Abstract
Serotyping is one of the typing techniques used to classify strains within the same species. O-serogroup diversification shows a strong association with the genetic diversity of O-antigen biosynthesis genes. In a previous study, based on the O-antigen biosynthesis gene cluster (O-AGC) sequences of 184 known Escherichia coli O serogroups (from O1 to O187), we developed a comprehensive and practical molecular O serogrouping (O genotyping) platform using a polymerase chain reaction (PCR) method, named E. coli O-genotyping PCR. Although, the validation assay using the PCR system showed that most of the tested strains were successfully classified into one of the O genotypes, it was impossible to classify 6.1% (35/575) of the strains, suggesting the presence of novel O genotypes. In this study, we conducted sequence analysis of O-AGCs from O-genotype untypeable Shiga toxin-producing E. coli (STEC) strains and identified six novel O genotypes; OgN1, OgN8, OgN9, OgN10, OgN12 and OgN31, with unique wzx and/or wzy O-antigen processing gene sequences. Additionally, to identify these novel O-genotypes, we designed specific PCR primers. A screen of O genotypes using O-genotype untypeable strains showed 13 STEC strains were classified into five novel O genotypes. The O genotyping at the molecular level of the O-AGC would aid in the characterization of E. coli isolates and will assist future studies in STEC epidemiology and phylogeny.
Keywords: E. coli, O serogroup, genotyping techniques, PCR, STEC
Introduction
Serotyping is a standard method for subtyping of Escherichia coli strains in taxonomical and epidemiological studies (Orskov and Orskov, 1984). In particular, the identification of strains of the same O serogroup is essential in outbreak investigations and surveillance for identifying the diffusion of a pathogenic clone (Frank et al., 2011; Luna-Gierke et al., 2014; Terajima et al., 2014; Heiman et al., 2015). Thus far, the World Health Organization Collaborating Centre for Reference and Research on Escherichia and Klebsiella, which is based at the Statens Serum Institut (SSI) in Denmark1, has recognized 185 E. coli O serogroups. These are designated O1 to O188 (publication of O182 to O188 is pending) and include three pairs of subgroups, O18ab/ac, O28ab/ac, and O112ab/ac; and six missing numbers, O31, O47, O67, O72, O93, and O122 (Orskov and Orskov, 1992; Scheutz et al., 2004).
O-serogroup diversification shows a strong association with the genetic diversity of O-antigen biosynthesis genes. In E. coli, the genes required for O-antigen biosynthesis are clustered at a chromosomal locus flanked by the colanic acid biosynthesis gene cluster (wca genes) and the histidine biosynthesis (his) operon. Sequence comparisons of O-antigen biosynthesis gene clusters (O-AGCs) indicate a variety of genetic structures (DebRoy et al., 2011a). In particular, sequences from O-antigen processing genes (wzx/wzy and wzm/wzt) located on the O-AGCs are highly variable and can be used as gene markers for the identification of O serogroups via molecular approaches. So far, several studies have reported genetic methodologies allowing rapid and low-cost O-typing of isolates (Coimbra et al., 2000; Beutin et al., 2009; Bugarel et al., 2010; Wang et al., 2010, 2014; DebRoy et al., 2011b; Fratamico and Bagi, 2012; Quiñones et al., 2012; Geue et al., 2014). In a previous study (Iguchi et al., 2015a), we analyzed the O-AGC sequences of 184 known E. coli O serogroups (from O1 to O187), and organized 162 DNA-based O serogroups (O-genotypes) on the basis of the wzx/wzy and wzm/wzt sequences. Subsequently we presented a comprehensive molecular O-typing scheme: an E. coli O-genotyping polymerase chain reaction (ECOG-PCR) system using 20 multiplex PCR sets containing 162 O-genotype-specific PCR primers (Iguchi et al., 2015b).
The Shiga toxin-producing E. coli (STEC) constitute one of the most important groups of food-borne pathogens, as they can cause gastroenteritis that may be complicated by hemorrhagic colitis or hemolytic-uremic syndrome (HUS; Tarr et al., 2005). O157 is a leading STEC O serogroup associated with HUS (Terajima et al., 2014; Heiman et al., 2015) and other STEC O serogroups, including O26, O103, O111, O121 and O145, are also recognized as significant food-borne pathogens worldwide (Johnson et al., 2006). Additionally, unexpected STEC O serogroups have sometimes emerged to cause sporadic cases or outbreaks. For example, STEC O104:H4 was responsible for a large food-borne disease outbreak in Europe in Buchholz et al. (2011). For such various O-serogroups, ECOG-PCR is an accurate and reliable approach for subtyping E. coli isolates from patients and contaminated foods (Iguchi et al., 2015b; Ombarak et al., 2016). However, as our previous studies indicated, some of the tested strains were not classified into any of the known O genotypes, suggesting the presence of novel O genotypes (Iguchi et al., 2015b).
