Abstract
Members of the TRP superfamily of ion channels mediate mechanosensation in some organisms, and have been suggested as candidates for the mechanotransduction channel in vertebrate hair cells. Some TRP channels can be ruled out based on lack of an inner ear phenotype in knockout animals or pore properties not similar to the hair-cell channel. Such studies have excluded Trpv4, Trpa1, Trpml3, Trpm1, Trpm3, Trpc1, Trpc3, Trpc5, and Trpc6. However, others remain reasonable candidates. We used data from an RNA-seq analysis of gene expression in hair cells as well as data on TRP channel conductance to narrow the candidate group. We then characterized mice lacking functional Trpm2, Pkd2, Pkd2l1, Pkd2l2 and Pkd1l3, using scanning electron microscopy, auditory brainstem response, permeant dye accumulation, and single-cell electrophysiology. In all of these TRP-deficient mice, and in double and triple knockouts, mechanotransduction persisted. Together with published studies, these results argue against the participation of any of the 33 mouse TRP channels in hair cell transduction.
Introduction
Sound conducted to the cochlea causes the movement of stereocilia on hair cells, the receptor cells of the inner ear. Sub-micron deflection of the bundle of stereocilia on a hair cell opens ion channels in microseconds, allowing influx of cations and the generation of a receptor potential [1,2]. Although a great deal is known about the ultrastructure and molecular mechanics of the mechanotransdution apparatus, the molecular identity of the transduction channel has been uncertain.
The physiological properties of this elusive channel provide a fingerprint for screening candidates. The transduction channel is a nonselective cation channel with high permeability to Ca2+ (PCa/PNa = 5–20) [3,4,5]. Although many divalent cations are permeant, they are also channel blockers: the channel can be blocked by Ca2+ (IC50 = 1 mM), Mg2+, La3+ (4 μm), and Gd3+ (3 μm) [6,7,8]. The single channel conductance varies considerably, ranging from about 80 to 150 pS in 2–3 mM extracellular Ca2+, and is roughly twice that in low Ca2+ [6,9,10,11,12]. Some organic cations are also permeant blockers, such as amiloride (IC50 = 50 μm [13]), the fluorescent dye FM1-43 (2 μm [14]) and the antibiotic dihydrostreptomycin (10‐70 μM [4,15,16]). The block is voltage dependent indicating that these cations block within the pore, part way along the transmembrane electric field [14,17]. Finally, transduction channels are partially permeable to large organic cations, such as choline and TEA, up to about 12 Å diameter [8]. The current view of the transduction channel shows a funnel-shaped channel with an outer vestibule and 12 Å selectivity filter [8,16,18,19]. These properties suggested that members of the transient receptor potential (TRP) family of ion channels, especially the PKD2 group, would be good candidates for the transduction channel [20,21].
The timing of gene expression provides additional clues. In mice, vestibular hair cells become mechanosensitive beginning on embryonic day 17 (E17) Cochlear hair cells show mechanosensitivity beginning between postnatal day 0 (P0) and P2, in the base and apex respectively [22,23]. We expect mRNA for the transduction channel gene to appear at or slightly before these times. Cuajungco et al. [20] analyzed expression of all 33 TRP channels in a mammalian organ of Corti library, and found 19 TRPs expressed at a single age. Asai et al. [24] went on to analyze expression of mRNAs for all TRP channels in cochlea using RT–PCR from whole inner ear tissue, at E17, E18, P0, P2, P4, P6 and P8 [24]. However, they were unable to distinguish expression in hair cells from that in supporting cells and other surrounding cells, somewhat limiting the usefulness of the analysis.
Here, we explore TRP channels as candidates for the hair cell transduction channel. We take advantage of new data on specific gene expression in hair cells at different developmental time points to narrow the candidates, and further narrow candidates by single-channel conductance and phenotypes in published TRP knockouts. With scanning electron microscopy, FM1-43 loading and single cell physiology, we investigate transduction in mouse knockouts of Trpm2, Pkd2, Pkd2l1, Pkd2l2 and Pkd1l3, and in double and triple knockouts of these genes. We find no substantial deficit in mechanotransduction, ruling out these TRPs. Although many TRPS are expressed in hair cells and surely have important functions, we argue that none of the TRP channels are likely candidates for the transduction channel itself.
Results
To understand specific expression of TRP channels in hair cells, we queried an extensive database of gene expression in hair cells during development [25]. In that study, hair cell- and surrounding cell-specific RNA-seq libraries were prepared from FACS-sorted cochlear and vestibular tissues at E16, P0, P4 and P7. The expression of the TRP channel family for different cell types and ages is shown in Fig 1. The single-channel conductance, drawn from the literature [26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61,62,63,64,65,66,67,68] is also indicated. For reference, S1 Fig shows the TRP family in mouse arranged phylogenetically.
Fig 1. TRP channel expression in cochlear and vestibular hair cells.
(a) Schematic of the sorted cells, redrawn from Scheffer et al., 2015 [25]. Hair cells (green) and surrounding cells (purple) were collected from the cochlea (dark colors) and utricle (light colors) at ages E16, P0, P4, and P7. (b) Normalized RNA-seq read counts in hair cells and surrounding cells (colors as in a). Data are shown for 31 of the 33 members of the TRP channel family in mouse. Mcoln2 and Trpc4 showed negligible counts in all samples. Data from www.shield.hms.harvard.edu [25].
In narrowing candidates, we felt that an attractive transduction channel candidate should show at least two-fold enrichment in hair cells compared to surrounding cells, and it should be expressed in hair cells by the time of transduction onset. It should preferably have a large single channel conductance (>80 pS) although it is possible that a heteromeric TRP channel might have higher conductance than either subunit expressed alone. It would be more attractive if expressed in both auditory and vestibular hair cells [25] and in both inner and outer hair cells in the cochlea [69]. Knockout mice have been generated for a number of TRP channels, and we excluded all TRPs that have been reported to have normal hair cell transduction or showed no phenotype that might be expected from auditory or vestibular deficits. In mice, loss of vestibular function often leads to circling, spinning or head-bobbing behavior. Such behavior is often the first indication of an inner-ear phenotype in random or targeted mutagenesis and is usually noted in phenotypic descriptions. Auditory function is usually tested only if there is a reason to suspect dysfunction, for instance if vestibular problems are noted. Trpa1, Trpc1, Trpc3, Trpc5, Trpc6, Trpv4, Trpml3 and Trpm1 can be excluded on this basis [70,71,72,73,74]. Similarly, channels with a reported conductance <80 pS were excluded unless other strong indications were present.
Trpm2 is not required for hair cell transduction
Based on these criteria, we first focused on Trpm2. Its mRNA shows 90-fold enrichment in hair cells compared to surrounding cells, and it is first expressed at E17 in vestibular system and P0 in cochlea, matching the onset of mechanosensitivity. Expression further increases during development in both tissues. Although the published conductance of 50–60 pS is somewhat below our criterion, the expression pattern warranted further investigation.
We therefore generated a conditional Trpm2 knock-out mouse in which exon 21—encoding the fifth transmembrane and pore domains of Trpm2—is flanked by LoxP sites (Trpm2fl/fl; see Methods and S2 Fig). Trpm2fl/fl mice were viable and could be bred as homozygotes. For hair-cell-specific Cre-mediated recombination, we crossed Trpm2fl/fl mice with mice expressing Cre-recombinase under control of the Gfi1 promoter [75]. PCR from genomic DNA purified from inner ears of Trpm2fl/fl:Gfi1-Cre+/- mice confirmed the deletion.
Trpm2fl/fl:Gfi1-Cre+ homozygous knockout mice looked similar to their Trpm2fl/+:Gfi1-Cre+/- heterozygous control littermates, suggesting no gross developmental defects. Gfi1 is expressed in vestibular hair cells, so Cre recombination should delete Trpm2 in these cells, however Trpm2-deficient mice showed no obvious vestibular deficit.
To test mechanotransduction in Trpm2-deficient cochlear hair cells, we applied FM1-43 dye [76] to cultured organ of Corti explants. Both control and Trpm2-deleted hair cells accumulated FM1-43, showing similar levels of fluorescence intensity, suggesting that mechanotransduction persisted in the absence of Trpm2 (Fig 2A). To further test transduction, we recorded hair cell transduction currents in response to a family of bundle deflections. Both wild-type and Trpm2fl/fl:Gfi1-Cre+ outer hair cells showed high amplitude, rapidly adapting transduction currents (Fig 2B), with peak currents in response to the largest deflections that were not significantly different (Fig 2C).
Fig 2. Trpm2 is not required for hair cell mechanotransduction.
(a) FM1-43 accumulation by IHCs and OHCs from control Trpm2fll+:Gfi1-Cre+ mice (top) and deleted Trpm2fl/fl:Gfi1-Cre+ mice (bottom). FM1-43 accumulation by hair cells was similar in control and Trpm2-deleted hair cells. Age: P5+2div. Scale bar = 20 μm. (b) A family of OHC transduction current recordings (top traces) in response to stereocilia bundle deflections (bottom traces) in WT (left) and Trpm2fl/fl:Gfi1-Cre+ (right) mice. (c) Average peak transduction current (red traces in b) for control mice (WT and Trpm2fl/+:Gfi1-Cre+) and Trpm2fl/fl:Gfi1-Cre+ mice. d, ABR thresholds in response to pure tone stimuli. Trpm2fl/fl:Gfi1-Cre+ mice show normal hearing. Data are mean ± sem; n as indicated.
The auditory brainstem response (ABR), a sound-evoked voltage change measured near the brainstem, tests both transduction and synaptic function of the peripheral auditory system. ABR responses to pure tone stimuli were largely normal in Trpm2-deleted animals (Fig 2D). There was a slight elevation of hearing threshold at high frequencies in Trpm2-deficient mice, but overall auditory function was preserved. Based on these results we conclude that Trpm2 is not required for hair cell transduction.
