messenger ribonucleic acid (mRNA) sequences. The most common method used to quantify mRNA is the amplification of individual RNA molecules by combining reverse transcription and real-time polymerase chain reaction (RT-PCR),(6) which enables a sensitive and accurate quantification of mRNA expression levels. Nevertheless, the selection of an appropriate normalization strategy is necessary, in order to exclude possible experimental errors, thus providing more trustworthy data. Most gene expression experiments require ribonucleic acid (RNA) isolation and processing, and the final amount of RNA may vary among samples. Performing RT-PCR analysis requires controlled parameters to obtain reliable quantitative expression measures. These include variations in initial sample amount, RNA recovery, RNA integrity, efficiency of complementary deoxyribonucleic acid (cDNA) synthesis, and differences in the overall transcriptional activity of the tissues or cells analyzed.(7, 8)

The most frequently applied approach for normalization in studies of gene expression is the use of an internal control or an endogenous reference gene, often referred to as a housekeeping gene (HKG). HKG encode proteins that provide basic, essential functions that all cells need to survive. They are supposed to have stable expression levels in different cell types and tissues, across developmental stages and even under various conditions. However, several studies have shown that transcript levels of traditionally used HKG may vary considerably in specific cells under different experimental conditions.(7)-10)

In recent years, it has become clear that no single gene is constitutively expressed in all cell types and under all experimental conditions, implying that the expression stability of the intended control gene has to be verified before each particular experimental model.(7) For a gene to be used as an internal control, several criteria should be fulfilled: mRNA must be consistently expressed at the same level in all samples under investigation, regardless of tissue type, disease state, medication, or experimental conditions; expression levels must be comparable to that of the target; and the amplification of the reference gene should be RNA-specific. The importance of choosing a reliable internal control is underlined by the fact that the use of an unstable reference gene for normalization may obscure real changes or produce artificial modifications in gene expression. Therefore, the validation of an HKG for each experimental situation is a crucial requirement for the acquisition of meaningful biological data.(8, 11) For more generalized studies, the use of the geometric mean level of expression from several genes for normalization, as well as the use of three to five different control genes, depending on the tissue being studied, are recommended.(12)

Until now, a systematic study comparing the suitability of candidate reference genes in the rat central nervous system has not been performed. The results presented in this study can be helpful in further analyses of gene expression in rats’ brain.

OBJECTIVE

The aim of the present study was to select a sample set to analyze distinct brain regions and evaluate the most stable housekeeping gene in areas of the central nervous system related with various social behaviors.

METHODS

Animals

Virgin female Wistar rats (n=6) with at least 3 consecutive regular cycles, in the diestrus period, approximately 90 days old, from the animal house of the Universidade Federal de Ciências da Saúde de Porto Alegre (UFCSPA), in Porto Alegre (RS), Brazil, were used. They were housed in groups of three in Plexiglas™ cages (46cm × 17cm × 31cm). Food and water were provided ad libitum. Animals were housed under controlled temperature (21±1°C) and light (12:12 light-dark cycle with lights off at 5:00 pm) conditions.

All procedures were performed from 2009 to 2012, in conformity with the Brazilian Society of Neuroscience and Behavior Guidelines for the care and use of laboratory animals, and the protocols were approved by the Research Ethics Committee of UFCSPA (protocol 590/08).

Reference gene selection and primer design

Candidate reference genes were selected from those most commonly used in the literature. Primers for cyclophilin A (CypA) were as published by Peinnequin et al.(13) and Langnaese et al.(8) The beta-actin (ActB) and ubiquitin C (UbC) primers were designed using Primer3 software, based on rat sequences in the GenBank database. The specificity of the primers was checked using the Basic Local Alignment Search Tool (BLAST) search against nucleotide collection (nr) of the National Center for Biotechnology Information (NCBI) database. All primers were from Invitrogen™ (São Paulo, Brazil). The sequences of primers used are listed on table 1.

Table 1. Housekeeping genes selected for this study, sequences of primers, and gene function.

HKG Primer F Primer R Function (Langnaese et al.)(8)
ActB 5’TATGCCAACACAGTGCTGTCTGG3’ 5’TACTCCTGCTTGCTGATCCACAT3’ Cytoskeletal structural protein
CypA 5’TATCTGCACTGCCAAGACTGAGTG3’ 5’CTTCTTGCTGGTCTTGCCATTCC3’ Accelerate folding in oligopeptides
UbC 5’TTTCCATAGACAATGCAGATCTTT3’ 5’AGGGTGGACTCCTTCTGGAT3’ Protein degradation

ActB: beta-actin; CypA: cyclophilin A UbC: ubiquitin C.

Brain tissue samples

In order to determine the regularity of the estrous cycle, vaginal smears were taken from virgin female rats during 2 weeks before the beginning of the experiment. After the occurrence of three regular estrous cycles, experiments were performed on the morning of the diestrus phase. Rats were decapitated and their brains were quickly removed. The regions OB, HP, ST, and PFC were dissected from the left hemisphere. Soon after the samples were dissected, they were placed in tubes containing RNAlater™ (Life Technologies, São Paulo, Brazil) and stored at -80°C.