Here, we analyzed the O-AGCs from genetically untypeable STEC strains (including strains from patients with diarrhea and hemorrhagic colitis) by the ECOG-PCR. By comparing sequences we revealed six novel O-genotypes and developed specific-PCRs for each novel O-genotype.
Materials and Methods
O Serogrouping/O Genotyping
O serogroup were determined by agglutination tests in microtiter plates using commercially available pooled and single antisera against all recognized E. coli O antigens (O1 to O187; SSI Diagnostica, 156 Hillerød, Denmark). O genotypes were determined by ECOG-PCR as described in our previous study (Iguchi et al., 2015b). Salmonella enterica O42 (SSI Diagnostica) and Shigella boydii type 13 (Denka Seiken Co. Ltd., Japan) single antisera were also used to test for the agglutination reaction.
Source Sequences of Novel O-Genotypes
The O-AGC sequences were determined from six O-genotype untypeable (OgUT) STEC strains, of which four were serologically typeable (O1, O39, O40, and O141) and two others were untypeable (OUT) strains (Table 1). All strains were isolated from human feces (including patients with diarrhea and hemorrhagic colitis) in Japan from 2008 to 2012. The O-AGC sequences flanked by wcaM and hisI were extracted from draft genome sequences determined using an Illumina MiSeq sequencer (Illumina, San Diego, CA, USA), as previously described (Ogura et al., 2015). Identification and functional annotation of the coding sequences were performed based on the results of homology searches against the public non-redundant protein database using BLASTP. Six O-AGC sequences reported in this paper have been deposited in the GenBank/EMBL/DDBJ database (accession no. LC125927-LC125932).
Table 1.
Shiga toxin-producing E. coli (STEC) strains used for sequencing of the O-AGC.
| Strain ID | Source (casea) | Year | O serogroup | O genotype | Novel O genotype | stx1 | stx2 | eae | Reference |
|---|---|---|---|---|---|---|---|---|---|
| 090823 | Human (D) | 2009 | O1 | OgUT | OgN10 | + | - | - | Iguchi et al., 2015b |
| 100998 | Human (BD) | 2010 | O39 | OgUT | OgN31 | - | + | - | Iguchi et al., 2015b |
| 121862 | Human (D) | 2012 | O40 | OgUT | OgN1 | - | + | - | Iguchi et al., 2015b |
| 102755 | Human (BD) | 2010 | O141 | OgUT | OgN8 | - | + | - | Iguchi et al., 2015b |
| OT-11 | Human (AC) | 2008 | OUT | OgUT | OgN9 | + | - | + | In this study |
| EHO-67 | Human (D) | 2011 | OUT | OgUT | OgN12 | + | - | - | In this study |
aAC, asymptomatic carrier; D, diarrhea; BD, bloody diarrhea.
Sequence Comparisons
The wzx/wzy sequences from O-serogroup strains (Iguchi et al., 2015a) and OX-groups reference strains (DebRoy et al., 2016) were used. Additionally, O-AGC sequences from O116 (AB812051; Iguchi et al., 2015a), O1 (GU299791; Li et al., 2010), O39 (AB811616; Iguchi et al., 2015a), O141 (DQ868765; Han et al., 2007), O40 (EU296417; Liu et al., 2008), S. enterica O42 (JX975340; Liu et al., 2014), and S. boydii type 13 (AY369140; Feng et al., 2004) were also used. Multiple alignments of DNA and amino acid sequences were constructed by using the CLUSTAL W program (Thompson et al., 1994). Phylogenetic trees were constructed by using the neighbor-joining algorithm using MEGA5 software (Tamura et al., 2007). Homology comparisons of paired sequences were performed by using the In Silico Molecular Cloning Genomics Edition (In Silico Biology, Inc., Yokohama, Japan).