Pkd2, Pkd2l1, Pkd2l2, and Pkd1l3 are not individually required for hair cell transduction
Pkd2l1 also showed an intriguing expression pattern (Fig 1), with 6.3-fold enrichment in hair cells compared to surrounding cells in both cochlea and utricle. The reported conductance of Pkd2l1 channels, 120–200 pS [28,67], matched that expected for the transduction channel. Indeed, the PKD2 group of TRP channels has previously been suggested to include attractive candidates for the transduction channel [21].
We obtained a Pkd2l1 knockout mouse lacking exons 3 and 4, which produced a premature stop in exon 5 [77]. Using in situ hybridization in cochlear sections, an antisense probe showed label in the hair-cell region (Fig 3A). No expression of Pkd2l1 mRNA was detected in Pkd2l1-/- mice, confirming the knockout, or with sense probe, confirming the probe specificity. However ABR measurements in Pkd2l1-/- mice showed normal hearing thresholds (Fig 3C), indicating that mechanotransduction persists in the absence of Pkd2l1. In scanning electron microscopy (SEM) images of Pkd2l1-/- mice at age P35, hair bundles appeared normal compared to wild-type controls (Fig 4A, 4C, 4E and 4G).
Fig 3. Neither Pkd2 nor Pkd2l1 is required for hair cell mechanotransduction.
(a) In situ hybridization in cochlear sections. (Left) no label is evident with a control sense probe. (Middle) no specific label is evident in the Pkd2l1 knockout. (Right) In situ hybridization with an antisense probe shows label of inner hair cells (arrowhead), outer hair cells (arrows) and inner sulcus cells (asterisks) in the organ of Corti. Scale bar = 50 μm; age P2. (b) ABR thresholds in response to pure tone stimuli. Pkd2l1-/- mice show normal hearing at age P31-P37. (c) Pkd2-/-:Atoh1-Cre+/-mice show normal hearing at age 4~6 weeks. Data are mean ± sem; n as indicated.
Fig 4. Mice lacking single or multiple PKD genes show normal stereocilia bundle morphology and hearing function.
(a-d) SEM images of postnatal 4~6 weeks organ of Corti hair cells at low magnification in WT and PKD-deficient mice. Scale bar = 10 μm. (e-l) OHC bundles at high magnification. Scale bar = 1 μm. (m) ABR thresholds in response to pure tone stimuli in Pkd2 and Pkd2l1 single and double knockouts. (n) Pkd2l1 and Pkd1l3 single and double knockouts. (o) Pkd2l2 knockouts. No functional deficit was observed in any combination tested. Data shown as mean ± sem.
The PKD2 group of TRP channels is not very divergent (S1 Fig), and PKD2 channels interact with each other forming heteromultimeric channels, further indicating their similarity [78,79,80,81]. These both raise the possibility that expression of Pkd2 or Pkd2l2 might compensate for the loss of Pkd2l1.
We therefore generated a conditional Pkd2 knock-out mouse line, by flanking exon 9 (aa630-671, comprising the pore and most of the sixth transmembrane domain) with loxP sites Pkd2fl/fl; see Methods and S3 Fig). Hair-cell-specific Cre recombination was achieved by crossing Pkd2fl/fl mice with a mouse line expressing Cre recombinase under control of the Atoh1 enhancer, restricting the Cre expression to hair cells [82]. Hair cell-specific absence of Pkd2 expression in Atoh1-Cre mice was confirmed using inner ear genomic PCR (S3 Fig).
We first assessed the consequence of Pkd2 deletion alone. Pkd2fl/fl:Atoh1-Cre+ knockout mice looked similar to their heterozygous control Pkd2fl/+:Atoh1-Cre+ littermates, suggesting no gross developmental defects. Hair bundles in Pkd2 knockouts also appeared normal (Fig 4B–4F). ABR measurements showed normal hearing thresholds (Fig 3D), indicating that hair-cell mechanotransduction does not require Pkd2.
As an independent confirmation, we used a second Pkd2fl/fl mouse line [83] missing exons 11–13, and deleted Pkd2 in hair cells by crossing to Atoh1-Cre+. In heterozygous controls, an antibody to Pkd2 labeled the kinocilia of hair cells and the primary cilia of adjacent supporting cells (S4 Fig). In homozygous knockouts, antibody label was missing from kinocilia but not adjacent primary cilia, confirming both the antibody specificity and the cell-specific deletion. These Pkd2 knockouts have normal hearing as well (S4 Fig).
We then obtained Pkd2l2 knockout mice in which exons 3 and 4 were replaced with a LacZ+Neo cassette, terminated by a stop (Jackson Laboratory B6.129P2- Pkd2l2tm1Dgen/J, Stock #: 005829). Because Pkd2l1 was thought to function together with Pkd1l3 in acid taste transduction [84,85,86], we also obtained a Pkd1l3 knockout line in which deletion of exons 17 through 21 produces a frame shift [87].
In double knockouts, we assessed stereocilia bundle morphology with SEM, and hearing sensitivity with ABR. Double knockout mice with hair cells missing both Pkd2 and Pkd2l1 showed normal bundles (Fig 4D–4J) and had normal hearing thresholds (Fig 4M). Similarly, single Pkd1l3 knockouts and double knockouts missing both Pkd2l1 and Pkd1l3 showed normal bundles (Fig 4H and 4I) and normal hearing thresholds (Fig 4N). Single Pkd2l2 knockouts are also normal (Fig 4K–4O).
Triple Pkd2, Pkd2l1 and Pkd2l2 knockout mice show normal transduction
Pkd2fl/fl:Atoh1-Cre+, Pkd2l1-/- and Pkd2l2-/- mouse lines were then crossed to each other to generate triple knockout mice. Triple knockouts were viable and could be bred as homozygotes. SEM imaging of stereocilia bundles revealed normal bundle morphology in adult mice (Fig 4L). To test transduction in cochlear hair cells missing Pkd2, Pkd2l1 and Pkd2l2, we first used the FM1-43 dye accumulation assay in acutely dissected P6 organ of Corti epithelia. Triple knockout mice showed similar levels of fluorescence dye intensity accumulation in hair cells as compared to double knockout control mice, suggesting preserved transduction (Fig 5A). To further test transduction, we recorded transduction currents in response to a family of bundle deflections in triple knockout organ of Corti explants and in age-matched control wild-type mice of the same background. Both wild-type and Pkd2fl/fl:Atoh1-Cre+:Pkd2l1-/-:Pkd2l2-/- OHCs showed high amplitude, rapidly adapting transduction currents (Fig 5B). The peak transduction current in response to the largest deflection was similar between the tested groups (Fig 5C). Vestibular hair cells of Pkd2fl/fl:Atoh1-Cre+:Pkd2l1-/-:Pkd2l2-/- triple knockouts also showed transduction currents (data not shown). ABR responses to pure tone stimuli showed similar threshold levels in Pkd2fl/fl:Atoh1-Cre+:Pkd2l1-/-:Pkd2l2-/- triple knockouts, as compared to their double knockout littermates with either Pkd2 or Pkd2l2 present (Fig 5D). Based on these results we conclude that the PKD2 subfamily of channels is not required for hair cell transduction.
Fig 5. Triple PKD knockout (Pkd2fl/fl:Atoh1-Cre+:Pkd2l1-/-:Pkd2l2-/-) mice show normal mechanotransduction and normal hearing in ABR measurements.
(a) FM1-43 accumulation is similar in IHCs and OHCs from P6 Pkd2fl/fl:Atoh1-Cre-:Pkd2l1-/-:Pkd2l2-/- controls lacking Cre (left) and Pkd2fl/fl:Atoh1-Cre+:Pkd2l1-/-:Pkd2l2-/- knockout mice (right), suggesting normal transduction. Scale bar = 20 μm. (b) A family of OHC transduction currents (top traces) in response to stereocilia bundle deflections (bottom traces) in WT (left) and Pkd2fl/fl:Atoh1-Cre+:Pkd2l1-/-:Pkd2l2-/- knockout (right) mice. (c) Average peak transduction currents (red traces in b) for WT mice (blue; n = 5) and triple knockout (red bar, n = 6). (d) ABR threshold measurements in response to pure tone stimuli in Pkd2fl/fl:Atoh1-Cre+:Pkd2l1-/-:Pkd2l2-/- knockout mice indicate normal hearing. Data are mean ± sem.
Discussion
The TRP channel family is broadly expressed in a different cell types and activated by a variety of stimuli, being especially prominent in reception of sensory stimuli. Like the hair-cell transduction channel, they are generally nonselective cation channels of high conductance. Some TRPs are thought to sense mechanical stimuli [88,89], although activation may be indirect [90]. This has led to the consideration of various TRPs as components of the hair cell mechanotransduction channel. Here we evaluate each of the six branches of the TRP family in mice.
TRPMLs
The varitint-waddler mutant (Va(J)) of Trpml3 (mucolipin 3; Mcoln3) has profound hearing loss [91] and impaired transduction in hair cells [64,92]. However, it was found that the Va(J) mutation leads to constitutive activation of the channel, causing a continuous inward current and consequent cell death. Hearing loss is explained by the loss of hair cells [20,61,63,64,92]. Hearing is normal in a null mutant of Trpml3 [93].
The TRPML branch is not very divergent (S1 Fig) so there is the possibility of compensation for loss of Trpml3 by a related gene. Trpml2 has negligible expression in the inner ear, but Trpml1 is expressed in both hair cells and surrounding cells (Fig 1). However the channel conductance for this branch is not consistent with the transduction channel conductance, and Trpml1 protein is mainly located in late endosomes and lysosomes [94].
