Abstract
Background
Some plants had been used in the treatment of cancer and one of these has attracted scientific interest, the Euphorbia tirucalli (E. tirucalli), used in the treatment of asthma, ulcers, warts has active components with activities scientifically proven as antimutagenic, anti-inflammatory and anticancer.
Methods
We evaluate the influence of the antitumoral fraction of the E. tirucalli latex in the larynx squamous cell carcinoma (Hep-2), on the morphology, cell proliferation and gene expression. The Hep-2 cells were cultivated in complete medium (MEM 10 %) and treated with E. tirucalli latex for 1, 3, 5 and 7 days. After statistically analyzing the proliferation of the tested cells, the cells were cultivated again for RNA extraction and the Rapid Subtractive Hybridization (RaSH) technique was used to identify genes with altered expression. The genes found using the RaSH technique were analyzed by Gene Ontology (GO) using Ingenuity Systems.
Results
The five genes found to have differential expression were validated by real-time quantitative PCR. Though treatment with E. tirucalli latex did not change the cell morphology in comparison to control samples, but the cell growth was significantly decreased. The RaSH showed change in the expression of some genes, including ANXA1, TCEA1, NGFRAP1, ITPR1 and CD55, which are associated with inflammatory response, transcriptional regulation, apoptosis, calcium ion transport regulation and complement system, respectively. The E. tirucalli latex treatment down-regulated ITPR1 and up-regulated ANXA1 and CD55 genes, and was validated by real-time quantitative PCR.
Conclusions
The data indicate the involvement of E. tirucalli latex in the altered expression of genes involved in tumorigenic processes, which could potentially be applied as a therapeutic indicator of larynx cancer.
Electronic supplementary material
The online version of this article (doi:10.1186/s12906-016-1115-z) contains supplementary material, which is available to authorized users.
Keywords: Differential gene expression, Cell culture, Subtractive hybridization, Quantitative PCR
Background
The head and neck squamous cell carcinoma (HNSCC) represents malignant tumors arising primarily in the oral cavity, tongue, floor of the mouth, tonsils, pharynx and larynx. Worldwide HNSCC is the fifth most common cancer and it accounts for about 6 % among all cancers [1]. This tumor originates from various anatomic structures including the craniofacial bones, soft tissues, salivary glands, skin, and mucosal membranes [2].
The main risk factors for larynx squamous cell carcinoma (LSCC) are smoking and alcohol consumption [3]. Family history is another important risk factor for this cancer, suggesting that genetic factors may contribute to susceptibility of this disease [4]. Others aspects that can modify cancer risk factors of the head and neck are the polymorphisms in drug metabolizing enzymes (DMEs) and prevalence of variant genotypes of cytochrome P450 (CYP) 1A1, 1B1, 2E1 or glutathione-S-transferase M1 (null). Furthermore, strong associations of the polymorphic genotypes of DMEs with cases of pharyngeal and oral cavity cancer who were tobacco chewers or alcohol users demonstrate that gene-environment interactions may explain differences in genetic susceptibility for cancers of the oral cavity, pharynx and larynx [5].
Some authors have reported that DNA alterations are responsible for the onset of carcinogenesis that usually occur in genes involved with proteins regulating cell cycle, cell growth, and differentiation. These are classified as oncogenes and tumor suppressor genes [6]. In HNSCC, the oncogenes H-ras, c-myc, EGFR and TGF-β are often activated and the tumor suppressor genes such as TP53, p16, FHIT, PTEN, Rb and APC are inactivated [7, 8].
Other factors that may contribute to LSCC include diet, oral hygiene, body mass, environmental pollution, certain working conditions associated with industries such as metallurgy and petrochemical and infections by human papillomavirus - HPV, particularly types 16 and 18 and Epstein-Barr virus which appear to be associated with the development of more aggressive tumors [7, 9–11]. The treatment for this neoplasm is defined depending on the type of cell, degree of differentiation, location, extent, presence of lymph node metastases, and macroscopic characteristics with bone and muscle tumor involvement. Conventional methods used for treatment are surgery, chemotherapy, and radiation therapies, but all these methods are considered highly invasive. Surgery can cause irreversible aesthetic injuries with possible functional alterations [12]. However, some plants have been used in the treatment of cancer as alternative therapies in an attempt to soften the damage caused by conventional methods. The Euphorbia tirucalli (E. tirucalli), popularly known as aveloz, which is used in the herbal treatment of asthma, ulcers, warts and tumors in general has attracted scientific interest [13, 14].