PCR for Identifying Novel O-Genotypes
Polymerase chain reaction primers for specifically identifying novel O genotypes were designed (Table 2) and their specificities were evaluated by using 185 O-serogroup reference strains (O1–O188) from SSI using the following PCR conditions. Genomic DNA from E. coli strains was purified using the Wizard Genomic DNA purification kit (Promega, Madison, WI, USA) or DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. PCRs were performed using 10 ng/μl of template DNA. PCR was performed as follows: each 30-μl reaction mixture contained 2 μl of genomic DNA, 6 μl of 5× Kapa Taq buffer, dNTP mix (final concentration, 0.3 mM each), MgCl2 (final concentration, 2.5 mM), primers (final concentration, 0.5 μM each), and 0.8 U of Kapa Taq DNA polymerase (Kapa Biosystems, Woburn, MA, USA). The thermocycling conditions were: 25 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min. PCR products (2 μl) were electrophoresed in 1.5% agarose gels in 0.5× TBE (25 mM Tris borate, 0.5 mM EDTA), and photographed under UV light after the gel was stained with ethidium bromide (1 mg/ml).
Table 2.
Polymerase chain reaction (PCR) primer sequences for identification of six novel O genotypes.
| O genotype | Primer name | Target gene | Sequence (5′–3′) | Size (bp) |
|---|---|---|---|---|
| OgN1 | OgN1_PCR_F | wzy | GGTTCCCTGTTGCCAATGGT | 525 |
| OgN1_PCR_R | GAGACGAACGTGCAGAAACCA | |||
| OgN8 | OgN8_PCR_F | wzy | AACCTTCGCTATGATGGGGG | 940 |
| OgN8_PCR_R | CTTTACCAGGGATGCTCCGA | |||
| OgN9 | OgN9_PCR_F | wzy | AAGGTTGGTAGCGTAGGGGA | 423 |
| OgN9_PCR_R | CTCGTATTTCGCCCCCATTC | |||
| OgN10 | OgN10_PCR_F | wzy | TGGTGCTGTGTGCTACCATTT | 892 |
| OgN10_PCR_R | AAAGCCAGCCTTAAATCGGA | |||
| OgN12 | OgN12_PCR_F | wzy | TTGTGGCACCTGATCCTGCT | 223 |
| OgN12_PCR_R | GCACATGCTAACCCTGCTCTT | |||
| OgN31 | OgN31_PCR_F | Glycosyltransferase | GCCATAAAAAGAGCAAGGGGG | 311 |
| OgN31_PCR_R | GGGGCAGCTGAAAACCAATC |
Distributional Survey of Novel O-Genotypes
Thirty five O-serogrouped E. coli strains from our previous study (Iguchi et al., 2015b), whose O genotypes were not identified by ECOG-PCR were used for screening novel O-genotypes by the PCR method designed in this study. The prevalence of stx1, stx2 (Cebula et al., 1995) and eae (Oswald et al., 2000) genes in the tested STEC strains was determined by the PCR.
Results
Novel O-Genotypes
Six types of O-AGC were identified from OgUT STEC strains (Figure 1). Four O-AGCs (named OgN10, OgN31, OgN1, and OgN8 genotypes) were obtained from strains that were serologically classified into O1, O39, O40, and O141, respectively (Table 1). Two others (named OgN9 and OgN12 genotypes) were obtained from strains that were both serologically and genetically unclassified into any groups (Table 1). Actually, the OgN9 strain did not react with any particular antiserum, and OgN12 showed identical agglutination titers with O34 and O140 antisera, which resulted in OUT classsification. OgN8, OgN10, and OgN12 carried rmlBDAC for the synsthesis of deoxythymidine diphosphate (dTDP)-L-rhamnose, and OgN31 carried rmlBA-vioA for dTDP viosamine synthesis (Figure 1). OgN9 carried fnlA-qnlBC for UDP-N-acetyl-L-quinovosamine (UDP-L-QuiNAc) synthesis (Figure 1). All novel O-AGCs carried the wzx/wzy O-antigen processing genes (Figure 1). The wzx/wzy sequences from OgN O-AGCs were compared with those from 171 O-serogroup strains and 11 OX-group reference strains, indicating that their sequences were unique compared to those from known O-AGCs (less than 70% DNA sequence identity of closest pairs), except for wzx of OgN31 (Figure 2). The sequence of OgN31_wzx was 98.7% identical in DNA sequence (99.0% amino acid sequence identity) to that of O116. Sequence comparison of O-AGCs revealed that the left region including wzx and genes for the d-TDP glucose pathway was conserved between OgN31 and Og116, and the right region including the wzy and glycosyltransferase genes was unique (less than 40% DNA sequence identity) in each O-AGC (Figure 3A). O-AGC gene sets from four pairs with members of different genotypes that agglutinated with the same O antisera were compared (Figure 3B). Between OgN10 and Og1 (from O1 strain), and between OgN8 and Og141 (from O141 strain), rmlBDAC genes were highly conserved in both O-AGCs, while other genes including wzx and wzy were diversified (less than 70% DNA sequence identity). Between OgN31 and Og39 (from O39 strain), different types of sugar biosynthesis genes were located on each O-AGC (rmlBA-vioA on OgN31, and rmlBDAC-vioAB and manCB on Og39). There was no genetic similarity between OgN1 and Og40 (from O40 strain). From these results, we were convinced that these six were novel O-AGCs.