PKDs
An analysis of candidates for the hair cell transduction channel pointed out that some members of the PKD (TRPP) branch of the TRP family have properties similar to those of the transduction channel [21]. PKD2 channels are highly permeable to calcium: Pkd2 has a PCa/PNa of 5 whereas Pkd2l1 has a PCa/PNa of ~4 [95]. The portfolio of blocking ions is similar to that of hair cells: Pkd2 is blocked by Ca2+, La3+ and Gd3+, and Pkd2l1 is blocked by Ca2+, Mg2+, La3+ and Gd3+. Both Pkd2 and Pkd2l1 are blocked by amiloride (IC50 = 40–130 μm). The conductance of Pkd2 is 40–170 pS [40,48], and Pkd2l1 conductance is ~120 pS for inward current [67,96]. Pkd2, Pkd2l1 and Pkd2l2 are all expressed in hair cells, with the Pkd2l1 profile being especially appropriate [25]. Moreover, some studies have suggested that the Pkd2 channel is mechanosensitive—specifically that it is located in primary cilia, where it is activated by cilia bending from environmental fluid flow [97,98,99].
Because constitutive deletion of the Pkd2 gene is embryonic lethal, we used an Atoh1-Cre line to delete Pkd2 conditionally in hair cells. Using a pure-tone ABR test, we found that hearing is normal in Pkd2 conditional knockout mice (Fig 3D). SEM imaging showed a normal hair bundle in the cochlea. Testing a second, independent Pkd2 conditional knockout line which truncates the C-terminal of Pkd2 channels, we found similarly normal function. Furthermore, antibody labeling showed that in hair cells Pkd2 is located in the kinocilia but not stereocilia. Finally, we recently re-analyzed mechanosensitivity in primary cilia in a variety of cell types and found that none shows rapid influx of Ca2+ upon cilium bending, casting doubt on the idea that Pkd2 is a mechanically gated channel [67,96,100].
We also investigated if Pkd2l1 is involved in hair cell transduction, using a Pkd2l1 knockout mouse that we recently described [77]. RT-PCR from whole mouse cochlea showed that expression of Pkd2l1 is correlated with the acquisition of mechanotransduction [24], and RNA-seq showed it is specifically expressed in hair cells at the start of mechanosensitivity (Fig 1). A sensitive mass spectroscopy study found that Pkd2l1 protein is enriched in hair bundles of the chicken auditory epithelium [101]. In situ hybridization in mouse showed that Pkd2l1 is highly expressed in hair cells and also some inner sulcus cells (Fig 3A). However the Pkd2l1 knockout mouse did not show abnormalities in hearing, using the ABR test (Fig 3C), or abnormal hair bundle morphology (Fig 4).
Pkd1l3 had been thought to form a heteromeric complex with Pkd2l1 for sour taste sensation [85,102,103], suggesting that it might share function with Pkd2l1 in hair cells. Pkd1l3 was also found to be expressed in the auditory system [24], although expression in hair cells is limited (Fig 1). However we found that a single knockout of Pkd1l3 and a double knockout with Pkd2l1 showed no abnormalities in the ABR or hair bundle morphology (Fig 4).
Pkd2l2 is also expressed in hair cells, although not preferentially (Fig 1). We found that a single Pkd2l2 knockout has a normal hearing sensitivity and hair bundle morphology. Because of the possibility of compensation among this closely-related group, we created double and triple knockouts of Pkd2, Pkd2l1 and Pdk2l2. Even triple knockouts showed no deficit in hearing sensitivity, bundle morphology, or mechanotransduction assessed with FM1-43 accumulation and single-cell recording. We can thus rule out the PKD2 branch of the TRP family.
In addition to Pkd1l3, some of the Pkd1 group of TRPs are sparsely expressed in hair cells. However none of the Pkd1 group have robust and hair-cell-specific expression profiles (Fig 1). Pkd1 mutants have normal transduction current and only moderate loss of hearing sensitivity [104]. Moreover, PKD1s are thought to form ion channels as heteromultimers with PKD2 channels [105], and the PKD2s have been ruled out.
The entire PKD group of TRP channels is thus unlikely to participate in hair-cell transduction.
TRPA
Trpa1 was also considered as a strong transduction channel candidate because knockdown of expression in both mice (with virally delivered siRNA) and zebrafish (morpholino injection) reduced the transduction current, and because it has a large single-channel conductance of 250 pS in low Ca2+ [106], (data not shown). However, mice lacking Trpa1 have normal transduction current and hearing [70]. Trpa1 is the only member of the Trpa branch in mice, so compensation by a related gene is unlikely.
TRPCs
Although Trpc1 is expressed in mouse hair cells (Fig 1), the other members of this branch do not have an appropriate expression pattern and Trpc4 is not expressed at all. In addition, a quadruple knockout of Trpc1, Trpc3, Trpc5 and Trpc6 shows normal hearing sensitivity and hair cell morphology [71,72]. We previously showed that the remaining TRPC gene, Trpc2, is highly expressed in mouse vomeronasal neurons and the protein is located in the sensory cilia where it is thought to participate in pheromone transduction [107]. Trpc2 knockout mice do lack pheromone sensitivity but have no vestibular deficit [108]. Also, TRPC2 is a nonfunctional pseudogene in a species (human) that has normal hearing [109]. Finally, the single channel conductance of the TRPC channels is lower than that of the hair cell transduction channel.
TRPMs
In situ hybridization and RNA-seq showed Trpm2 to be selectively expressed by inner ear hair cells, suggesting that it plays an important role in these cells [25]. We found, however, that Trpm2 knockout mice exhibited normal transduction current and FM-143 accumulation. Trpm1 knockouts also have normal hearing [73]. It might be that other TRPMs compensate in these knockouts, but—with the exception of Trpm7—none of the others has an appropriate expression pattern or single-channel conductance. Trpm7 is expressed but not enriched in hair cells, its single channel conductance is high but not as high as the transduction channel, and zebrafish studies suggest it is not required for hair cell transduction in zebrafish [110]. Thus none of the TRPMs seems likely to be a transduction channel.
TRPVs
Trpv4 was first suggested as a possible component of a heteromeric transduction channel because it was mechanosensitive—responding to changes in osmolarity—and was expressed in auditory hair cells [111]. Newer methods have shown the Trpv4 gene to be expressed only at very low levels in cochlear hair cells and not at all in utricular hair cells [25]. Although Trpv4 knockout mice show mild, late onset hearing loss, there is no deficit in hearing at earlier ages, excluding it as a transduction channel candidate [72].
Of other TRPVs, only Trpv3 has a large conductance; however its expression pattern is not consistent with the hair cell transduction channel (Fig 1). None of the other TRPV channels shows an appropriate expression pattern in hair cells.
Conclusion
Although the TRP family of ion channels initially seemed like a rich source of candidates for the hair-cell transduction channel, most of them can be ruled out by inappropriate expression pattern, inappropriate conductance, or lack of an auditory or vestibular phenotype in knockout mice. Here, we have tested the remaining reasonable candidates—including some that were quite attractive based on expression and conductance—but found no deficit in transduction in hair cells of these animals. Although many TRPs are expressed in hair cells and many are sure to carry out important functions in these cells, it now seems safe to exclude the entire TRP family in the search for a transduction channel.
Materials and Methods
TRP channel expression data
Expression data for all 33 mouse TRP channels were drawn from Scheffer et al., 2015, as posted on the SHIELD database (shield.hms.harvard.edu). Read counts were analyzed based on the 20207 RefSeq genes in the DNAnexus set. Pkd1l1 is not in that set, so reads for Pkd1l1 were identified by specifically querying the raw data set.
Mouse lines
This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Institutional Animal Care and Use Committee at Harvard Medical School (Protocol Number: 03524). ABR measurements were performed under anesthesia (ketamine (100 mg/kg)/xylazine (10 mg/kg) cocktail). Newborn mice (P0-P4) were anesthetized by cooling, then euthanized by decapitation. Adult mice were euthanized by isoflurane overdose, followed by cervical dislocation. All efforts were made to minimize suffering. All primers used in current study are summarized in Table 1.
Table 1. Primers used for genotyping and validation of gene deletion.