Originating from Africa, E. tirucalli belonging to the family Euphorbiaceae, was subsequently introduced in other countries, it has some compounds that have been scientifically proven to have biological activities such as antiviral, anticancer for breast, antibacterial, anti-inflammatory, antimutagenic, antitumor and larvicidal [13, 15–18]. In addition, some authors have reported that a lectin isolated from the latex of E. tirucalli, called Eutirucallin showed biological activities such as neutrophils recruitment and cytokine production by macrophages [19]. An alternative that justifies its antitumorigenic potential is antimutagenicity. Substances with antimutagenic potentials increase the efficiency of repair mechanisms thereby acting as protective agents that decrease the frequency of DNA damage while controlling the disorderly proliferation of tumor cells [17].
The euphol (tetracyclic triterpene alcohol isolated from the latex of E. tirucalli) showed anticancer effects, inhibiting the growth of human gastric cancer cells and tumor development, demonstrating its great value and potential for use in disease therapy [20]. Anti-inflammatory properties of euphol was observed in skin diseases, because it markedly inhibited TPA (12-O-tetradecanoilphorbol-13-acetato)-induced inflammatory response, demonstrating that euphol can be used as an alternative therapy in skin diseases [21].
To investigate the effects of E. tirucalli in LSCC, we evaluated the influence of this herbal medicine on the morphology, cell proliferation and gene expression in Hep-2 cells. We also identified the signaling pathways where genes modulated by E. tirucalli participate, which are important for tumorigenic and the inflammatory process.
Methods
Hep-2 culture conditions
The Hep-2 cell line originally established from an epidermoid carcinoma of the larynx (ATCC, Rockville, Maryland, USA), was obtained and seeded at a density of 1 × 106 cells/ml per 75 cm2 culture flask (Corning, NY, USA). Minimum Essential Medium (MEM - Cultilab, Campinas, SP, Brazil) was used at pH 7.5 and supplemented with 10 % fetal calf serum (Cultilab), 1 % non-essential amino acids and 1 % antibiotic/antimycotic (Invitrogen Corporation, Carlsbad, CA, USA) and cultured at 37 °C under an atmosphere of 5 % CO2.
Pharmacological treatments
The Hep-2 cells were subdivided into three groups: a) control that was not manipulated, b) the group that was submitted to the addition of vehicle (ethanol) and c) an experimental group where E. tirucalli latex was added at concentrations of 0.25 to 250 μg/ml. The experiments were conducted for periods of 1, 3, 5, and 7 days to determine the statistically significant time for further use in the methodology, for all the three groups.
The sap from E. tirucalli was initially extracted with hexane through an incision in the trunk and branches of the adult plant, and the resulting precipitate was extracted with n-butanol. The active fraction of this latex, diluted in this polar solvent, was used to treat the cells. In this butanol fraction of the E. tirucalli latex, ingenol-3-hexanoate was used to obtain a useful composition for the treatment of disease. Synthesis and modifications were done by Kyolab Laboratories (Campinas, Brazil), by Dr. Luiz Francisco Pianowski.
Separation of the butanol fraction by HPLC (High Performance Liquid Chromatography) allowed the compounds present to be taken off in group scales, mainly by size. In a column chromatography separation with silica gel Sephadex G75, using a mixture of hexane:ethyl acetate (0 to 100 %), eight fractions were separated from the butanol fraction of the latex extract. But one of them show the best presence of components with higher polarity, with solubility and affinity characteristics with the substrate, then this fraction was submitted to tests to verify its anticancer action, as disclosed in the “patent of the active fraction of a polar solvent extract from the latex of Euphorbiaceae plants” (Additional file 1) and results in decreased of growth of seven cancer cell lines [22].