FIGURE 1.
Six novel O-AGCs from STEC strains. The O-AGCs flanked by wcaM and hisI were extracted from draft genome sequences.
FIGURE 2.

Phylogenetic analysis of Wzx and Wzy homologs from six novel O-AGCs, Escherichia coli O-serogroup strains and OX-groups reference strains based on the amino acid sequences (except for wzy of OX25, which is not found in the O-AGC of OX25). Pairs or groups of homologs with ≥95% DNA sequence identity are indicated in red, and ≥70% identity is indicated in blue. Other homologs with low sequence homologies (less than 70%) are indicated in black.
FIGURE 3.
Comparison of O-AGCs. (A) The pair of O-AGCs, OgN31 and O116. (B) Four pairs that were serologically agglutinated with the same O antisera carried different types of O-AGCs. Lower genes show the O-AGCs from O-serogroup strains. (C) Similar O-AGCs in strains of other genera. Amino acid sequence identities (%) between homologs are shown in the middle.
A BLAST search of the NCBI database revealed that the OgN10 O-AGC is similar to that of S. enterica O42, and the OgN9 O-AGC was almost identical to that of S. boydii type 13 (Figure 3C). OgN10 and OgN9 strains agglutinated with S. enterica O42 and S. boydii type 13 antisera, respectively (data not shown).
Primers for Identifying Novel O Genotypes
Six PCR primer pairs were designed for identifying the novel O-genotypes (Table 2 and Figure 4). All primer pairs were targeted unique sequences of wzy, except for OgN31 for which primers were targeted to a glycosyltransferase gene. Each PCR was evaluated by using all 185 O-serogroup reference strains from O1 to O188 and six novel O-genotype strains (listed in Table 1). PCR products of the expected sizes on the agarose gel were obtained only with the corresponding strains, and no extra products were observed in the size range between 100 and 1,500 bp (data not shown).
FIGURE 4.

Polymerase chain reaction (PCR) products of OgN strains by each specific-primer pair. (1) OgN1 (525 bp), (2) OgN8 (940 bp), (3) OgN9 (423 bp), (4) OgN10 (892 bp), (5) OgN12 (232 bp), (6) OgN31 (311 bp), M; 100-bp DNA ladder markers.
Distribution of Novel O-Genotypes
Among 35 O-serogrouped E. coli strains whose O genotypes were not identified by the ECOG-PCR, five O141, three O1, three O39, one O40, and one O140 strains were classified by using the novel O-genotype PCR into OgN8, OgN10, OgN31, OgN1, and OgN12, respectively (Table 3). All 13 strains classified into five novel O-genotypes were eae-negative STEC, and OgN8, OgN10, and OgN31 had been isolated from patients with bloody diarrhea. OgN8 and OgN12 strains also cross-reacted with O41 and O34 antisera, respectively.
Table 3.
List of STEC strains classified into novel O genotypes by PCR screening.
| Strain ID | Source (casea) | Year | O serogroup | O-genotype | Novel O genotypeb | stx1 | stx2 | eae |
|---|---|---|---|---|---|---|---|---|
| 121862 | Human (D) | 2012 | O40 | OgUT | OgN1∗ | - | + | - |
| 102755 | Human (BD) | 2010 | O141 | OgUT | OgN8∗ | - | + | - |
| 110906 | Human (AC) | 2011 | O141 | OgUT | OgN8 | - | + | - |
| 133345 | Human (AC) | 2013 | O141 | OgUT | OgN8 | + | + | - |
| PV10-60 | Food | 2010 | O141 | OgUT | OgN8 | - | + | - |
| PV12-70 | Food | 2012 | O141 | OgUT | OgN8 | - | + | - |
| 072583 | Human (BD) | 2007 | O1 | OgUT | OgN10 | - | + | - |
| 090823 | Human (D) | 2009 | O1 | OgUT | OgN10∗ | + | - | - |
| 091971 | Human (AC) | 2009 | O1 | OgUT | OgN10 | + | - | - |
| 091275 | Human (AC) | 2009 | O140 | OgUT | OgN12 | + | - | - |
| 100998 | Human (BD) | 2010 | O39 | OgUT | OgN31∗ | - | + | - |
| 100999 | Human (D) | 2010 | O39 | OgUT | OgN31 | - | + | - |
| NBK#585 | Human (AC) | – | O39 | OgUT | OgN31 | - | + | - |
aAC, asymptomatic carrier; D, diarrhea; BD, bloody diarrhea. bStrains used for sequencing of the O-AGC are indicated by asterisks. All strains were isolated in Japan.