| Mouse lines | Primer Name | PCR primer concentration | Sequence | Floxed allele | WT allele | KO allele | Purpose |
|---|---|---|---|---|---|---|---|
| Trpm2cKO (David Corey) | LOX | 1.2 μM | TGAGGCGGAAGGAATTAGCAC | 320 | 259 | Genotyping | |
| SDL | 1.2 μM | CCCACCTGACAGTCACAAGTGTG | 320 | 259 | Genotyping | ||
| TM2cKO15101f | 1.2 μM | GACTTCATCATGTTCTGTCT | 4184 (N/A*) | 2415 (N/A*) | 616 | Verification cKO in the inner ear | |
| Pkd2cKO (Jing Zhou) | mPKD2in9F3 | 0.6 μM | TTGTGCATTTGGTGATGTGTTA | 520 | 468 | Genotyping | |
| mPKD2in9R3 | 0.6 μM | CCACATTTACATGGCATCTGAG | 520 | 468 | Genotyping | ||
| PKD2-5940f1 | 1.2 μM | AAGCTGTGTTATCATTCTAGAAAGC | >2457 | 2457 | 344 | Verification cKO in the inner ear | |
| Pkd2cKO (Terry Watnick) | MG/3 flox c-f | 1.2 μM | GGGGTTTCCTATGAAGAGTTCCAAG | 485 | 396 | Genotyping | |
| MG/3 flox d-r | 1.2 μM | CTGACAGGCACCTACAGAACAGTG | 485 | 396 | Genotyping | ||
| Pkd2l1 | Neo82 | 0.6 μM | CTGCCTTGGGAAAAGCGCCT | ~520 | ~480 | Genotyping | |
| MPclF904 | 0.6 μM | AAGATCAGCTCCCCTTTGGACCT | ~520 | ~480 | Genotyping | ||
| R520 | 0.6 μM | TTCCACCCCAGGATTCTCTG | ~520 | ~480 | Genotyping | ||
| Gfi1-Cre | Gfi-1F | 1.2 μM | GGG ATA ACG GAC CAG TTG | 609 | 672 | Genotyping | |
| Gfi1Cre-R | 1.2 μM | GCC CAA ATG TTG CTG GAT AGT | 609 | 672 | Genotyping | ||
| Gfi-1R | 0.6 μM | CCG AGG GGC GTT AGG ATA | 609 | 672 | Genotyping | ||
| Atoh1-Cre | Atoh1Cre-F | 1.2 μM | ATCGGCCTCCTCCTCGTAGACAGC | 550 | Genotyping | ||
| Atoh1Cre-R | 1.2 μM | GGATCCGCCGCATAACCAGTGA | 550 | Genotyping | |||
| Pkd2l2 | IMR4245 | 0.3 μM | CATCATCAGGTAGAGAAGTGTCCAC | ~200 | ~450 | Genotyping | |
| IMR4246 | 1.2 μM | CGTGCGTGCAAACACCCACACACAG | ~200 | ~450 | Genotyping | ||
| IMR5100 | 1.2 μM | TTCAACAGACCTTGCATTCCTTTGG | ~200 | ~450 | Genotyping | ||
| Pkd1l3 | 1111nF-5’ | 0.3 μM | AGGAGAGGATTGACTTCTATGAG | ~250 | 650 | Genotyping | |
| 1112nR-5’ | 0.3 μM | CAGGAGAGCCTCTGGACTCGTGT | ~250 | 650 | Genotyping | ||
| 1328F-5’ | 1.2 μM | GATGGAAGCCGGTCTTGTCGAT | ~250 | 650 | Genotyping | ||
| 1538R-5’ | 1.2 μM | TCGAGCCCCAGCTGGTTCTTTCC | ~250 | 650 | Genotyping |
* Not amplified
Trpm2 conditional knockout mouse line
We worked with Ingenious Targeting Laboratory (Ronkonkoma, New York, USA) to make the Trpm2 conditional knockout. A 10.2-kb Trpm2 genomic fragment was subcloned from a C57BL/6 BAC clone to construct the targeting vector using homologous recombination. A FRT-LoxP-Neo-FRT-LoxP cassette was inserted upstream of exon 21 and the third single LoxP site was inserted downstream of exon 21 (S2 Fig). The region flanked by the second and the third LoxP sites is about 2.0 kb. Exon 21 encodes amino acids 929–985 and corresponds to the fifth transmembrane domain and pore of Trpm2; its deletion also causes an early stop. A homology short arm extends 1.8 kb to the 3’ of the FRT-LoxP-Neo-FRT-LoxP cassette whereas a homology long arm extends 6.4 kb from the 5’ side of the third LoxP site. The linearized targeting vector was then electroporated into iTL BA1(C57BL/6X129/SvEv) hybrid embryonic stem cells.
Pkd2l1 constitutive knockout
We have previously described the Pkd2l1 knockout [77]. It lacks exons 3 and 4, leading to a premature stop codon in exon 5.
Pkd2 conditional knockout
A 7.3kb genomic fragment of the Pkd2 gene was used to construct the targeting vector. Three LoxP sites were inserted as shown in S3 Fig. The first LoxP site was inserted upstream of exon 9 and a LoxP-Neo-LoxP cassette was inserted downstream of exon 9. The first and second LoxP sites thus flank a 2.2kb genomic region that includes exon 9. Exon 9 encodes amino acids 630–671, comprising the pore and most of the sixth transmembrane domain of Pkd2. The homology short arm extended 0.9 kb to the first loxP site and a homology long arm extended 4.2 kb downstream of the LoxP-Neo-LoxP cassette.
Pkd2l2 constitutive knockout
Mice were obtained from The Jackson Laboratory (B6.129P2-Pkd2l2tm1Dgen/J, #005829). In this mutant mouse line, a lacZ-Neo cassette was inserted into the Pkd2l2 gene to replace a 1.8-kb genomic fragment including exons 3 and 4. As a result, the endogenous Pkd2l2 gene promoter drives expression of the beta-galactosidase gene but not the endogenous Pkd2l2 gene (S5 Fig).
Pkd1l3 constitutive knockout
Mice were obtained from The Jackson Laboratory (B6;129S4-Pkd1l3tm1Sul/J, Stock #: 008419). They lack exons 17 through 21, which encode transmembrane domains 2–5 [87].
Cre lines
The Gfi1-Cre mouse line was generously provided by Dr. Lin Gan (University of Rochester)[75]. The Atoh1-Cre mouse was obtained from The Jackson Laboratory (B6.Cg-Tg(Atoh1-cre)1Bfri/J, #011104) [82].
Immunofluorescence
Mouse cochleas and/or utricles were dissected from P2~P8 mutant mice and their wild-type littermates. Samples were fixed with 4% formaldehyde for 2 hr, rinsed with PBS, incubated in 0.1 M citrate buffer (pH 7.0) at 60°C for 30 min for antigen retrieval. Whole mount samples were permeabilized with 0.5% Triton X-100 for 30 min, and blocked with 10% goat serum supplemented with 0.5% Triton X-100 for 30 min. Samples were then incubated with primary antibody overnight at 4°C, rinsed with PBS, and further incubated in secondary antibodies together with phalloidin for 6 hr. Samples were then mounted with Prolong Gold antifade kit (Invitrogen), cured in the dark at room temperature overnight and imaged with an upright Olympus FluoView FV1000 confocal laser scanning microscope (60X 1.42NA objective).
ABR measurements
The ABR assay was performed using a Tucker Davis Technologies (TDT, Gainsville, FL) workstation (System III). Mice age P28 to P60 were anesthetized by intraperitoneal injection of a ketamine (100 mg/kg)/xylazine (10 mg/kg) cocktail. Anesthetized mice were then placed on a heating pad and electrodes were placed subcutaneously in the vertex, underneath the left ear, and on the back near the tail. Tone stimuli of 4, 5.6, 8, 11.2, 16, 22, 32 and 45.3 kHz were calibrated with a precision microphone system (PS9200Kit, ACO Pacific, USA) using the TDT SigCal software package. The recorded signals were band-pass filtered (300 Hz to 3 kHz) and amplified 100,000 times. The number of acquisition trials was set to 500 averages. Maximum stimulus intensity was set to 95 dB peak SPL with attenuation decreasing from 85 dB to 0 dB SPL at 5 dB SPL intervals. All ABR thresholds were read by second investigator who was blind to the mouse genotype.
Field emission scanning electron microscopy
Cochleas from either P2 or adult (P28-P40) mice were dissected out and immediately immersed in 0.5% glutaraldehyde / 0.1 M sodium cacodylate buffer / 3 mM CaCl2 (pH 7.3) for 2 hr. Adult cochleas were further decalcified in 120 mM EDTA (pH 7.2) for 24 hr. Cochlea coils were dissected out in distilled water. Samples were processed through an OTOTO procedure [112] with modifications. Briefly, samples were washed in the cacodylate dilution buffer three times for 5 min each, fixed in 1% OsO4 in cacodylate buffer for 1 hr, and washed in H2O for 5 min three times. The samples then went through 1% freshly prepared tannic acid for 1 hr, then 1% OsO4 for 1 hr, 1% tannic acid for 1 hr, and 1% OsO4 for 1 hr, with an H2O wash between steps. Next, samples were washed and processed through the crescent isopropanol series steps (30% isopropanol at room temperature, 50% isopropanol on ice, 70% isopropanol at -20°C, 90% isopropanol slurry on dry ice, 95% isopropanol slurry on dry ice, 100% isopropanol slurry on dry ice), with each step exposition set to 15 min. Sample were then critical point dried, sputter coated with platinum and imaged on a Hitachi S-4800 field emission scanning electron microscope.
Whole-cell patch clamp recording
Organ of Corti epithelia were dissected at P3-P5 in L-15 medium (Life Technologies), placed in glass bottom Petri dishes (WPI Inc.) and cultured for 2–3 days in DMEM/F12 medium (Life Technologies) supplemented with 5% FBS and 10 mg/l ampicillin at 37°C (10% CO2) as previously described [113]. Experiments were performed at room temperature in L-15 containing the following inorganic salts (in mM): NaCl (137), KCl (5.4), CaCl2 (1.26), MgCl2 (1.0), Na2HPO4 (1.0), KH2PO4 (0.44), MgSO4 (0.81). Hair cells were observed with an inverted microscope (TE 2000, Nikon) using a 100X 1.3 NA oil-immersion objective lens and DIC optics. Pipettes for whole-cell patch-clamp recordings were filled with intracellular solution containing (in mM): CsCl (140), MgCl2 (2.5), Na2ATP (2.5), EGTA (1.0), HEPES (5.0). The pipette resistance was typically 4–6 MΩ when measured in the bath. Patch clamp recordings were performed with an AxoPatch 200B amplifier (Molecular Devices) controlled by pClamp 9 software package. Hair cells were held at –60 mV between the short periods of transduction recordings, when the holding potential was temporarily hyperpolarized to –90 mV. All recorded hair cells were located 35–45% away from the apex of the organ of Corti explant.
Hair bundles were deflected using a stiff glass probe, fire-polished to fit the shape of the stereocilia bundle (~5–7 μm). The probe was mounted on a piezo actuator (PA 8/14 SG, Piezosystem Jena), equipped with a strain gauge sensor to provide a direct reading of the probe’s axial displacement. The piezo was driven by a custom-made amplifier, providing a rapid step deflection within ~40 μs (10–90% risetime). The angle between the axis of the probe movement and the bottom surface of a dish was kept constant at ~30 degrees.