Molecular analyses

Total RNA was extracted from samples using TRIzol™ (Invitrogen™, São Paulo, Brazil). Briefly, each brain structure was homogenized in the presence of TRIzol™, chloroform was added (1:5, v/v), and the aqueous phase was obtained after centrifugation (12,000×g, 15 minutes). RNA was precipitated with isopropanol for 15 minutes at room temperature, followed by centrifugation at 12,000×g for 10 minutes. Pellets were resuspended in 0.1% diethylpyrocarbonate (DEPC)-treated water, and RNA was quantified by spectrophotometry. The concentration of total RNA was determined by measuring the optical density at 260nm and the RNA purity was assessed based on the 260nm/280nm ratio and agarose gel electrophoresis.(8)

Semi-quantitative RT-PCR has been well accepted and widely used as a valid method for analysis of gene expression in brain areas, as described elsewhere.(14)-16) For reverse transcription, 1μg of total RNA was used as template to synthesize cDNA. RNA was first incubated with 1μL of oligo(dT) (0.5μg/μL, Invitrogen™, São Paulo, Brazil), 1μL of deoxyribonucleotide triphosphate (dNTPs) (10mM) and DEPC-water to a final volume of 12μL for 5 minutes at 65°C and then for 1 minute in ice. The following reagents were then added to reach a final volume of 19μL:4μL of RT-PCR buffer (50mM TrisHCl, pH 8.3, 75mM KCl, 3mM MgCl2) and 2μL of DTT™ (0.1M). After 2 minutes of incubation at 37°C, 1μL of the enzyme reverse transcriptase encoded by moloney murine leukemia virus reverse transcriptase (M-MLV-RT; 200U/μL, Invitrogen™, São Paulo, Brazil) was added and cDNA synthesis was performed at 50°C for 1 hour; the reaction was inactivated by incubation at 70°C for 15 minutes.

Amplification of reference genes was carried out using 7.5μL of SYBR™ green polymerase chain reaction (PCR) master mix (Applied Biosystems™, São Paulo, Brazil), 0.5μL of forward and reverse primers (0.33µM each), 100ng of cDNA and nuclease-free water, in a total volume of 15μL. Reactions were performed in an optical 96-well plate, using a StepOnePlus™ thermocycler (Applied Biosystems™, Foster City, CA, USA). After an initial denaturation step at 95°C for 10 minutes, amplification was performed in 50 cycles of denaturation at 95°C for 30 seconds, annealing at 60°C for 40 seconds and extension at 72°C for 40 seconds. Amplification was followed by a melting curve analysis to confirm PCR product specificity. No signals were detected in no-template controls. The experimental threshold cycle (Ct) was calculated using the algorithm enhancements provided by the equipment. All samples were run in duplicate and the mean value of each duplicate was used for all further calculations.(8, 10, 17)

Determination of reference gene expression stability

The publicly available software tool, NormFinder (a Visual Basic application for Microsoft Excel), was used to analyze gene expression stability. It ranks HKG according to their expression stability using a model-based approach. The program estimates both the intra-and the inter-group expression variation and calculates candidate gene stability values.(7, 8)

Reporting the data obtained from the raw Ct values falsely represents the variation and error, so it should be avoided. This way, the expression of each HKG was calculated from the formula 2-Ct. This calculation transforms the logarithmic Ct data to a linear value. The 2-Ct form more accurately describes the individual variation among replicate reactions.(6, 18) Thus, NormFinder requires the transformation of Ct values to linear scale expression quantities, so the average Ct values of the duplicates were therefore exported into Microsoft Excel, and changed to the 2-Ct form, then the calculated quantities were entered into NormFinder,(19) where the candidate most stably expressed in the sample set investigated is the top ranked gene, which has the smallest stability value.(20)

RESULTS

Stability values were obtained by ranking candidate normalization genes with NormFinder. Figures 1 to 4 show that in the HP and in the ST the most stable HKG was ActB. On the other hand, Cyp A and UbC were more stable in the PFC and in the OB, respectively.

DISCUSSION

In some gene expression studies in the CNS, ActB was shown to be as stable as glyceraldehyde-3-phosphate dehydrogenase (GAPDH), but its stability depends on the tissue and conditions used in the analyses.(21, 22) Chen et al.(23) found that other constitutive genes, such as eukaryotic translation elongation factor (EF) and GAPDH, are more stable than ActB in some areas of the brain such as the auditory cortex and the cochlea of rats, and thus should be considered as reference genes in quantitative gene expression analyses in these regions. Yet, many studies based on RT-PCR to evaluate gene expression in different brain regions – such as PFC, ST, HP, and cerebellum – use ActB as reference gene.(14)-16, 24)

Our results show that ActB is the most stable HKG in the HP of our sample set. In a study by Langnaese et al.,(8) ActB and CypA were shown to be the most stable genes in the HP of their analysis. These two HKG were also used as control genes in a study by Nishida et al.,(25) because their expression levels are considered stable in this brain area. On the other hand, Honkaniemi et al.(26) used only CypA in an ischemia model that analyzes gene expression in the HP.