Growth curve
Hep-2 cells were seeded in triplicate at a density of 5 × 104 cells in plastic 6-well plates and divided in three groups. The control group was grown on complete medium, the other groups were submitted to the addition of vehicle (ethanol), whereas E. tirucalli latex was added to the experimental group. Twenty four (24) hours later, when the cells had already adhered, Hep-2 cultures were incubated with serum free medium (MEM 0 %). After an additional 24 h, the control group was maintained in complete medium without any pharmacological manipulation, whereas vehicle (ethanol) was added to the other groups and E. tirucalli latex was added to the experimental group.
The cell morphology was observed on each day. The cytotoxic effects of the E. tirucalli on the proliferation of Hep-2 cells were investigated in three experimental groups at 1, 3, 5 and 7 days. The cells were harvested, stained with trypan blue and counted using the Countess® Automated Cell Counter (Invitrogen®). Significant differences between the groups were determined by one-way analysis of variance (GraphPad Prism 5) and statistical significance was assumed when P <0.05. The same experiment was repeated twice.
RNA extraction for Rapid Subtraction Hybridization (RaSH) and real time PCR experiments
Hep-2 cells were seeded at a density of 1 × 106 cells/ml in 75 cm2 culture flasks in complete medium (control group), vehicle (ethanol) was added and they were incubated with E. tirucalli latex for 3 days (experimental group). The RNA from Hep-2 cells (three groups) was extracted using Trizol [23] following treatment with DNase (Invitrogen). cDNA synthesis was performed using a High Capacity cDNA Archive kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions.
Rapid Subtraction Hybridization (RaSH)
The RaSH technique [24] was performed with two subtractions. The first was termed “Sub I”, in which the Hep-2 control cells were referred to as tester and the cells treated with E. tirucalli latex were termed driver. In the second subtraction, “Sub II,” the opposite test was performed.
The first cDNA strand was obtained by reverse transcriptase with 2 μl of oligo (dT) (50 mM) and 2 μl of 10 mM dNTPs at 65 °C for 5 min. The samples were immediately placed on ice for 1 min and 2.0 μl of 0.1 mM DTT, 1 μl of 40 U/μl RNA-OUT and 4.0 μl of 5X First-Strand Buffer [250 mM Tris-HCl (pH 8,3), 375 mM KCl, 15 mM MgCl2] were added. The samples were incubated at 42 °C for 2 min and 1.0 μl of Superscript™ II reverse transcriptase (RT) (200 U/μl) was added. The samples were incubated again at 42 °C for 50 min and then at 70 °C for 15 min. Segments of β-actin cDNA were also amplified to verify the quality of these reactions.
The second strand of cDNA was synthesized in reactions containing 30 μl of 5X Second Strand Buffer, 3 μl of 10 mM dNTPs, 1 μl of DNA ligase (10 U/μl), 4 μl of DNA Pol I (10 U/μl) and 1.0 μl of RNase H (2 U/μl). The samples were incubated for 2 h at 16 °C before the addition of 2 μl of T4 DNA Pol (5 U/μl) and further incubation for an additional 5 min. The action of the enzyme T4 DNA Pol was inhibited by the addition of 10 μl of 0.5 M EDTA. Phenol/chloroform extraction was used to purify the sample and the pellet was resuspended in 45 μl of water. The cDNA was used in amplification reactions for segments of GAPDH and was subsequently digested with 2 μl of MboI enzyme (10 U/μL) and incubated for 1 h at 37 °C. Finally, over 1 μl of this enzyme was added to the reaction, and the samples were incubated overnight at 37 °C.
A volume of 4.1 and 4.5 μl, of the adapters XDPN-14 5′-CTGATCACTCGAGA and XDPN-12 5′-GATCTCTCGAGT (Sigma Chemical, final concentration 10 mM) was added to the cDNA respectively, 8 μl of 5X T4 DNA ligase buffer Invitrogen©, heated at 55 °C for 1 min, and cooled down to 14 °C within 1 h was also added. The cDNA received 3 μl (9 U) of T4 DNA ligase (3 U/μl), ligation was carried out overnight at 14 °C. After phenol/chloroform extraction and ethanol/glycogen precipitation, the mixtures were diluted to 100 μl with TE buffer (10 mM Tris/1 mM EDTA); 40 μl of the mixtures were used for PCR amplification.