Discussion
In this study, six novel O genotypes were revealed from STEC strains isolated from human patients, and the prevalence of these O genotype strains was confirmed in STECs. The OgN10 strains were serologically classified into the O1 serogroup. The O1-serogroup strain is often seen in extra-intestinal pathogenic E. coli from patients with urinary tract infections (Abe et al., 2008; Mora et al., 2009) and septicemic disease (Mora et al., 2009), and in avian pathogenic E. coli (Mora et al., 2009; Johnson et al., 2012). Our previous study showed that an O1 strain isolated from patient blood was classified into Og1 (Iguchi et al., 2015b) and sequence comparisons showed that both an APEC O1 strain from avian colibacillosis (Johnson et al., 2007) and the G1632 strain from a patient with a urinary tract infection (Li et al., 2010) carried the Og1-type O-AGC, whereas three STEC O1 strains used in this study were all classified into OgN10. Actually, we confirmed that five STEC O1 strains from cattle used in a previous study, described as O1B type (Mekata et al., 2014) were also classified into OgN10 (data not shown). In fact, E. coli O1 strains could be generally subtyped into two genotypes, Og1 and OgN10, which were clearly linked to extra-intestinal/avian pathogenic E. coli and STEC, respectively. Among the O1 serogroup, three types of antigen structures have so far been reported (Baumann et al., 1991; Gupta et al., 1992) and the β-linked side-chain N-acetyl-D-mannosamine residue was suggested to be a common O1-specific epitope (Gupta et al., 1992). A partial kinship of O antigen structure synthesized from different O-AGCs may be serologically recognized as the same O serogroup and may also be represented in OgN1 OgN8, OgN12, and OgN31 strains, related to O40, O141, O140, and O39, respectively. The subdivision within each O-serogroup based on the O-AGC DNA sequences may be useful for obtaining more reliable information for epidemiological studies of pathogenic E. coli. Another advantage for DNA-based typing is that serologically untypeable and ambiguous strains could be clearly classified. At the present time, the PCR-based method reported here is the only way to distinguish OgN9. Although, STEC OgN groups have not emerged as a major public health issue, these groups are believed to be a possible cause of diarrhea and bloody diarrhea. To gain more information about trends in STEC OgNs epidemiology, further studies of global OgN isolates are needed. The PCR method described in this study may help the surveillance and monitoring of the OgN groups. Additionally, published sequences from OgN O-AGCs may be used for other DNA-based methodologies, such as in silico typing using whole genome sequencing data (Joensen et al., 2015).
Author Contributions
Conceived and designed the experiments: AI, MO, and TH. Performed the experiments: AI, SI, KS, and HN. Analyzed the data: AI and YO. Contributed reagents/materials/analysis tools: SI, KS, MO, and HM. Wrote the paper: AI. Critical revision of the paper for important intellectual content: AI, SI, and TH.
Conflict of Interest Statement
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer BQ and handling Editor declared their shared affiliation and the handling Editor states that the process nevertheless met the standards of a fair and objective review.
Acknowledgments
We thank Atsuko Akiyoshi and Yuiko Kato for technical assistance.
Funding. This research was partially supported by the Research Program on Emerging and Re-emerging Infectious Diseases from Japan Agency for Medical Research and development (AMED; 15fk0108008h0001), and by the Grants-in-Aid for Scientific Research (C) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) to AI (25350180) and SI (15K08486).