In ST we also found ActB as the most stably expressed gene. However, Benn et al.(9) identified that UbC is more stable than ActB in this area. Honkaniemi et al.(26) examined the expression of CypA to compare the ischemic changes with general transcriptional levels in the ST.

CypA displayed the most stable expression in the PFC according to our analysis. Prior studies on gene expression levels made use mainly of one of the traditional HKG such as GAPDH, 18S, or CypA in the whole brain of adult Wistar rats.(17) Honkaniemi et al.(26) also examined the expression of CypA in the cortex of rats in an ischemic model. Furthermore, Benn et al.(9) identified UbC as being stably expressed in the cortex, rather than ActB. But Yamada et al.(27) used ActB as a reference for gene amplification, as well as Soria-Fregozo et al.,(14) who chose ActB as an internal control for quantifying mRNA in the PFC.

We found that UbC is the most stable HKG in the OB. UbC has been used in several studies of gene expression, such as in the human brain(24, 28) and rat liver.(29) But Wong et al.(30) analyzed the expression of ActB and CypA in the OB of rats.

Our study had some limitations. After RNA extraction with TRIzol™, samples were not incubated with DNAse, however the purity of the RNA was checked by agarose gel electrophoresis and no DNA was present in the samples. Another limitation was that the analyses were based on semi-quantitative RT-PCR. Even though more recent studies on gene expression are based on quantitative PCR, many studies have been based on conventional RT-PCR; as a matter of fact, this had been the most used molecular technique for gene expression analyses until recently, therefore its use does not impair our results or other previous findings.

CONCLUSIONS

The variations on the stability of housekeeping genes in the different central nervous system areas probably occur due to the variability in the samples used in each study. Therefore, the validation of reference genes for each experimental situation is a crucial requirement for the acquisition of meaningful and reliable data for any sort of analysis. Once the housekeeping gene has been selected for each central nervous system area, further analysis relating the expression of target genes in animal models can be accomplished with the security of using a stable control gene.

Figure 1. Housekeeping genes stability in the prefrontal cortex.

Figure 1

Figure 2. Housekeeping genes stability in the hippocampus.

Figure 2

Figure 3. Housekeeping gene stability in the olfactory bulb.

Figure 3

Figure 4. Housekeeping gene stability in the striatum.