The PCR mixtures were set up using 10 μM XPDN-18 5′-CTGATCACTCGAGAGATC, 0.4 mM dNTPs, 10 × PCR buffer, 1.5 mM MgCl2 and 1U Taq DNA polymerase (Invitrogen). Thermocycler conditions were one cycle at 72 °C for 5 min, followed by 25 cycles of 94 °C for 1 min, 55 °C for 1 min, 72 °C for 1 min, ending in a final extension at 72 °C for 3 min. Ten (10 μg) micrograms of purified PCR product (tester) was digested with 10 U/μl XhoI (Invitrogen) for 6 h at 37 °C and followed phenol/chloroform extraction and ethanol precipitation.
One-hundred nanograms of the tester cDNA were mixed with 5 μg of the driver cDNA in hybridization solution (0.5 M NaCl, 50 mM Tris/HCl, SDS 2 % and 40 % formamide) and, after heating at 99.9 °C for 5 min, they were incubated at 42 °C for 1 h, and 42 °C for 48 h. After extraction and precipitation, the hybridization mixture (1 μg) was ligated with XhoI-digested pZero plasmid and transformed into competent bacteria. Bacterial colonies were picked and used as DNA template for PCR. Clones were sequenced using an automated DNA sequence and homologies sequences were searched using the BLAST program. Gene ontology (GO) annotation was used for the functional classification of up- and down-regulated genes using terms from Gene Ontology database.
The genes were further analyzed through Ingenuity Pathway (IPA - Ingenuity Systems©) to relate the differentially expressed genes with biological functions and processes in which these genes are involved and evaluate the main networks of interaction between them.
Quantitative PCR - RT-qPCR
The RNA from control, vehicle (ethanol) and E. tirucalli latex treated Hep-2 cells was extracted and cDNA synthesis was performed as described above.
Five differentially expressed genes were selected for validation by quantitative real time PCR experiments according to their direct or indirect involvement in tumorigenesis. Their expression was checked in treated samples relative to matched non-treated samples.
The primers were manually designed with: 19–23 bp length, 30–80 % GC content and a short amplicon size (80–120 bp). Their sequences are shown in Table 1. Real-time PCR was performed in triplicate using a 7500 Fast Real-Time PCR System (Applied Biosystems). Reaction mixture consisted of a 20 μl volume solution containing 10 μl of Power SYBR Green PCR Master Mix (Applied Biosystems).
Table 1.
Primers for the selected genes. ANXA1, ITPR1, CD55, NGFRAP1 and TCEA1 primers to quantitative PCR validation
| Primer | Sequence |
|---|---|
| ANXA1 antisense | 5′ TAAGGGTGACCGATCTGAGG 3′ |
| ANXA1 sense | 5′ ACGTCTGTCCCCTTTCTCCT 3′ |
| ITPR1 antisense | 5′ GCTCTATGAGCAGGGGTGAG 3′ |
| ITPR1 sense | 5′ GGAACACTCGGTCACTGGAT 3′ |
| CD55 antisense | 5′ CAGCACCACCACAAATTGAC 3′ |
| CD55 sense | 5′ TGCTCTCCAATCATGGTGAA 3′ |
| NGFRAP1 antisense | 5′ GGGGGAGCTCTCTAATCACC 3′ |
| NGFRAP1 sense | 5′ AAAGAAAACAGCGGGAATCA 3′ |
| TCEA1 antisense | 5′ AGCTGAAAGAGATGCGGAAA 3′ |
| TCEA1 sense | 5′ TGCCACATGTGAACAAGTCA 3′ |
Reaction mixture consisted of a 20 μl volume solution containing 100 and 500 ηg of Power SYBR Green PCR Master Mix (Applied Biosystems), 100 nM of each primer and 100 ng cDNA (control and treated with E. tirucalli latex). The PCR conditions were 95 °C for 10 min followed by 40 cycles of 95° for 15 s and 60° for 1 min. Melting curve analysis was performed for each gene to check the specificity and identity of the RT-PCR products. For each primer set, the efficiency of the PCR reaction (linear equation: y = slope + intercept) was measured in triplicate on serial dilutions of the same cDNA sample. The PCR efficiency (E) was calculated by the formula E = [10(-1/slope)] and ranged from 1.96 to 2.02 in the different assays.