References
- Abe C. M., Salvador F. A., Falsetti I. N., Vieira M. A., Blanco J., Blanco J. E., et al. (2008). Uropathogenic Escherichia coli (UPEC) strains may carry virulence properties of diarrhoeagenic E. coli. FEMS Immunol. Med. Microbiol. 52 397–406. 10.1111/j.1574-695X.2008.00388.x [DOI] [PubMed] [Google Scholar]
- Baumann H., Jansson P. E., Kenne L., Widmalm G. (1991). Structural studies of the Escherichia coli O1A O-polysaccharide, using the computer program CASPER. Carbohydr. Res. 211 183–190. 10.1016/0008-6215(91)84159-C [DOI] [PubMed] [Google Scholar]
- Beutin L., Jahn S., Fach P. (2009). Evaluation of the ‘GeneDisc’ real-time PCR system for detection of enterohaemorrhagic Escherichia coli (EHEC) O26, O103, O111, O145 and O157 strains according to their virulence markers and their O- and H-antigen-associated genes. J. Appl. Microbiol. 106 1122–1132. 10.1111/j.1365-2672.2008.04076.x [DOI] [PubMed] [Google Scholar]
- Buchholz U., Bernard H., Werber D., Böhmer M. M., Remschmidt C., Wilking H., et al. (2011). German outbreak of Escherichia coli O104:H4 associated with sprouts. N. Engl. J. Med. 365 1763–1770. 10.1056/NEJMoa1106482 [DOI] [PubMed] [Google Scholar]
- Bugarel M., Beutin L., Martin A., Gill A., Fach P. (2010). Micro-array for the identification of Shiga toxin-producing Escherichia coli (STEC) seropathotypes associated with Hemorrhagic Colitis and Hemolytic Uremic Syndrome in humans. Int. J. Food Microbiol. 142 318–329. 10.1016/j.ijfoodmicro.2010.07.010 [DOI] [PubMed] [Google Scholar]
- Cebula T. A., Payne W. L., Feng P. (1995). Simultaneous identification of strains of Escherichia coli serotype O157:H7 and their Shiga-like toxin type by mismatch amplification mutation assay-multiplex PCR. J. Clin. Microbiol. 33 248–250. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Coimbra R. S., Grimont F., Lenormand P., Burguière P., Beutin L., Grimont P. A. (2000). Identification of Escherichia coli O-serogroups by restriction of the amplified O-antigen gene cluster (rfb-RFLP). Res. Microbiol. 151 639–654. 10.1016/S0923-2508(00)00134-0 [DOI] [PubMed] [Google Scholar]
- DebRoy C., Fratamico P. M., Yan X., Baranzoni G., Liu Y., Needleman D. S., et al. (2016). Comparison of O-Antigen Gene Clusters of All O-Serogroups of Escherichia coli and Proposal for Adopting a New Nomenclature for O-Typing. PLoS ONE 11:e0147434 10.1371/journal.pone.0147434 [DOI] [PMC free article] [PubMed] [Google Scholar]
- DebRoy C., Roberts E., Fratamico P. M. (2011a). Detection of O antigens in Escherichia coli. Anim. Health Res. Rev. 12 169–185. 10.1017/S1466252311000193 [DOI] [PubMed] [Google Scholar]
- DebRoy C., Roberts E., Valadez A. M., Dudley E. G., Cutter C. N. (2011b). Detection of Shiga toxin-producing Escherichia coli O26, O45, O103, O111, O113, O121, O145, and O157 serogroups by multiplex polymerase chain reaction of the wzx gene of the O-antigen gene cluster. Foodborne Pathog. Dis. 8 651–652. 10.1089/fpd.2010.0769 [DOI] [PubMed] [Google Scholar]
- Feng L., Senchenkova S. N., Yang J., Shashkov A. S., Tao J., Guo H., et al. (2004). Structural and genetic characterization of the Shigella boydii type 13 O antigen. J. Bacteriol. 186 383–392. 10.1128/JB.186.2.383-392.2004 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Frank C., Werber D., Cramer J. P., Askar M., Faber M., an der Heiden M., et al. (2011). Epidemic profile of Shiga-toxin-producing Escherichia coli O104:H4 outbreak in Germany. N. Engl. J. Med. 365 1771–1780. 10.1056/NEJMoa1106483 [DOI] [PubMed] [Google Scholar]
- Fratamico P. M., Bagi L. K. (2012). Detection of Shiga toxin-producing Escherichia coli in ground beef using the GeneDisc real-time PCR system. Front. Cell Infect. Microbiol. 2:152 10.3389/fcimb.2012.00152 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Geue L., Monecke S., Engelmann I., Braun S., Slickers P., Ehricht R. (2014). Rapid microarray-based DNA genoserotyping of Escherichia coli. Microbiol. Immunol. 58 77–86. 10.1111/1348-0421.12120 [DOI] [PubMed] [Google Scholar]