FM1-43 loading
Organ of Corti epithelia were acutely dissected from P4-P5 mice in L-15 cell culture medium, and either mounted on coverslips using tungsten minutien pins (WPI Inc.) for the experiment, or cultured for an additional 2 days as described above. Following tectorial membrane removal and medium aspiration, FM1-43 solution (2 μM in L-15) was applied to the tissue for 30–60 s, then quickly aspirated; the tissue was rinsed once with L-15 and the excessive dye quenched by a 0.2 mM solution of 4-sulphonato calix[8]arene, sodium salt (SCAS, Biotium) in L-15. The organ of Corti was then observed on an upright Olympus FV1000 confocal microscope, equipped with 60X 1.1 NA water-dipping objective lens.
Supporting Information
There are 33 genes in six major groups (TRPM, TRPC, TRPV, PKD/TRPP, TRPML and TRPA). Length of line indicates divergence.
(TIF)
(a) Trpm2 conditional knockout strategy. We inserted two LoxP sites to flank a ~1.9 kb region that includes exon 21. A LoxP-FRT-Neo-LoxP-FRT cassette was inserted upstream of exon 21 and the third LoxP site was inserted downstream of exon 21. Exon 21 encodes aa929-985 including the essential fifth transmembrane domain and pore. The deletion also led to a downstream frameshift. Red arrowheads refer to LoxP sites, yellow brackets refer to FRT sites, and green arrows refer to the neomycin resistance gene. Primers used for genotyping and validation are indicated as gray arrows. (b) PCR from genomic DNA purified from inner ears of Trpm2fl/fl: Gfi1-Cre+ mice, Trpm2fl/fl:Gfi1-Cre- mice, and an age-matched wildtype mouse. (Left) PCR results using primer pair TM2cKO15101f and SDL. Lane 1 (Trpm2fl/fl:Gfi1-Cre+) shows a fused short band (616bp) only from the deleted allele; lane 2 lacking Cre (Trpm2fl/fl:Gfi1-Cre-) and Lane 3 (wildtype) do not show it. The fused band was confirmed by Sanger sequencing. (Middle) PCR bands at 320 bp (floxed allele) in lane 1 and lane 2, and 259 bp (Wt allele)in lane 3, using primers LOX and SDL, (Right) Genotyping for the Gfi1-Cre allele. A 1-kb DNA extension ladder was used (5 μl; Invitrogen #10511–012).
(TIF)
(a) Exon 9 of the Pkd2 gene was deleted by flanking the ~2.2 kb targeting region with two LoxP sites. A LoxP-Neo-LoxP cassette was inserted downstream of exon 9 and the third LoxP site was inserted upstream. Exon 9 encodes aa630-671 including the pore domain and most of the sixth transmembrane domain of the Pkd2 channel. Primers used for genotyping and validation are indicated as a gray arrows. (b) PCR from genomic DNA purified from inner ears of Pkd2fl/fl:Atoh1-Cre+ mice, Pkd2 fl/fl:Atoh1-Cre-/- mice, and an age-matched wildtype mouse. (Left) PCR results using primer pair PKD2-5940f1 and mPKD2in9R3. Lane 1 (Pkd2fl/fl:Atoh1-Cre+) shows a fused short band (344 bp) from the deleted allele and a longer band (>2437 bp) from the genomic DNA cells without Cre activity. The short fused band was confirmed by Sanger sequencing. Lane 2 (Pkd2 fl/fl:Atoh1-Cre-) shows the same long band as in lane 1 but no short band. Lane 3 shows a band of 2457 bp produced from a wildtype mouse inner ear. (Middle) PCR produced bands at 520bp in lane 1 and lane 2, and 468 bp in lane 3 using mPKD2in9F3 and mPKD2inR3. (Right) Genotyping of the Atoh1-Cre allele. A 1-kb DNA extension ladder was used (5 μl; Invitrogen #10511–012).
(TIF)
(a,a’) Antibody labeling (Santa Cruz Biotechnology, #sc-10376) for Pkd2 (red) and phalloidin staining for actin (green) in the heterozygote (Pkd2fl/+: Atoh1-Cre+) positive-control cochlea. Pkd2 label is evident in hair-cell kinocilia (arrowheads) and some supporting cell primary cilia (arrows). (b,b’) Pkd2fl/fl: Atoh1-Cre+ knockout cochlea. Pkd2 label is absent from hair cell kinocilia but not from supporting cell cilia. (c-c’) In vestibular hair cells of heterozygote mice, Pkd2 label is also in kinocilia. (d) ABR thresholds in response to pure tone stimuli. Pkd2fl/fl: Atoh1-Cre+ knockout mice show normal hearing. Data are mean ± SEM.
(TIF)
The generation of the Pkd2l2 knockout mouse, based on information from The Jackson Laboratory (Pkd2l2tm1Dgen/J; stock #005829; https://www.jax.org/strain/005829). A bacterial lacZ gene fused with a neomycin resistance gene replaced ~ 1.8 kb genomic sequence extending from the 3’ part of exon 3 to the 5’ part of exon 4. Thus the endogenous promoter drove the expression of beta-galactosidase.
(TIF)
Acknowledgments
We thank William Fowle (Northeastern University), and Jun Shen, Hongyu Zhao, Bruce Derfler and Yaqiao Li (Harvard Medical School) for advice and assistance.
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
This work used reagents provided by the Baltimore Polycystic Kidney Disease Research and Clinical Core Center (P30DK090868). Supported by NIH grant DC000304 to DPC, and R01DK51050, R01DK53357 and R01DK09953201 to JZ. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1.Hudspeth AJ, Corey DP (1977) Sensitivity, polarity, and conductance change in the response of vertebrate hair cells to controlled mechanical stimuli. Proc Natl Acad Sci U S A 74: 2407–2411. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Corey DP, Hudspeth AJ (1979) Response latency of vertebrate hair cells. Biophys J 26: 499–506. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Corey DP, Hudspeth AJ (1979) Ionic basis of the receptor potential in a vertebrate hair cell. Nature 281: 675–677. [DOI] [PubMed] [Google Scholar]
- 4.Ohmori H (1985) Mechano-electrical transduction currents in isolated vestibular hair cells of the chick. J Physiol 359: 189–217. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Lumpkin EA, Marquis RE, Hudspeth AJ (1997) The selectivity of the hair cell's mechanoelectrical-transduction channel promotes Ca2+ flux at low Ca2+ concentrations. Proc Natl Acad Sci U S A 94: 10997–11002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Crawford AC, Evans MG, Fettiplace R (1991) The actions of calcium on the mechano-electrical transducer current of turtle hair cells. J Physiol 434: 369–398. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Kimitsuki T, Nakagawa T, Hisashi K, Komune S, Komiyama S (1996) Gadolinium blocks mechano-electric transducer current in chick cochlear hair cells. Hear Res 101: 75–80. [DOI] [PubMed] [Google Scholar]
- 8.Farris HE, LeBlanc CL, Goswami J, Ricci AJ (2004) Probing the pore of the auditory hair cell mechanotransducer channel in turtle. J Physiol 558: 769–792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Geleoc GS, Lennan GW, Richardson GP, Kros CJ (1997) A quantitative comparison of mechanoelectrical transduction in vestibular and auditory hair cells of neonatal mice. Proc Biol Sci 264: 611–621. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Ricci AJ, Crawford AC, Fettiplace R (2003) Tonotopic variation in the conductance of the hair cell mechanotransducer channel. Neuron 40: 983–990. [DOI] [PubMed] [Google Scholar]
- 11.Beurg M, Evans MG, Hackney CM, Fettiplace R (2006) A large-conductance calcium-selective mechanotransducer channel in mammalian cochlear hair cells. J Neurosci 26: 10992–11000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Pan B, Geleoc GS, Asai Y, Horwitz GC, Kurima K, Ishikawa K, et al. (2013) TMC1 and TMC2 are components of the mechanotransduction channel in hair cells of the mammalian inner ear. Neuron 79: 504–515. 10.1016/j.neuron.2013.06.019 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Rusch A, Kros CJ, Richardson GP (1994) Block by amiloride and its derivatives of mechano-electrical transduction in outer hair cells of mouse cochlear cultures. J Physiol 474: 75–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Gale JE, Marcotti W, Kennedy HJ, Kros CJ, Richardson GP (2001) FM1-43 dye behaves as a permeant blocker of the hair-cell mechanotransducer channel. J Neurosci 21: 7013–7025. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Kroese AB, Das A, Hudspeth AJ (1989) Blockage of the transduction channels of hair cells in the bullfrog's sacculus by aminoglycoside antibiotics. Hear Res 37: 203–217. [DOI] [PubMed] [Google Scholar]
- 16.Ricci A (2002) Differences in mechano-transducer channel kinetics underlie tonotopic distribution of fast adaptation in auditory hair cells. J Neurophysiol 87: 1738–1748. [DOI] [PubMed] [Google Scholar]