Two control genes (GAPDH, ACTB) were used as internal standards. The relative expression ratio (fold change) of the target genes was calculated according to Pfaffl [25]. Statistical analysis was performed by a two-tailed unpaired t test using GraphPad prism software.
Results
Cellular morphology
Hep-2 cells were initially cultured and observed by phase contrast microscopy. These cells have a fusiform appearance and central core, with multiple nucleoli and a eucromatic position, which are characteristics of a cell with high metabolic activity. In cells treated with E. tirucalli latex [25 μg/ml], there was no morphological change, and cytoplasmic processes were more clearly observed due to reduced cell proliferation (Fig. 1a and b).
Fig. 1.

Morphological analysis and growth curve of E. tirucalli latex treatment in Hep-2 cell line. Hep-2 cells were seeded in complete MEM 10 % at a concentration of 5×104 per well (6 well plate). The cell morphology observed in (a) the control group, characterized by a monolayer of nucleated cells was not altered in (b) the E. tirucalli latex [25 μg/mL] treated group for 3 days. 400× magnification. The growth curve observed to Hep-2 cells treated with (c) E. tirucalli latex [0.25, 2.5, 25, 250 μg/ml] for 1, 3, 5 and 7 days and (d) ethanol (vehicle) and E. tirucalli latex [25 μg/ml] for 1, 3, 5 and 7 days. Assays were performed in triplicate. Graph x = time (hours) and y = number of cells × 104. P values <0.05 were significant
Proliferation assay
In the proliferation assay (Fig. 1c), it was possible to observe the growth inhibitory effect under treatment with E. tirucalli latex, using the GraphPad Prism 5 (GraphPad Software). E. tirucalli was shown to decrease the proliferation in treated cells in comparison to the control group. Statistical analysis showed that these differences were most significant (P < 0.05) at a concentration of 25 μg/ml E. tirucalli and a culture time of 3 days.
We also observed, using the same statistical test, that the addition of ethanol reduced cell proliferation, however, they did not exhibit any statistically significant difference compared to control group (Fig. 1d), confirming that the reduced growth of Hep2 cells was due to E. tirucalli and not its diluent’s (ethanol), (Additional files 2 and 3).
Genes identified using the RaSH approach
Rapid subtractive hybridization (RaSH) compares two distinct experiments aiming to find differential gene expression. RaSH was performed on Hep-2 cells from the control group and those treated with E. tirucalli latex for 3 days and 85 clones were isolated and sequenced. By screening these sequences through GenBank (Blast) and by rigorous classification and selection, 19 genes were found to be differentially expressed, and two libraries of genes (Sub I and Sub II) were acquired. Fifteen genes of the “Sub I” library exhibited changes in expression levels in the control cells, whereas four genes of the “Sub II” library changed in expression under treatment with E. tirucalli latex. Therefore, it was expected that the gene expression of one library would be lower than that of the other one. The libraries of the genes obtained along with their different functions and processes are described in the Gene Ontology (GO) databases.
IPA was used to further analyze the 19 differentially expressed genes, which were especially associated with tumorigenesis, apoptosis, cell proliferation, cell cycle, DNA repair, complement activation and inflammatory response (Table 2). Moreover, some of these genes were chosen because they form a network of important interactions with other genes such as NF-kB.
Table 2.