- Gupta D. S., Shashkov A. S., Jann B., Jann K. (1992). Structures of the O1B and O1C lipopolysaccharide antigens of Escherichia coli. J. Bacteriol. 174 7963–7970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Han W., Liu B., Cao B., Beutin L., Krüger U., Liu H., et al. (2007). DNA microarray-based identification of serogroups and virulence gene patterns of Escherichia coli isolates associated with porcine postweaning diarrhea and edema disease. Appl. Environ. Microbiol. 73 4082–4088. 10.1128/AEM.01820-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Heiman K. E., Mody R. K., Johnson S. D., Griffin P. M., Gould L. H. (2015). Escherichia coli O157 Outbreaks in the United States, 2003-2012. Emerg. Infect. Dis. 21 1293–1301. 10.3201/eid2108.141364 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Iguchi A., Iyoda S., Kikuchi T., Ogura Y., Katsura K., Ohnishi M., et al. (2015a). A complete view of the genetic diversity of the Escherichia coli O-antigen biosynthesis gene cluster. DNA Res. 22 101–107. 10.1093/dnares/dsu043 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Iguchi A., Iyoda S., Seto K., Morita-Ishihara T., Scheutz F., Ohnishi M., et al. (2015b). Escherichia coli O-Genotyping PCR: a comprehensive and practical platform for molecular o serogrouping. J. Clin. Microbiol. 53 2427–2432. 10.1128/JCM.00321-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Joensen K. G., Tetzschner A. M., Iguchi A., Aarestrup F. M., Scheutz F. (2015). Rapid and easy in silico serotyping of Escherichia coli isolates by use of whole-genome sequencing data. J. Clin. Microbiol. 53 2410–2426. 10.1128/JCM.00008-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Johnson K. E., Thorpe C. M., Sears C. L. (2006). The emerging clinical importance of non-O157 Shiga toxin-producing Escherichia coli. Clin. Infect. Dis. 43 1587–1595. 10.1086/509573 [DOI] [PubMed] [Google Scholar]
- Johnson T. J., Kariyawasam S., Wannemuehler Y., Mangiamele P., Johnson S. J., Doetkott C., et al. (2007). The genome sequence of avian pathogenic Escherichia coli strain O1:K1:H7 shares strong similarities with human extraintestinal pathogenic E. coli genomes. J. Bacteriol. 189 3228–3236. 10.1128/JB.01726-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Johnson T. J., Wannemuehler Y., Kariyawasam S., Johnson J. R., Logue C. M., Nolan L. K. (2012). Prevalence of avian-pathogenic Escherichia coli strain O1 genomic islands among extraintestinal and commensal E. coli isolates. J. Bacteriol. 194 2846–2853. 10.1128/JB.06375-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Li D., Liu B., Chen M., Guo D., Guo X., Liu F., et al. (2010). A multiplex PCR method to detect 14 Escherichia coli serogroups associated with urinary tract infections. J. Microbiol. Methods 82 71–77. 10.1016/j.mimet.2010.04.008 [DOI] [PubMed] [Google Scholar]
- Liu B., Knirel Y. A., Feng L., Perepelov A. V., Senchenkova S. N., Reeves P. R., et al. (2014). Structural diversity in Salmonella O antigens and its genetic basis. FEMS Microbiol. Rev. 38 56–89. 10.1111/1574-6976.12034 [DOI] [PubMed] [Google Scholar]
- Liu B., Knirel Y. A., Feng L., Perepelov A. V., Senchenkova S. N., Wang Q., et al. (2008). Structure and genetics of Shigella O antigens. FEMS Microbiol. Rev. 32 627–653. 10.1111/j.1574-6976.2008.00114.x [DOI] [PubMed] [Google Scholar]
- Luna-Gierke R. E., Griffin P. M., Gould L. H., Herman K., Bopp C. A., Strockbine N., et al. (2014). Outbreaks of non-O157 Shiga toxin-producing Escherichia coli infection: USA. Epidemiol. Infect. 142 2270–2280. 10.1017/S0950268813003233 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mekata H., Iguchi A., Kawano K., Kirino Y., Kobayashi I., Misawa N. (2014). Identification of O serotypes, genotypes, and virulotypes of Shiga toxin-producing Escherichia coli isolates, including non-O157 from beef cattle in Japan. J. Food Prot. 77 1269–1274. 10.4315/0362-028X.JFP-13-506 [DOI] [PubMed] [Google Scholar]