Figure 4

REFERENCES

  • 1.Castilhos J, Marcuzzo S, Forti CD, Frey RM, Stein D, Achaval M, et al. Further studies on the rat posterodorsal medial amygdala: dendritic spine density and effect of 8-OH-DPAT microinjection on male sexual behavior. Brain Res Bull. 2006;69(2):131–139. doi: 10.1016/j.brainresbull.2005.11.013. [DOI] [PubMed] [Google Scholar]
  • 2.Rasia AA, Filho, Haas D, Oliveira AP, Castilhos J, Frey R, Stein D, et al. Morphological and functional features of the sex steroid-responsive posterodorsal medial amygdala of adult rats. Mini Rev Med Chem. 2012;12(11):1090–1106. doi: 10.2174/138955712802762211. Review. [DOI] [PubMed] [Google Scholar]
  • 3.Röskam S, Koch M. Effects of neonatal and peripubertal ethanol treatment on various aspects of adult rat behavior and brain anatomy. Int J Dev Neurosci. 2009;27(3):249–256. doi: 10.1016/j.ijdevneu.2008.12.009. [DOI] [PubMed] [Google Scholar]
  • 4.Djordjevic J, Djordjevic A, Adzic M, Radojcic MB. Effects of chronic social isolation on Wistar rat behavior and brain plasticity markers. Neuropsychobiology. 2012;66(2):112–119. doi: 10.1159/000338605. [DOI] [PubMed] [Google Scholar]
  • 5.Ruthschilling CA, Albiero G, Lazzari VM, Becker RO, Moura AC, Giovenardi M, et al. Analysis of transcriptional levels of the oxytocin receptor in different areas of the central nervous system and behaviors in high and low licking rats. Behav Brain Res. 2012;228(1):176–184. doi: 10.1016/j.bbr.2011.12.005. [DOI] [PubMed] [Google Scholar]
  • 6.Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, Reed MW. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods. Anal Biochem. 2000;285(2):194–204. doi: 10.1006/abio.2000.4753. [DOI] [PubMed] [Google Scholar]
  • 7.Andersen CL, Jensen JL, Ørntoft TF. Normalization of real-time quantitative reverse transcription-PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 2004;64(15):5245–5250. doi: 10.1158/0008-5472.CAN-04-0496. [DOI] [PubMed] [Google Scholar]
  • 8.Langnaese K, John R, Schweizer H, Ebmeyer U, Keilhoff G. Selection of reference genes for quantitative real-time PCR in a rat asphyxial cardiac arrest model. 53BMC Mol Biol. 2008;9 doi: 10.1186/1471-2199-9-53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Benn CL, Fox H, Bates GP. Optimisation of region-specific reference gene selection and relative gene expression analysis methods for pre-clinical trials of Huntington’s disease. 17Mol Neurodegener. 2008;3 doi: 10.1186/1750-1326-3-17. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Cook NL, Kleinig TJ, van den Heuvel C, Vink R. Reference genes for normalising gene expression data in collagenase-induced rat intracerebral haemorrhage. 7BMC Molecular Biology. 2010;11 doi: 10.1186/1471-2199-11-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gubern C, Hurtado O, Rodríguez R, Morales JR, Romera VG, Moro MA, et al. Validation of housekeeping genes for quantitative real-time PCR in in-vivo and in-vitro models of cerebral ischaemia. 57BMC Mol Biol. 2009;10 doi: 10.1186/1471-2199-10-57. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Barber RD, Harmer DW, Coleman RA, Clark BJ. GAPDH as a housekeeping gene: analysis of GAPDH mRNA expression in a panel of 72 human tissues. Physiol Genomics. 2005;21(3):389–395. doi: 10.1152/physiolgenomics.00025.2005. [DOI] [PubMed] [Google Scholar]
  • 13.Peinnequin A, Mouret C, Birot O, Alonso A, Mathieu J, Clarençon D, et al. Rat pro-inflammatory cytokine and cytokine related mRNA quantification by real-time polymerase chain reaction using SYBR green. 3BMC Immunol. 2004;5 doi: 10.1186/1471-2172-5-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Soria-Fregozo C, Pérez-Vega MI, González-Burgos I, Feria-Velasco A, Beas-Zárate C. Prefrontal serotonergic denervation induces increase in the density of 5-HT2A receptors in adult rat prefrontal cortex. Neurochem Res. 2008;33(11):2350–2357. doi: 10.1007/s11064-008-9740-7. [DOI] [PubMed] [Google Scholar]
  • 15.Hatami H, Hossainpour-Faizi MA, Azarfarin M, Azarfam P. Chronic ecstasy use increases neurotrophin-4 gene expression and protein levels in the rat brain. Pharmacol Rep. 2010;62(6):998–1004. doi: 10.1016/s1734-1140(10)70361-3. [DOI] [PubMed] [Google Scholar]
  • 16.Blanco E, Campos-Sandoval JA, Palomino A, Luque-Rojas MJ, Bilbao A, Suárez J, et al. Cocaine modulates both glutaminase gene expression and glutaminase activity in the brain of cocaine-sensitized mice. Psychopharmacology (Berl) 2012;219(4):933–944. doi: 10.1007/s00213-011-2418-x. [DOI] [PubMed] [Google Scholar]
  • 17.Nelissen K, Smeets K, Mulder M, Hendriks JJ, Ameloot M. Selection of reference genes for gene expression studies in rat oligodendrocytes using quantitative real time PCR. J Neurosci Methods. 2010;187(1):78–83. doi: 10.1016/j.jneumeth.2009.12.018. [DOI] [PubMed] [Google Scholar]
  • 18.Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C (T)) Method. Methods. 2001;25(4):402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  • 19.MOMA - Department of Molecular Medicine. Aarhus University Hospital. Molecular Diagnostic Laboratory [2014 Aug 10;];Denmark: Department of Molecular Medicine, Aarhus University Hospital. NormFinder software version. 2010 20 http://moma.dk/normfinder-software Internet. software. [Google Scholar]
  • 20.MOMA - Department of Molecular Medicine. Aarhus University Hospital. Molecular Diagnostic Laboratory [2014 Aug 10;];Denmark: Department of Molecular Medicine, Aarhus University Hospital, Documentation for NormFinder version. 2010 20 http://moma.dk/files/Normfinder% 20documentation-v20.pdf Internet. [Google Scholar]
  • 21.Tanic N, Perovic M, Mladenovic A, Ruzdijic S, Kanazir S. Effects of aging, dietary restriction and glucocorticoid treatment on housekeeping gene expression in rat cortex and hippocampus-evaluation by real time RT-PCR. J Mol Neurosci. 2007;32(1):38–46. doi: 10.1007/s12031-007-0006-7. [DOI] [PubMed] [Google Scholar]
  • 22.Bonefeld BE, Elfving B, Wegener G. Reference genes for normalization: a study of rat brain tissue. Synapse. 2008;62(4):302–309. doi: 10.1002/syn.20496. [DOI] [PubMed] [Google Scholar]
  • 23.Chen J, Ruan R. Identifying stable reference genes for evaluation of antioxidative enzyme gene expression in auditory cortex and cochlea of young and old Fischer 344 rats. Acta Otolaryngol. 2009;129(6):644–650. doi: 10.1080/00016480802311015. [DOI] [PubMed] [Google Scholar]
  • 24.Vandesompele J, Preter K, Pattyn F, Poppe B, Van Roy N, Paepe A, et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002;3(7) doi: 10.1186/gb-2002-3-7-research0034. RESEARCH0034. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Nishida Y, Sugahara-Kobayashi M, Takahashi Y, Nagata T, Ishikawa K, Asai S. Screening for control genes in mouse hippocampus after transient forebrain ischemia using high-density oligonucleotide array. J Pharmacol Sci. 2006;101(1):52–57. doi: 10.1254/jphs.fp0050881. [DOI] [PubMed] [Google Scholar]
  • 26.Honkaniemi J, States BA, Weinstein PR, Espinoza J, Sharp FR. Expression of zinc finger immediate early genes in rat brain after permanent middle cerebral artery occlusion. J Cereb Blood Flow Metab. 1997;17(6):636–646. doi: 10.1097/00004647-199706000-00005. [DOI] [PubMed] [Google Scholar]
  • 27.Yamada M, Iwabuchi T, Takahashi K, Kurahashi C, Ohata H, Honda K, et al. Identification and expression of frizzled-3 protein in rat frontal cortex after antidepressant and electroconvulsive treatment. J Pharmacol Sci. 2005;99(5):239–246. doi: 10.1254/jphs.fp0050461. [DOI] [PubMed] [Google Scholar]
  • 28.Coulson DT, Brockbank S, Quinn JG, Murphy S, Ravid R, Johnston JA, et al. Identification of valid reference genes for the normalization of RT qPCR gene expression data in human brain tissue. 46BMC Molecular Biol. 2008;9 doi: 10.1186/1471-2199-9-46. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Xing W, Deng M, Zhang J, Huang H, Dirsch O, Dahmen U. Quantitative evaluation and selection of reference genes in a rat model of extended liver resection. J Biomol Techn. 2009;20(2):109–115. [PMC free article] [PubMed] [Google Scholar]
  • 30.Wong CC, Poon WH, Tsim TY, Wong EY, Leung MS. Gene expressions during the development and sexual differentiation of the olfactory bulb in rats. Brain Res Dev Brain Res. 2000;119(2):187–194. doi: 10.1016/s0165-3806(99)00173-x. [DOI] [PubMed] [Google Scholar]
Einstein (Sao Paulo). 2014 Jul-Sep;12(3):336–341. [Article in Portuguese]