Genes selected by RasH in the subtractive library I expressed in Hep-2 cell line. NM is the access number in GenBank (www.ncbi.nlm.nih.gov)
| NM | Name | Abbreviation | Chromosomal location | Functions and processes |
|---|---|---|---|---|
| NM_001099952.2 | Homo sapiens inositol 1,4,5-trisphosphate receptor, type 1 | ITPR1 | 3p26.1 | Protein binding; calcium ion transmembrane transporter activity; intrinsic apoptotic signaling pathway and signal transduction. |
| NM_000700.1 | Homo sapiens annexin A1 | ANXA1 | 9q21.13 | Calcium ion binding; regulation of cell proliferation; inflammatory response; cell surface receptor signaling pathway; negative regulation of apoptotic process. |
| NM_006756.2 | Homo sapiens transcription elongation factor A (SII), 1 | TCEA1 | 8q11.2 | DNA repair; positive regulation of transcription from RNA polymerase II promoter and gene expression. |
| NM_000574.3 | Homo sapiens CD55 molecule, decay accelerating factor for complement | CD55 | 1q32 | Enzyme inhibitor activity; elevation of cytosolic calcium ion concentration and regulation of complement activation. |
| NM_206917.1 | Homo sapiens nerve growth factor receptor (TNFRSF1) associated protein 1 | NGFRAP1 | Xq22.2 | Protein binding; induction of apoptosis. |
Five differentially expressed genes, ITPR1, ANXA1, TCEA1, CD55 and NGFRAP1, were selected for validation by quantitative real-time PCR experiments. These genes are associated with calcium ion transport, inflammatory response, DNA repair, complement activation and apoptotic process respectively. They were chosen because they are directly or indirectly involved in tumorigenic and inflammatory processes (Table 2 and Fig. 2).
Fig. 2.

Network of gene interaction NF-KB pathway obtained from the subtraction of the control Hep-2 cells. Ingenuity Systems© software reveals a network of gene interactions associated with cancer, squamous cell tumor, benign tumor, apoptosis, proliferation, aggregation, morphology, viability, development and cell signaling, cell cycle control, cell membrane fusion, cleavage RNA fragment, protein transport, angiogenesis, activation of the complement system, innate immune response, release and activation of the calcium ion, inflammatory, antimicrobial response, inherited disorders, organ hypoplasia, oral cancer and laryngeal cancer process
Real-time PCR validation of differentially expressed genes
The RaSH analysis indicated the down-regulation of one gene (ITPR1) and up-regulation of four genes (ANXA1, TCEA1, CD55 and NGFRAP1) in Hep-2 cells treated with E. tirucalli latex. The quantitative PCR experiment showed that only the expression of ITPR1 was significantly reduced, however the expression of CD55 and ANXA1 genes was significantly increased in Hep-2 cells after treatment with E. tirucalli latex (Fig. 3). The expression of other genes oscillated without statistical significance, which was most likely because the E. tirucalli does not quantitatively modify the expression of the selected genes despite its interaction with the cell (Additional file 4).
Fig. 3.

Quantitative Real time PCR gene expression in Hep-2 cells treated with E. tirucalli latex. Expression of ITPR1, ANXA1, TCEA1, CD55 and NGFRAP1 genes in Hep-2 cells treated with 25 μg/ml of E. tirucalli latex compared with control cells. The data represent the logarithm base 2
Discussion
The active fraction present in the E. tirucalli latex that was used in our experiments inhibits proliferation of tumor-related enzymes and presents potential anti-inflammatory and analgesic effects [26]. Also, due to the importance of its antitumogenic action, we analyzed the effect of herbal medicine in the cell line of laryngeal squamous cell carcinoma (Hep-2) and it was observed that the morphology did not change after treatment with E. tirucalli latex, however, cell proliferation decreased significantly. Other authors corroborate these results, they also observed that treatment with E. tirucalli in cell line of breast cancer did not alter the morphology of these cells independent on the vehicle [15]. Regarding the reduced proliferation, E. tirucalli must have acted in tumorigenic cells causing cell death and also causing the growth of these cells to be reduced. In vitro, it is known that latex works in the cell colonies fighting breast cancer and gastric cancer [19, 27].
The E. tirucalli latex effect was also analyzed in the gene expression, for the first time, by RaSH that isolates differentially expressed genes including new genes and rare transcripts as can be seen in some researches [28] and others who use this technology [29]. It is possible to generate significant genomic libraries that can assist in the search for genes differentially expressed in treated Hep-2 cells with herbal cell lines which is faster and less costly than other alternative hybridization techniques [24].
The results showed changes in the expression of some genes in the cells of LSCC after treatment with E. tirucalli latex, including ANXA1, TCEA1, NGFRAP1, ITPR1 and CD55 genes. These genes belong to the same gene signaling network related by software IPA, correlating the tumorigenic and inflammatory processes. Other authors used the software IPA to identify the biological activities of the genes that distinguish between the thermal properties, hot (warm effects, disperse cold) or cold (cooling effect, removes heat) of Chinese medicinal herb. It was demonstrated that the main biological gene networks in the herbs with hot properties include inflammation and immunity regulation while the genes of the herbs with cold properties affect cell growth, proliferation and development [30].