- Mora A., López C., Dabhi G., Blanco M., Blanco J. E., Alonso M. P., et al. (2009). Extraintestinal pathogenic Escherichia coli O1:K1:H7/NM from human and avian origin: detection of clonal groups B2 ST95 and D ST59 with different host distribution. BMC Microbiol. 9:132 10.1186/1471-2180-9-132 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ogura Y., Mondal S. I., Islam M. R., Mako T., Arisawa K., Katsura K., et al. (2015). The Shiga toxin 2 production level in enterohemorrhagic Escherichia coli O157:H7 is correlated with the subtypes of toxin-encoding phage. Sci. Rep. 5:16663 10.1038/srep16663 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ombarak R. A., Hinenoya A., Awasthi S. P., Iguchi A., Shima A., Elbagory A. R., et al. (2016). Prevalence and pathogenic potential of Escherichia coli isolates from raw milk and raw milk cheese in Egypt. Int. J. Food Microbiol. 221 69–76. 10.1016/j.ijfoodmicro.2016.01.009 [DOI] [PubMed] [Google Scholar]
- Orskov F., Orskov I. (1984). Serotyping of Escherichia coli. Methods Microbiol. 14 43–112. 10.1016/S0580-9517(08)70447-1 [DOI] [Google Scholar]
- Orskov F., Orskov I. (1992). Escherichia coli serotyping and disease in man and animals. Can. J. Microbiol. 38 699–704. 10.1139/m92-115 [DOI] [PubMed] [Google Scholar]
- Oswald E., Schmidt H., Morabito S., Karch H., Marchès O., Caprioli A. (2000). Typing of intimin genes in human and animal enterohemorrhagic and enteropathogenic Escherichia coli: characterization of a new intimin variant. Infect. Immun. 68 64–71. 10.1128/IAI.68.1.64-71.2000 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Quiñones B., Swimley M. S., Narm K. E., Patel R. N., Cooley M. B., Mandrell R. E. (2012). O-antigen and virulence profiling of shiga toxin-producing Escherichia coli by a rapid and cost-effective DNA microarray colorimetric method. Front. Cell Infect. Microbiol. 2:61 10.3389/fcimb.2012.00061 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Scheutz F., Cheasty T., Woodward D., Smith H. R. (2004). Designation of O174 and O175 to temporary O groups OX3 and OX7, and six new E. coli O groups that include Verocytotoxin-producing E. coli (VTEC): O176, O177, O178, O179, O180 and O181. APMIS 112 569–584. 10.1111/j.1600-0463.2004.apm1120903.x [DOI] [PubMed] [Google Scholar]
- Tamura K., Dudley J., Nei M., Kumar S. (2007). MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24 1596–1599. 10.1093/molbev/msm092 [DOI] [PubMed] [Google Scholar]
- Tarr P. I., Gordon C. A., Chandler W. L. (2005). Shiga-toxin-producing Escherichia coli and haemolytic uraemic syndrome. Lancet 365 1073–1086. 10.1016/S0140-6736(05)71144-2 [DOI] [PubMed] [Google Scholar]
- Terajima J., Iyoda S., Ohnishi M., Watanabe H. (2014). Shiga Toxin (Verotoxin)-Producing Escherichia coli in Japan. Microbiol. Spectr. 2 1–9. 10.1128/microbiolspec.EHEC-0011-2013 [DOI] [PubMed] [Google Scholar]
- Thompson J. D., Higgins D. G., Gibson T. J. (1994). CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22 4673–4680. 10.1093/nar/22.22.4673 [DOI] [PMC free article] [PubMed] [Google Scholar]
- Wang Q., Ruan X., Wei D., Hu Z., Wu L., Yu T., et al. (2010). Development of a serogroup-specific multiplex PCR assay to detect a set of Escherichia coli serogroups based on the identification of their O-antigen gene clusters. Mol. Cell. Probes 24 286–290. 10.1016/j.mcp.2010.06.002 [DOI] [PubMed] [Google Scholar]
- Wang S., Meng Q., Dai J., Han X., Han Y., Ding C., et al. (2014). Development of an allele-specific PCR assay for simultaneous sero-typing of avian pathogenic Escherichia coli predominant O1, O2, O18 and O78 strains. PLoS ONE 9:e96904 10.1371/journal.pone.0096904 [DOI] [PMC free article] [PubMed] [Google Scholar]