Estudo de expressão transcricional no sistema nervoso central de ratos: qual gene deve ser usado como controle interno?

Ana Carolina de Moura 1, Virgínia Meneghini Lazzari 1, Grasiela Agnes 1, Silvana Almeida 1, Márcia Giovenardi 1, Ana Beatriz Gorini da Veiga 1

Abstract

Objetivo

Um número crescente de artigos publicados relaciona a expressão de genes específicos com diferentes padrões de comportamento em ratos. Os níveis de transcritos de ácido ribonucleico mensageiro são geralmente analisados por transcrição reversa, seguida de reação em cadeia da polimerase, e quantificados após a normalização com um controle interno ou gene de referência (gene housekeeping). No entanto, os genes housekeeping exibem expressão diferencial no sistema nervoso central, dependendo das condições fisiológicas e da área do cérebro a ser estudada. A escolha de um bom gene de controle interno é essencial para a obtenção de resultados confiáveis. Este estudo avaliou a expressão de três genes housekeeping (beta-actina, ciclofilina A e ubiquitina C) em diferentes áreas do sistema nervoso central de ratos (bulbo olfatório, hipocampo, estriado e córtex pré-frontal).

Métodos

Foram usadas ratas Wistar (fêmeas virgens, n=6) durante o período de diestro. O ácido ribonucleico total foi extraído a partir de cada região do cérebro; o ácido desoxirribonucleico complementar foi sintetizado por transcrição reversa e amplificado por reação em cadeia da polimerase quantitativo em tempo real utilizando SYBR® Green e primers específicos para cada um dos genes de referência. A estabilidade de expressão foi determinada utilizando NormFinder.

Resultados

A beta-actina foi o gene mais estável no hipocampo e estriado, enquanto a ciclofilina A e a ubiquitina C apresentaram maior estabilidade no córtex pré-frontal e no bulbo olfatório, respectivamente.

Conclusão

Com base em nosso trabalho, estudos posteriores de expressão gênica utilizando ratos como modelos animais devem levar estes resultados em conta na escolha de um gene de controle interno confiável.

Keywords: Ratos Wistar, Encéfalo, Expressão gênica, Reação em cadeia da polimerase em tempo real, Genes essenciais

INTRODUÇÃO

Algumas estruturas no sistema nervoso central (SNC), como bulbo olfatório (OB), hipocampo (HP), estriado (ST), córtex pré-frontal (PFC), amígdala medial posterodorsal (MePD) e área pré-óptica medial (MPOA), são responsáveis pela aparência e pela manutenção de diferentes comportamentos.(1, 2) A compreensão dos mecanismos moleculares envolvidos na regulação das vias de sinalização no SNC serviu de base para muitos estudos, que visaram analisar como um padrão de comportamento é controlado pela expressão de um gene candidato ou de grupo de genes.(3)-5) Assim, ensaios sobre a expressão de genes são cada vez mais usados em estudos comportamentais com modelos animais, com base na análise de transcritos específicos no SNC e sua associação com diferentes padrões de comportamento.