The selection of the validated ITPR1 gene (inositol 1,4,5-trisphosphate receptor, type 1) can contribute significantly to the understanding of processes including cancer of the larynx since it has functions related to apoptosis, tumorigenesis of cells squamous and cell proliferation. Inositol 1,4,5-trisphosphate receptor type1 (IP3R1) is known as an IP3-gated Ca2+ channel that is located on the endoplasmic reticulum (ER). The ER stores intracellular Ca2+ and it has been reported to play a critical role in a variety of cell functions including cell proliferation, contraction of smooth muscle and apoptosis by pumping out Ca2+ from ER to cytosol [31–33].
We observed reduced ITPR1 gene expression in Hep -2 cells after treatment with E. tirucalli latex. Other project showed that IP3 receptors act as in vivo substrates for Akt kinase, which plays a key role in suppressing apoptosis [34]. According to our tests, it can be inferred that the E. tirucalli latex decreases the expression of ITPR1 gene by restricting the action of the enzyme Akt kinase and activating apoptosis, decreasing cell growth of LSCC since these receptors are substrates for the action of this enzyme.
Another gene studied was ANXA1 (Annexin 1), there was increased expression in Hep-2 cells after treatment with E. tirucalli latex. This gene is important for the carcinogenic process such as cell cycle control, regulation of apoptosis, cell proliferation and growth, inflammatory response and calcium ion transport regulation [35]. The annexin family consists of ubiquitous proteins that interact with phospholipids in a Ca2+-dependent manner. Each annexin consists of an N-terminal domain and a typical core domain. The annexin core is conserved among all members of the annexin family. In contrast, N-terminal domains are variable in length and are believed to regulate annexin functions, forming a truncated molecule with altered sensitivity to calcium [36].
Changes in the expression of ANXA1 have been reported in various cancers and, furthermore, its expression has been compared to that of other proteins. This scenario prompted Jorge et al. [37] to investigate the relationship between the gene and protein expression of annexin-A1 (ANXA1/AnxA1) and galectin-1(LGALS1/Gal-1) in an inflammatory gastric lesion as chronic gastritis (CG) and gastric adenocarcinoma (GA) and its association with H. pylori infection. High ANXA1mRNA expression levels were observed in 90 % of CG cases and in 80 % of GA cases. However, LGALS1 mRNA levels were high in 60 % of the GA cases, while low expression was found in CG. These results have provided evidence that galectin-1 and mainly annexin-A1 are overexpressed in both gastritis and gastric cancer, suggesting a strong association of these proteins with chronic gastric inflammation and carcinogenesis [37].
The expression of ANXA1 was evaluated in larynx cancer and it was observed that this protein plays a regulatory role in Hep-2 cells, decreasing the growth of these cells [38]. We infer that the E. tirucalli latex contributes to increased expression of the gene ANXA1 in the larynx squamous cell carcinoma, confirming the role of Annexin A1 in the regulation of cell proliferation, besides the anti-inflammatory function.
The gene CD55 (decay accelerating factor) presents functions related with squamous tumor cells, apoptosis, cell growth and proliferation, inflammatory response, calcium ion transport regulation and innate immune response, according to the reported data Gene Ontology (GO).
This gene is a key regulator affecting all three complement activation pathways and encoding a globular glycoprotein known as DAF - decay accelerating factor. DAF inhibits the activation of C3 and C5 by preventing the formation of new and accelerating the decay of preformed C3 and C5 convertases which can mediate the downstream effect of all 3 complement-activation pathways, therefore, CD55 functions to protect host cells from complement attack and inhibits amplification of the complement cascade [39].
CD55 is an anti-inflammatory and immunological anti-adhesive molecule implicated in the resolution of ongoing inflammation of mucosal epithelia through clearance of transmigrating neutrophils [40]. In our tests, it was demonstrated that the expression of CD55 was elevated in cell lines of laryngeal squamous cell carcinoma after treatment with E. tirucalli latex, confirming its anti-inflammatory role.