- 17.Marcotti W, van Netten SM, Kros CJ (2005) The aminoglycoside antibiotic dihydrostreptomycin rapidly enters mouse outer hair cells through the mechano-electrical transducer channels. J Physiol 567: 505–521. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Pan B, Waguespack J, Schnee ME, LeBlanc C, Ricci AJ (2012) Permeation properties of the hair cell mechanotransducer channel provide insight into its molecular structure. J Neurophysiol 107: 2408–2420. 10.1152/jn.01178.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Vollrath MA, Kwan KY, Corey DP (2007) The micromachinery of mechanotransduction in hair cells. Annu Rev Neurosci 30: 339–365. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Cuajungco MP, Grimm C, Heller S (2007) TRP channels as candidates for hearing and balance abnormalities in vertebrates. Biochim Biophys Acta 1772: 1022–1027. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Fettiplace R (2009) Defining features of the hair cell mechanoelectrical transducer channel. Pflugers Arch 458: 1115–1123. 10.1007/s00424-009-0683-x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Geleoc GS, Holt JR (2003) Developmental acquisition of sensory transduction in hair cells of the mouse inner ear. Nat Neurosci 6: 1019–1020. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Lelli A, Asai Y, Forge A, Holt JR, Geleoc GS (2009) Tonotopic gradient in the developmental acquisition of sensory transduction in outer hair cells of the mouse cochlea. J Neurophysiol 101: 2961–2973. 10.1152/jn.00136.2009 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Asai Y, Holt JR, Geleoc GS (2010) A quantitative analysis of the spatiotemporal pattern of transient receptor potential gene expression in the developing mouse cochlea. J Assoc Res Otolaryngol 11: 27–37. 10.1007/s10162-009-0193-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Scheffer DI, Shen J, Corey DP, Chen ZY (2015) Gene Expression by Mouse Inner Ear Hair Cells during Development. J Neurosci 35: 6366–6380. 10.1523/JNEUROSCI.5126-14.2015 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Caterina MJ, Schumacher MA, Tominaga M, Rosen TA, Levine JD, Julius D (1997) The capsaicin receptor: a heat-activated ion channel in the pain pathway. Nature 389: 816–824. [DOI] [PubMed] [Google Scholar]
- 27.Zitt C, Obukhov AG, Strubing C, Zobel A, Kalkbrenner F, Luckhoff A, et al. (1997) Expression of TRPC3 in Chinese hamster ovary cells results in calcium-activated cation currents not related to store depletion. J Cell Biol 138: 1333–1341. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Chen XZ, Vassilev PM, Basora N, Peng JB, Nomura H, Segal Y, et al. (1999) Polycystin-L is a calcium-regulated cation channel permeable to calcium ions. Nature 401: 383–386. [DOI] [PubMed] [Google Scholar]
- 29.Hofmann T, Obukhov AG, Schaefer M, Harteneck C, Gudermann T, Schultz G (1999) Direct activation of human TRPC6 and TRPC3 channels by diacylglycerol. Nature 397: 259–263. [DOI] [PubMed] [Google Scholar]
- 30.Nilius B, Vennekens R, Prenen J, Hoenderop JG, Bindels RJ, Droogmans G (2000) Whole-cell and single channel monovalent cation currents through the novel rabbit epithelial Ca2+ channel ECaC. J Physiol 527 Pt 2: 239–248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Strotmann R, Harteneck C, Nunnenmacher K, Schultz G, Plant TD (2000) OTRPC4, a nonselective cation channel that confers sensitivity to extracellular osmolarity. Nat Cell Biol 2: 695–702. [DOI] [PubMed] [Google Scholar]
- 32.Vennekens R, Hoenderop JG, Prenen J, Stuiver M, Willems PH, Droogmans G, et al. (2000) Permeation and gating properties of the novel epithelial Ca(2+) channel. J Biol Chem 275: 3963–3969. [DOI] [PubMed] [Google Scholar]
- 33.Nadler MJ, Hermosura MC, Inabe K, Perraud AL, Zhu Q, Stokes AJ, et al. (2001) LTRPC7 is a Mg.ATP-regulated divalent cation channel required for cell viability. Nature 411: 590–595. [DOI] [PubMed] [Google Scholar]
- 34.Perraud AL, Fleig A, Dunn CA, Bagley LA, Launay P, Schmitz C, et al. (2001) ADP-ribose gating of the calcium-permeable LTRPC2 channel revealed by Nudix motif homology. Nature 411: 595–599. [DOI] [PubMed] [Google Scholar]
- 35.Runnels LW, Yue L, Clapham DE (2001) TRP-PLIK, a bifunctional protein with kinase and ion channel activities. Science 291: 1043–1047. [DOI] [PubMed] [Google Scholar]
- 36.Sano Y, Inamura K, Miyake A, Mochizuki S, Yokoi H, Matsushime H, et al. (2001) Immunocyte Ca2+ influx system mediated by LTRPC2. Science 293: 1327–1330. [DOI] [PubMed] [Google Scholar]
- 37.Strubing C, Krapivinsky G, Krapivinsky L, Clapham DE (2001) TRPC1 and TRPC5 form a novel cation channel in mammalian brain. Neuron 29: 645–655. [DOI] [PubMed] [Google Scholar]
- 38.Voets T, Prenen J, Fleig A, Vennekens R, Watanabe H, Hoenderop JG, et al. (2001) CaT1 and the calcium release-activated calcium channel manifest distinct pore properties. J Biol Chem 276: 47767–47770. [DOI] [PubMed] [Google Scholar]
- 39.Yue L, Peng JB, Hediger MA, Clapham DE (2001) CaT1 manifests the pore properties of the calcium-release-activated calcium channel. Nature 410: 705–709. [DOI] [PubMed] [Google Scholar]
- 40.Gonzalez-Perrett S, Batelli M, Kim K, Essafi M, Timpanaro G, Moltabetti N, et al. (2002) Voltage dependence and pH regulation of human polycystin-2-mediated cation channel activity. J Biol Chem 277: 24959–24966. [DOI] [PubMed] [Google Scholar]
- 41.LaPlante JM, Falardeau J, Sun M, Kanazirska M, Brown EM, Slaugenhaupt SA, et al. (2002) Identification and characterization of the single channel function of human mucolipin-1 implicated in mucolipidosis type IV, a disorder affecting the lysosomal pathway. FEBS Lett 532: 183–187. [DOI] [PubMed] [Google Scholar]
- 42.Voets T, Prenen J, Vriens J, Watanabe H, Janssens A, Wissenbach U, et al. (2002) Molecular determinants of permeation through the cation channel TRPV4. J Biol Chem 277: 33704–33710. [DOI] [PubMed] [Google Scholar]
- 43.Watanabe H, Vriens J, Suh SH, Benham CD, Droogmans G, Nilius B (2002) Heat-evoked activation of TRPV4 channels in a HEK293 cell expression system and in native mouse aorta endothelial cells. J Biol Chem 277: 47044–47051. [DOI] [PubMed] [Google Scholar]
- 44.Xu H, Ramsey IS, Kotecha SA, Moran MM, Chong JA, Lawson D, et al. (2002) TRPV3 is a calcium-permeable temperature-sensitive cation channel. Nature 418: 181–186. [DOI] [PubMed] [Google Scholar]
- 45.Grimm C, Kraft R, Sauerbruch S, Schultz G, Harteneck C (2003) Molecular and functional characterization of the melastatin-related cation channel TRPM3. J Biol Chem 278: 21493–21501. [DOI] [PubMed] [Google Scholar]
- 46.Heiner I, Eisfeld J, Halaszovich CR, Wehage E, Jungling E, Zitt C, et al. (2003) Expression profile of the transient receptor potential (TRP) family in neutrophil granulocytes: evidence for currents through long TRP channel 2 induced by ADP-ribose and NAD. Biochem J 371: 1045–1053. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Hofmann T, Chubanov V, Gudermann T, Montell C (2003) TRPM5 is a voltage-modulated and Ca(2+)-activated monovalent selective cation channel. Curr Biol 13: 1153–1158. [DOI] [PubMed] [Google Scholar]
- 48.Luo Y, Vassilev PM, Li X, Kawanabe Y, Zhou J (2003) Native polycystin 2 functions as a plasma membrane Ca2+-permeable cation channel in renal epithelia. Mol Cell Biol 23: 2600–2607. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Nilius B, Prenen J, Droogmans G, Voets T, Vennekens R, Freichel M, et al. (2003) Voltage dependence of the Ca2+-activated cation channel TRPM4. J Biol Chem 278: 30813–30820. [DOI] [PubMed] [Google Scholar]
- 50.Prawitt D, Monteilh-Zoller MK, Brixel L, Spangenberg C, Zabel B, Fleig A, et al. (2003) TRPM5 is a transient Ca2+-activated cation channel responding to rapid changes in [Ca2+]i. Proc Natl Acad Sci U S A 100: 15166–15171. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51.Chung MK, Lee H, Mizuno A, Suzuki M, Caterina MJ (2004) 2-aminoethoxydiphenyl borate activates and sensitizes the heat-gated ion channel TRPV3. J Neurosci 24: 5177–5182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.LaPlante JM, Ye CP, Quinn SJ, Goldin E, Brown EM, Slaugenhaupt SA, et al. (2004) Functional links between mucolipin-1 and Ca2+-dependent membrane trafficking in mucolipidosis IV. Biochem Biophys Res Commun 322: 1384–1391. [DOI] [PubMed] [Google Scholar]
- 53.Launay P, Cheng H, Srivatsan S, Penner R, Fleig A, Kinet JP (2004) TRPM4 regulates calcium oscillations after T cell activation. Science 306: 1374–1377. [DOI] [PubMed] [Google Scholar]
- 54.Shi J, Mori E, Mori Y, Mori M, Li J, Ito Y, et al. (2004) Multiple regulation by calcium of murine homologues of transient receptor potential proteins TRPC6 and TRPC7 expressed in HEK293 cells. J Physiol 561: 415–432. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Grimm C, Kraft R, Schultz G, Harteneck C (2005) Activation of the melastatin-related cation channel TRPM3 by D-erythro-sphingosine [corrected]. Mol Pharmacol 67: 798–805. [DOI] [PubMed] [Google Scholar]
- 56.Nagata K, Duggan A, Kumar G, Garcia-Anoveros J (2005) Nociceptor and hair cell transducer properties of TRPA1, a channel for pain and hearing. J Neurosci 25: 4052–4061. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Nilius B, Prenen J, Janssens A, Owsianik G, Wang C, Zhu MX, et al. (2005) The selectivity filter of the cation channel TRPM4. J Biol Chem 280: 22899–22906. [DOI] [PubMed] [Google Scholar]