Os níveis de expressão de um gene dentro de uma célula podem ser alterados por diversas condições, como a fase do ciclo celular ou a exposição a drogas, hormônios, citocinas ou outros estímulos. Logo, a análise da expressão de genes requer medidas precisas e reprodutíveis de sequências específicas de ácido ribonucleico mensageiro (mRNA). O método mais comum de quantificação de mRNA é a amplificação de moléculas individuais de RNA, pela combinação de transcrição reversa e pela reação da cadeia de polimerase em tempo real (RT-PCR),(6) que permitem uma quantificação sensível e acurada dos níveis de expressão de mRNA. Mesmo assim, é necessário haver seleção de uma estratégia apropriada de normalização para excluir possíveis erros experimentais, fornecendo, desse modo, dados mais confiáveis. A maioria dos experimentos de expressão gênica requer isolamento e processamento do ácido ribonucleico (RNA), e a quantidade final de RNA pode variar entre as amostras. A realização de análises RT-PCR demanda parâmetros controlados para a obtenção de medidas quantitativas confiáveis de expressão. Estas incluem variações na quantidade da amostra inicial, recuperação de RNA, integridade de RNA, eficiência de síntese do ácido desoxirribonucleico complementar (cDNA) e diferenças na atividade geral de transcrição dos tecidos ou células analisados.(7, 8)

A abordagem usada mais frequentemente para normalização em estudos de expressão gênica é o emprego de um controle interno ou gene de referência endógeno, frequentemente chamado de gene housekeeping (HKG). Os HKG codificam proteínas que oferecem funções básicas, essenciais, das quais todas as células necessitam para sobreviver. Eles devem ter níveis de expressão estáveis em diferentes tipos de células e tecidos, por todos os estágios de desenvolvimento, e mesmo em várias condições. Entretanto, vários estudos mostraram que os níveis de transcrição de HKG usados tradicionalmente podem variar de forma considerável em células específicas em condições experimentais diferentes.(7)-10)

Nos últimos anos, ficou claro que nenhum gene isolado é expresso constitutivamente em todos os tipos de células e sob todas as condições experimentais, sugerindo que a estabilidade de expressão do gene de controle considerado tem de ser verificada antes de cada modelo experimental particular.(7) Para que um gene seja usado como controle interno, diversos critérios devem ser satisfeitos: o mRNA tem de ser expresso de modo consistente no mesmo nível em todas as amostras sob investigação, independentemente do tipo de tecido, estado de doença, medicação ou condição experimental; os níveis de expressão têm de ser comparáveis aos do alvo; e a amplificação do dado gene de referência deve ser específica para o RNA. A importância da escolha de um controle interno confiável é salientada pelo fato de que o uso de um gene de referência instável para normalização pode obscurecer as reais alterações ou produzir modificações artificiais na expressão do gene. Assim, a validação de um HKG para cada situação experimental é um requerimento crucial para a aquisição de dados biológicos significantes.(8, 11) Para estudos mais generalizados, são recomendados o uso do nível geométrico médio de expressão de vários genes para normalização e também o uso de três a cinco genes de controle diferentes, dependendo do tecido a ser estudado.(12)

Ainda não foi realizado um estudo sistemático que comparasse a capacidade de adequação de genes de referência candidatos no sistema nervoso central de ratos. Os resultados apresentados neste estudo podem ser úteis em análises posteriores de expressão gênica no cérebro de ratos.

OBJETIVO

O objetivo do presente estudo foi selecionar uma amostra para analisar regiões distintas do cérebro e avaliar as áreas mais estáveis do gene housekeeping do sistema nervoso central, relacionadas a vários comportamentos sociais.

MÉTODOS

Animais

Foram usadas ratas Wistar virgens (n=6) com pelo menos 3 ciclos regulares consecutivos, no período diestro, com aproximadamente 90 dias de idade, do biotério da Universidade Federal de Ciências da Saúde de Porto Alegre (UFCSPA), em Porto Alegre (RS). Elas foram abrigadas em grupos de três em gaiolas de Plexiglas® (46cm × 17cm × 31cm). Alimento e água foram oferecidos à vontade. Os animais foram abrigados em condições controladas de temperatura (21±1°C) e de luz (ciclos claro-escuro 12:12, com as luzes apagadas às 17h).

Todos os procedimentos foram realizados de 2009 a 2012, em conformidade com as Diretrizes da Sociedade Brasileira de Neurociências e Comportamento para o cuidado e uso de animais de laboratório, e os protocolos foram aprovados pelo Comitê de Ética em Pesquisa da UFCSPA (protocolo 590/08).

Seleção de gene de referência e desenho de primer

Genes de referência candidatos foram selecionados entre os mais comumente usados na literatura. Os primers para ciclofilina A (CypA) estavam de acordo com o que foi descrito por Peinnequin et al.(13) e Langnaese et al.(8) Os primers de beta-actina (ActB) e ubiquitina C (UbC) foram projetados usando o software Primer3, com base em sequências de ratos no banco de dados GenBank. A especificidade dos primers foi verificada usando a ferramenta de busca Basic Local Alignment Search Tool (BLAST) para coleção de nucleotídeos (nr) do banco de dados do National Center for Biotechnology Information (NCBI). Todos os primers foram da Invitrogen® (São Paulo, Brasil). A sequência de primers usados está descrita na tabela 1.

Tabela 1. Genes housekeeping selecionados para este estudo, sequências de primers e função do gene.

HKG Primer F Primer R Função (Langnaese et al.)(8)
ActB 5’TATGCCAACACAGTGCTGTCTGG3’ 5’TACTCCTGCTTGCTGATCCACAT3’ Proteína do citoesqueleto estrutural
CypA 5’TATCTGCACTGCCAAGACTGAGTG3’ 5’CTTCTTGCTGGTCTTGCCATTCC3’ Acelera o dobramento nos oligopeptídeos
UbC 5’TTTCCATAGACAATGCAGATCTTT3’ 5’AGGGTGGACTCCTTCTGGAT3’ Degradação de proteínas

ActB: beta-actina; CypA: ciclofilina A; UbC: ubiquitina C.

Amostras de tecido cerebral

Para determinar a regularidade do ciclo estral, foram colhidos esfregaços vaginais das ratas virgens durante 2 semanas antes do início do experimento. Após a ocorrência de três ciclos estrais regulares, os experimentos foram feitos na manhã da fase diestro. As ratas foram decapitadas e seus cérebros foram rapidamente removidos. As regiões OB, HP, ST e PFC foram dissecadas do hemisfério esquerdo. Logo depois, as amostras dissecadas foram colocadas em tubos contendo RNAlater® (Life Technologies, São Paulo, Brasil) e armazenadas a -80°C.

Análises moleculares

O RNA total foi extraído de amostras usando TRIzol® (Invitrogen®, São Paulo, Brasil). Rapidamente, cada estrutura cerebral foi homogeneizada na presença de TRIzol®; acrescentou-se clorofórmio (1:5, v/v) e obteve-se a fase aquosa após centrifugação (12.000×g, 15 minutos). O RNA foi precipitado com isopropanol por 15 minutos em temperatura ambiente, seguido por centrifugação a 12.000×g por 10 minutos. Os pellets foram novamente suspensos em água tratada com 0,1% dietilpirocarbonato (DEPC) e o RNA foi quantificado por espectrofotometria. A concentração total de RNA foi determinada pela mensuração da densidade óptica a 260nm e a pureza do RNA foi avaliada com base na proporção 260nm/280nm e eletroforese em gel de agarose.(8)

A RT-PCR semiquantitativa é bem aceita e amplamente usada como um método valido para análise de expressão gênica nas áreas do cérebro, como já descrito em outros trabalhos.(14)-16) Para a transcrição reversa, 1μg de RNA total foi usado como molde para sintetizar cDNA. RNA foi incubado com 1μL de oligo(dT) (0,5μg/μL, Invitrogen®, São Paulo, Brasil), 1μL de desoxirribonucleotídeo trifosfato (dNTPs) (10mM) e água-DEPC para um volume final de 12μL, por 5 minutos a 65°C e, depois, por 1 minuto em gelo. Os seguintes reagentes foram então adicionados para atingir um volume final de 19μL:4μL de tampão RT-PCR (50mM TrisHCl, pH 8,3, 75mM KCl, 3mM MgCl2) e 2μL de DTT® (0,1M). Após 2 minutos de incubação a 37°C, 1μL da transcriptase reversa codificada pelo moloney muri ne leukemia virus reverse transcriptase (M-MLV-RT) (200U/μL, Invitrogen®, São Paulo, Brasil) foi adicionado e a síntese de cDNA foi feita a 50°C por 1 hora. A reação foi inativada por incubação a 70°C por 15 minutos.

A amplificação dos genes de referência foi feita usando 7,5μL de SYBR ® green polymerase chain reaction (PCR) master mix (Applied Biosystems®, São Paulo, Brasil), 0,5μL de primers forward e reverse (0,33µM cada), 100ng de cDNA e água livre de nuclease, em um volume total de 15μL. As reações foram feitas em uma placa óptica de 96 poços, usando um termociclador StepOnePlus® (Applied Biosystems®, Foster City, CA, EUA). Após o passo inicial de desnaturação a 95°C por 10 minutos, a amplificação foi realizada em 50 ciclos de desnaturação a 95°C por 30 segundos, com anelamento de 60°C por 40 segundos e extensão a 72°C por 40 segundos. A amplificação foi seguida por uma análise de curva de fusão para confirmar a especificidade do produto do PCR. Nenhum sinal foi detectado nos controles sem molde (no-template). O limiar do ciclo (Ct) experimental foi calculado usando os algoritmos de realce fornecidos pelo equipamento. Todas as amostras foram processadas em duplicata, e o valor médio de cada duplicata foi usado para todos os cálculos restantes.(8, 10, 17)

Determinação da estabilidade de expressão do gene de referência

Foi usada a ferramenta disponível publicamente NormFinder (um aplicativo Visual Basic para Microsoft Excel) para analisar a estabilidade de expressão do gene. Ela faz a classificação dos HKG, segundo sua estabilidade de expressão, usando uma abordagem baseada em modelo. O programa estima a variação de expressão tanto intragrupo como intergrupo e calcula os valores de estabilidade do gene candidato.(7, 8)