- 58.Oberwinkler J, Lis A, Giehl KM, Flockerzi V, Philipp SE (2005) Alternative splicing switches the divalent cation selectivity of TRPM3 channels. J Biol Chem 280: 22540–22548. [DOI] [PubMed] [Google Scholar]
- 59.Li M, Jiang J, Yue L (2006) Functional characterization of homo- and heteromeric channel kinases TRPM6 and TRPM7. J Gen Physiol 127: 525–537. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Togashi K, Hara Y, Tominaga T, Higashi T, Konishi Y, Mori Y, et al. (2006) TRPM2 activation by cyclic ADP-ribose at body temperature is involved in insulin secretion. Embo J 25: 1804–1815. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61.Grimm C, Cuajungco MP, van Aken AF, Schnee M, Jors S, Kros CJ, et al. (2007) A helix-breaking mutation in TRPML3 leads to constitutive activity underlying deafness in the varitint-waddler mouse. Proc Natl Acad Sci U S A 104: 19583–19588. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62.Xu H, Delling M, Li L, Dong X, Clapham DE (2007) Activating mutation in a mucolipin transient receptor potential channel leads to melanocyte loss in varitint-waddler mice. Proc Natl Acad Sci U S A 104: 18321–18326. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Kim HJ, Li Q, Tjon-Kon-Sang S, So I, Kiselyov K, Soyombo AA, et al. (2008) A novel mode of TRPML3 regulation by extracytosolic pH absent in the varitint-waddler phenotype. Embo J 27: 1197–1205. 10.1038/emboj.2008.56 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Nagata K, Zheng L, Madathany T, Castiglioni AJ, Bartles JR, Garcia-Anoveros J (2008) The varitint-waddler (Va) deafness mutation in TRPML3 generates constitutive, inward rectifying currents and causes cell degeneration. Proc Natl Acad Sci U S A 105: 353–358. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Bobkov YV, Corey EA, Ache BW (2011) The pore properties of human nociceptor channel TRPA1 evaluated in single channel recordings. Biochim Biophys Acta 1808: 1120–1128. 10.1016/j.bbamem.2010.12.024 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66.Zhang X, Li X, Xu H (2012) Phosphoinositide isoforms determine compartment-specific ion channel activity. Proc Natl Acad Sci U S A 109: 11384–11389. 10.1073/pnas.1202194109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67.DeCaen PG, Delling M, Vien TN, Clapham DE (2013) Direct recording and molecular identification of the calcium channel of primary cilia. Nature 504: 315–318. 10.1038/nature12832 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Clapham DE, DeCaen P, Carvacho I, Chaudhuri D, Doerner JF, Julius D, et al. (2016) IUPHAR/BPS Guide to PHARMACOLOGY. http://wwwguidetopharmacologyorg/GRAC/FamilyDisplayForward?familyId=78.
- 69.Liu H, Pecka JL, Zhang Q, Soukup GA, Beisel KW, He DZ (2014) Characterization of transcriptomes of cochlear inner and outer hair cells. J Neurosci 34: 11085–11095. 10.1523/JNEUROSCI.1690-14.2014 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Kwan KY, Allchorne AJ, Vollrath MA, Christensen AP, Zhang DS, Woolf CJ, et al. (2006) TRPA1 contributes to cold, mechanical, and chemical nociception but is not essential for hair-cell transduction. Neuron 50: 277–289. [DOI] [PubMed] [Google Scholar]
- 71.Sexton JE, Desmonds T, Quick K, Taylor R, Abramowitz J, Forge A, et al. (2016) The contribution of TRPC1, TRPC3, TRPC5 and TRPC6 to touch and hearing. Neurosci Lett 610: 36–42. 10.1016/j.neulet.2015.10.052 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.Tabuchi K, Suzuki M, Mizuno A, Hara A (2005) Hearing impairment in TRPV4 knockout mice. Neurosci Lett 382: 304–308. [DOI] [PubMed] [Google Scholar]
- 73.Gerka-Stuyt J, Au A, Peachey NS, Alagramam KN (2013) Transient receptor potential melastatin 1: a hair cell transduction channel candidate. PLoS One 8: e77213 10.1371/journal.pone.0077213 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 74.Alagramam KN, Goodyear RJ, Geng R, Furness DN, van Aken AF, Marcotti W, et al. (2011) Mutations in protocadherin 15 and cadherin 23 affect tip links and mechanotransduction in mammalian sensory hair cells. PLoS One 6: e19183 10.1371/journal.pone.0019183 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 75.Yang H, Gan J, Xie X, Deng M, Feng L, Chen X, et al. (2010) Gfi1-Cre knock-in mouse line: A tool for inner ear hair cell-specific gene deletion. Genesis 48: 400–406. 10.1002/dvg.20632 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76.Meyers JR, MacDonald RB, Duggan A, Lenzi D, Standaert DG, Corwin JT, et al. (2003) Lighting up the senses: FM1-43 loading of sensory cells through nonselective ion channels. J Neurosci 23: 4054–4065. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77.Yao G, Luo C, Harvey M, Wu M, Schreiber TH, Du Y, et al. (2015) Disruption of Polycystin-L causes Hippocampal Hyperexcitability. Hum Mol Genet. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78.Tsiokas L, Kim E, Arnould T, Sukhatme VP, Walz G (1997) Homo- and heterodimeric interactions between the gene products of PKD1 and PKD2. Proc Natl Acad Sci U S A 94: 6965–6970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Newby LJ, Streets AJ, Zhao Y, Harris PC, Ward CJ, Ong AC (2002) Identification, characterization, and localization of a novel kidney polycystin-1-polycystin-2 complex. J Biol Chem 277: 20763–20773. [DOI] [PubMed] [Google Scholar]
- 80.Murakami M, Ohba T, Xu F, Shida S, Satoh E, Ono K, et al. (2005) Genomic organization and functional analysis of murine PKD2L1. J Biol Chem 280: 5626–5635. [DOI] [PubMed] [Google Scholar]
- 81.Ishimaru Y, Katano Y, Yamamoto K, Akiba M, Misaka T, Roberts RW, et al. (2010) Interaction between PKD1L3 and PKD2L1 through their transmembrane domains is required for localization of PKD2L1 at taste pores in taste cells of circumvallate and foliate papillae. Faseb J 24: 4058–4067. 10.1096/fj.10-162925 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82.Matei V, Pauley S, Kaing S, Rowitch D, Beisel KW, Morris K, et al. (2005) Smaller inner ear sensory epithelia in Neurog 1 null mice are related to earlier hair cell cycle exit. Dev Dyn 234: 633–650. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Garcia-Gonzalez MA, Outeda P, Zhou Q, Zhou F, Menezes LF, Qian F, et al. (2010) Pkd1 and Pkd2 are required for normal placental development. PLoS One 5. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 84.Huang AL, Chen X, Hoon MA, Chandrashekar J, Guo W, Trankner D, et al. (2006) The cells and logic for mammalian sour taste detection. Nature 442: 934–938. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 85.Ishimaru Y, Inada H, Kubota M, Zhuang H, Tominaga M, Matsunami H (2006) Transient receptor potential family members PKD1L3 and PKD2L1 form a candidate sour taste receptor. Proc Natl Acad Sci U S A 103: 12569–12574. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 86.Ye W, Chang RB, Bushman JD, Tu YH, Mulhall EM, Wilson CE, et al. (2016) The K+ channel KIR2.1 functions in tandem with proton influx to mediate sour taste transduction. Proc Natl Acad Sci U S A 113: E229–238. 10.1073/pnas.1514282112 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87.Nelson TM, Lopezjimenez ND, Tessarollo L, Inoue M, Bachmanov AA, Sullivan SL (2010) Taste function in mice with a targeted mutation of the pkd1l3 gene. Chem Senses 35: 565–577. 10.1093/chemse/bjq070 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88.Eijkelkamp N, Quick K, Wood JN (2013) Transient receptor potential channels and mechanosensation. Annu Rev Neurosci 36: 519–546. 10.1146/annurev-neuro-062012-170412 [DOI] [PubMed] [Google Scholar]
- 89.Lin SY, Corey DP (2005) TRP channels in mechanosensation. Curr Opin Neurobiol 15: 350–357. [DOI] [PubMed] [Google Scholar]
- 90.Christensen AP, Corey DP (2007) TRP channels in mechanosensation: direct or indirect activation? Nat Rev Neurosci 8: 510–521. [DOI] [PubMed] [Google Scholar]
- 91.Di Palma F, Belyantseva IA, Kim HJ, Vogt TF, Kachar B, Noben-Trauth K (2002) Mutations in Mcoln3 associated with deafness and pigmentation defects in varitint-waddler (Va) mice. Proc Natl Acad Sci U S A 99: 14994–14999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.van Aken AF, Atiba-Davies M, Marcotti W, Goodyear RJ, Bryant JE, Richardson GP, et al. (2008) TRPML3 mutations cause impaired mechano-electrical transduction and depolarization by an inward-rectifier cation current in auditory hair cells of varitint-waddler mice. J Physiol 586: 5403–5418. 10.1113/jphysiol.2008.156992 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93.Jors S, Grimm C, Becker L, Heller S (2010) Genetic inactivation of Trpml3 does not lead to hearing and vestibular impairment in mice. PLoS One 5: e14317 10.1371/journal.pone.0014317 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94.Wang W, Zhang X, Gao Q, Xu H (2014) TRPML1: an ion channel in the lysosome. Handb Exp Pharmacol 222: 631–645. 10.1007/978-3-642-54215-2_24 [DOI] [PubMed] [Google Scholar]
- 95.Hoenderop JG, van Leeuwen JP, van der Eerden BC, Kersten FF, van der Kemp AW, Merillat AM, et al. (2003) Renal Ca2+ wasting, hyperabsorption, and reduced bone thickness in mice lacking TRPV5. J Clin Invest 112: 1906–1914. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96.Delling M, DeCaen PG, Doerner JF, Febvay S, Clapham DE (2013) Primary cilia are specialized calcium signalling organelles. Nature 504: 311–314. 10.1038/nature12833 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Nauli SM, Alenghat FJ, Luo Y, Williams E, Vassilev P, Li X, et al. (2003) Polycystins 1 and 2 mediate mechanosensation in the primary cilium of kidney cells. Nat Genet 33: 129–137. [DOI] [PubMed] [Google Scholar]
- 98.Kottgen M, Buchholz B, Garcia-Gonzalez MA, Kotsis F, Fu X, Doerken M, et al. (2008) TRPP2 and TRPV4 form a polymodal sensory channel complex. J Cell Biol 182: 437–447. 10.1083/jcb.200805124 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99.Du J, Ma X, Shen B, Huang Y, Birnbaumer L, Yao X (2014) TRPV4, TRPC1, and TRPP2 assemble to form a flow-sensitive heteromeric channel. Faseb J 28: 4677–4685. 10.1096/fj.14-251652 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 100.Delling M, Indzhykulian AA, Liu X, Li Y, Xie T, Corey DP, et al. (2016) Primary cilia are not calcium-responsive mechanosensors. Nature 531: 656–660. 10.1038/nature17426 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 101.Shin JB, Krey JF, Hassan A, Metlagel Z, Tauscher AN, Pagana JM, et al. (2013) Molecular architecture of the chick vestibular hair bundle. Nat Neurosci 16: 365–374. 10.1038/nn.3312 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 102.LopezJimenez ND, Cavenagh MM, Sainz E, Cruz-Ithier MA, Battey JF, Sullivan SL (2006) Two members of the TRPP family of ion channels, Pkd1l3 and Pkd2l1, are co-expressed in a subset of taste receptor cells. J Neurochem 98: 68–77. [DOI] [PubMed] [Google Scholar]
- 103.Ishii S, Misaka T, Kishi M, Kaga T, Ishimaru Y, Abe K (2009) Acetic acid activates PKD1L3-PKD2L1 channel—a candidate sour taste receptor. Biochem Biophys Res Commun 385: 346–350. 10.1016/j.bbrc.2009.05.069 [DOI] [PubMed] [Google Scholar]
- 104.Steigelman KA, Lelli A, Wu X, Gao J, Lin S, Piontek K, et al. (2011) Polycystin-1 is required for stereocilia structure but not for mechanotransduction in inner ear hair cells. J Neurosci 31: 12241–12250. 10.1523/JNEUROSCI.6531-10.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 105.Yu Y, Ulbrich MH, Li MH, Buraei Z, Chen XZ, Ong AC, et al. (2009) Structural and molecular basis of the assembly of the TRPP2/PKD1 complex. Proc Natl Acad Sci U S A 106: 11558–11563. 10.1073/pnas.0903684106 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 106.Corey DP, Garcia-Anoveros J, Holt JR, Kwan KY, Lin SY, Vollrath MA, et al. (2004) TRPA1 is a candidate for the mechanosensitive transduction channel of vertebrate hair cells. Nature 432: 723–730. [DOI] [PubMed] [Google Scholar]
- 107.Liman ER, Corey DP, Dulac C (1999) TRP2: a candidate transduction channel for mammalian pheromone sensory signaling. Proc Natl Acad Sci U S A 96: 5791–5796. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 108.Stowers L, Holy TE, Meister M, Dulac C, Koentges G (2002) Loss of sex discrimination and male-male aggression in mice deficient for TRP2. Science 295: 1493–1500. [DOI] [PubMed] [Google Scholar]
- 109.Liman ER, Innan H (2003) Relaxed selective pressure on an essential component of pheromone transduction in primate evolution. Proc Natl Acad Sci U S A 100: 3328–3332. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 110.Low SE, Amburgey K, Horstick E, Linsley J, Sprague SM, Cui WW, et al. (2011) TRPM7 is required within zebrafish sensory neurons for the activation of touch-evoked escape behaviors. J Neurosci 31: 11633–11644. 10.1523/JNEUROSCI.4950-10.2011 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 111.Liedtke W, Tobin DM, Bargmann CI, Friedman JM (2003) Mammalian TRPV4 (VR-OAC) directs behavioral responses to osmotic and mechanical stimuli in Caenorhabditis elegans. Proc Natl Acad Sci U S A 100 Suppl 2: 14531–14536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 112.Forge A, Nevill G, Zajic G, Wright A (1992) Scanning electron microscopy of the mammalian organ of Corti: assessment of preparative procedures. Scanning Microsc 6: 521–534; discussion 534–525. [PubMed] [Google Scholar]
- 113.Indzhykulian AA, Stepanyan R, Nelina A, Spinelli KJ, Ahmed ZM, Belyantseva IA, et al. (2013) Molecular remodeling of tip links underlies mechanosensory regeneration in auditory hair cells. PLoS Biol 11: e1001583 10.1371/journal.pbio.1001583 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
There are 33 genes in six major groups (TRPM, TRPC, TRPV, PKD/TRPP, TRPML and TRPA). Length of line indicates divergence.
(TIF)
(a) Trpm2 conditional knockout strategy. We inserted two LoxP sites to flank a ~1.9 kb region that includes exon 21. A LoxP-FRT-Neo-LoxP-FRT cassette was inserted upstream of exon 21 and the third LoxP site was inserted downstream of exon 21. Exon 21 encodes aa929-985 including the essential fifth transmembrane domain and pore. The deletion also led to a downstream frameshift. Red arrowheads refer to LoxP sites, yellow brackets refer to FRT sites, and green arrows refer to the neomycin resistance gene. Primers used for genotyping and validation are indicated as gray arrows. (b) PCR from genomic DNA purified from inner ears of Trpm2fl/fl: Gfi1-Cre+ mice, Trpm2fl/fl:Gfi1-Cre- mice, and an age-matched wildtype mouse. (Left) PCR results using primer pair TM2cKO15101f and SDL. Lane 1 (Trpm2fl/fl:Gfi1-Cre+) shows a fused short band (616bp) only from the deleted allele; lane 2 lacking Cre (Trpm2fl/fl:Gfi1-Cre-) and Lane 3 (wildtype) do not show it. The fused band was confirmed by Sanger sequencing. (Middle) PCR bands at 320 bp (floxed allele) in lane 1 and lane 2, and 259 bp (Wt allele)in lane 3, using primers LOX and SDL, (Right) Genotyping for the Gfi1-Cre allele. A 1-kb DNA extension ladder was used (5 μl; Invitrogen #10511–012).
(TIF)
(a) Exon 9 of the Pkd2 gene was deleted by flanking the ~2.2 kb targeting region with two LoxP sites. A LoxP-Neo-LoxP cassette was inserted downstream of exon 9 and the third LoxP site was inserted upstream. Exon 9 encodes aa630-671 including the pore domain and most of the sixth transmembrane domain of the Pkd2 channel. Primers used for genotyping and validation are indicated as a gray arrows. (b) PCR from genomic DNA purified from inner ears of Pkd2fl/fl:Atoh1-Cre+ mice, Pkd2 fl/fl:Atoh1-Cre-/- mice, and an age-matched wildtype mouse. (Left) PCR results using primer pair PKD2-5940f1 and mPKD2in9R3. Lane 1 (Pkd2fl/fl:Atoh1-Cre+) shows a fused short band (344 bp) from the deleted allele and a longer band (>2437 bp) from the genomic DNA cells without Cre activity. The short fused band was confirmed by Sanger sequencing. Lane 2 (Pkd2 fl/fl:Atoh1-Cre-) shows the same long band as in lane 1 but no short band. Lane 3 shows a band of 2457 bp produced from a wildtype mouse inner ear. (Middle) PCR produced bands at 520bp in lane 1 and lane 2, and 468 bp in lane 3 using mPKD2in9F3 and mPKD2inR3. (Right) Genotyping of the Atoh1-Cre allele. A 1-kb DNA extension ladder was used (5 μl; Invitrogen #10511–012).
(TIF)
(a,a’) Antibody labeling (Santa Cruz Biotechnology, #sc-10376) for Pkd2 (red) and phalloidin staining for actin (green) in the heterozygote (Pkd2fl/+: Atoh1-Cre+) positive-control cochlea. Pkd2 label is evident in hair-cell kinocilia (arrowheads) and some supporting cell primary cilia (arrows). (b,b’) Pkd2fl/fl: Atoh1-Cre+ knockout cochlea. Pkd2 label is absent from hair cell kinocilia but not from supporting cell cilia. (c-c’) In vestibular hair cells of heterozygote mice, Pkd2 label is also in kinocilia. (d) ABR thresholds in response to pure tone stimuli. Pkd2fl/fl: Atoh1-Cre+ knockout mice show normal hearing. Data are mean ± SEM.
(TIF)
The generation of the Pkd2l2 knockout mouse, based on information from The Jackson Laboratory (Pkd2l2tm1Dgen/J; stock #005829; https://www.jax.org/strain/005829). A bacterial lacZ gene fused with a neomycin resistance gene replaced ~ 1.8 kb genomic sequence extending from the 3’ part of exon 3 to the 5’ part of exon 4. Thus the endogenous promoter drove the expression of beta-galactosidase.
(TIF)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.