O relato dos dados obtidos dos valores brutos de Ct representa de maneira falsa a variação e erros, devendo ser evitado. Assim, a expressão de cada HKG foi calculada a partir da fórmula 2-Ct. Este cálculo transforma os dados logarítmicos de Ct em um valor linear. A forma 2-Ct descreve, de modo mais preciso, a variação individual entre as reações de replicação.(6, 18) Consequentemente, o NormFinder requer a transformação de valores de Ct em quantidades de expressão numa escala linear, de forma que os valores médios de Ct foram, então, exportados para Microsoft Excel e alterados para a forma 2-Ct, e depois as quantidades calculadas foram colocadas no NormFinder,(19) onde o candidato com expressão mais estável no conjunto da amostra é o gene com a primeira colocação, que tem o menor valor de estabilidade.(20)

RESULTADOS

Na classificação de genes candidatos de normalização com o NormFinder, foram obtidos os valores de estabilidade. As figuras 1 a 4 mostram que em HP e ST, o HKG mais estável foi ActB. Por outro lado, Cyp A e UbC foram mais estáveis em PFC e OB, respectivamente.

DISCUSSÃO

Em alguns estudos de expressão gênica no SNC, ActB se mostrou tão estável quanto gliceraldeído-3-fosfato desidrogenase (GAPDH), mas sua estabilidade depende dos tecidos e das condições usados nas análises.(21, 22) Chen et al.(23) verificaram que outros genes constitutivos, como o fator de alongamento da tradução eucariótica (EF, do inglês elongation factor) e GAPDH são mais estáveis do que ActB em algumas áreas do cérebro, como o córtex auditivo e a cóclea de ratos, e que devem, portanto, ser considerados genes de referência em análises quantitativas de expressão gênica nessas regiões. Todavia, muitos estudos baseados em RT-PCR para avaliar a expressão de genes em diferentes regiões do cérebro – como PFC, ST, HP e cerebelo – utilizam ActB como gene de referência.(14)-16, 24)

Nossos resultados mostram que ActB é o HKG mais estável no HP do conjunto de nossa amostra. Em um estudo realizado por Langnaese et al.,(8) ActB e CypA provaram ser os genes mais estáveis no HP de sua análise. Esses dois HKG foram também usados como genes de controle em um estudo por Nishida et al.,(25) porque seus níveis de expressão são considerados estáveis nessa área do cérebro. Por outro lado, Honkaniemi et al.(26) usaram apenas CypA em um modelo de isquemia que analisa a expressão gênica no HP.

No ST, também identificamos ActB como o gene mais estável. Contudo, Benn et al.(9) verificaram que UbC é mais estável que ActB nessa área. Honkaniemi et al.(26) examinaram a expressão de CypA para comparar as alterações isquêmicas com os níveis gerais de transcrição no ST.

CypA demonstrou a expressão mais estável no PFC segundo nossa análise. Estudos anteriores de níveis de expressão gênica usaram principalmente um dos HKG mais tradicionais, como GAPDH, 18S ou CypA, no cérebro inteiro de ratos Wistar adultos.(17) Honkaniemi et al.(26) também examinaram a expressão de CypA no córtex de ratos em um modelo isquêmico. Ademais, Benn et al.(9) identificaram UbC como tendo expressão estável no córtex, em vez de ActB. Contudo, Yamada et al.(27) usaram ActB como referência para amplificação de genes, além de Soria-Fregozo et al.,(14) que escolheram ActB como um controle interno para quantificar mRNA no PFC.

Vimos que UbC é o HKG mais estável no OB. UbC já foi usada em vários estudos de expressão gênica, como no cérebro humano(24, 28) e fígado de rato.(29) Todavia, Wong et al.(30) analisaram a expressão de ActB e CypA no OB de ratos.

Nosso estudo teve algumas limitações. Após a extração de RNA com TRIzol®, as amostras não foram incubadas com DNAse, mas a pureza do RNA foi verificada por eletroforese em gel de agarose e nenhum DNA estava presente nas amostras. Outra limitação foi o fato de as análises serem baseadas em RT-PCR semiquantitativa. Mesmo que os estudos mais recentes sobre a expressão de genes sejam baseados em PCR quantitativo, muitas investigações foram baseadas em RT-PCR convencional. Aliás, essa foi a técnica molecular para análise de expressão gênica mais usada até recentemente e, portanto, seu uso não prejudica nossos resultados ou outros achados anteriores.

CONCLUSÃO

As variações na estabilidade dos genes housekeeping nas diferentes áreas do sistema nervoso central ocorrem provavelmente devido à variabilidade nas amostras usadas em cada estudo. Assim, a validação dos genes de referência para cada situação experimental é um requisito essencial para aquisição de dados significativos e confiáveis para qualquer tipo de análise. Uma vez selecionado o gene housekeeping para cada área do sistema nervoso central, as análises adicionais podem ser feitas com a segurança do uso de um gene de controle mais estável.

Figura 1. Estabilidade do gene housekeeping no córtex pré-frontal.

Figura 1

Figura 2. Estabilidade do gene housekeeping no hipocampo.

Figura 2

Figura 3. Estabilidade do gene housekeeping no bulbo olfatório.

Figura 3

Figura 4. Estabilidade do gene housekeeping no estriado.

Figura 4


Articles from Einstein are provided here courtesy of Instituto de Ensino e Pesquisa Albert Einstein

RESOURCES