The genes evaluated in this study showed differential expression in Hep-2 cells in a manner dependent on E. tirucalli latex treatment. This study highlights the importance of the RaSH technique as a fast and efficient method for identifying genes modulated by E. tirucalli latex in cells of epithelial origin. The functions of the genes identified in this study are important in tumor progression and are amenable to changes through interactions with the metabolism of the Hep-2 cells. The treatment for larynx carcinoma commonly involves surgery, chemotherapy or radiotherapy. However, new therapeutics such as the use of gene therapy associated with nanoparticles tested in larynx cancer derived Hep-2 cells are being developed, allowing the delivery of drugs into target cells.
Furthermore, the E. tirucalli latex alters the proliferation and gene expression of Hep-2 cells. These changes are most likely related to inflammatory and tumorigenic processes. Thus, we suggest that the this herb has modulatory effects on the metabolism of this cell type. Our findings suggest the importance of future studies using Hep-2 cells for the development of new therapies. These studies should focus on gene activities that involve the action of E. tirucalli and applications of this herb as a possible therapeutic in the treatment larynx carcinoma.
Conclusions
These findings show that the E. tirucalli latex alters the expression of genes with roles in signaling cascades involved in the inflammatory and tumorigenic processes. E. tirucalli latex was also shown to alter the proliferation of Hep-2 cells. Thus, our results point to possible applications of this herb as an indicator of innovative therapies for the treatment of LSCC.
Ethics approval and consent to participate
Not applicable in this section.
Consent for publication
Not applicable in this section.
Acknowledgements
We are profoundly grateful to the São Paulo State University (UNESP), the Institute of Biosciences, Letters and Science (IBILCE) and the Faculty of Engineering of Ilha Solteira (FEIS) for their technical support.
Funding
This study was supported by the Fundação de Amparo à Pesquisa do Estado de São Paulo - FAPESP (Grants 2012/07853-6 to GBF-S and 2013/24083-2 to FCR-L) and Pró Reitoria de Pesquisa da UNESP (PROPE/ProInter to FCR-L). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Abbreviations
- ACTB
beta-actin
- AKt
protein kinase
- ANXA1
annexin A1
- APC
adenomatous polyposis coli
- BLAST
basic local alignment search tool
- C3
C3 convertase enzyme
- C5
C5 convertase enzyme
- Ca2+
calcium
- CD55
decay accelerating factor for complement
- cDNA
complementary DNA
- CG
chronic gastritis
- c-myc
myelocytomatosis oncogene
- CO2
carbon dioxide
- CYP1A1
cytochrome P450, family 1, subfamily A, member 1
- CYP1B1
cytochrome P450, family 1, fubfamily B, polypeptide 1
- CYP2E1
cytochrome P450, family 2, subfamily E, member 1
- DAF
decay accelerating factor
- DMEs
polymorphisms in drug-metabolizing enzymes
- DNA
deoxyribonucleic acid
- DNA Pol I
DNA Polymerase I
- DNase
deoxyribonuclease
- dNTP
deoxynucleotide - solution mix
- DTT
DL-Dithiothreito
- EDTA
ethylenediaminetetraacetic acid
- EGFR
epidermal growth factor receptor
- ER
endoplasmic reticulum
- FHIT
fragile histidine triad
- GA
gastric adenocarcinoma
- GAPDH
Glyceraldehyde 3-phosphate dehydrogenase
- GC
guanine and cytosine
- GO
gene ontology
- Hep-2
cells epidermoid carcinoma of the larynx
- HNSCC
head and neck squamous cell carcinoma
- HPLC
high performance liquid chromatography
- HPV
human papilloma virus
- H-ras
harvey rat sarcoma virus oncogene homolog
- IP3
inositol 1,4,5-triphosphate
- IP3R1
inositol 1,4,5-trisphosphate receptor type1
- IPA
ingenuity pathway - ingenuity systems©
- ITPR1
inositol 1,4,5-trisphosphate receptor, type 1
- KCl
potassium chloride
- LGALS1/Gal-1
galectin-1
- LSCC
larynx squamous cell carcinoma
- MboI
enzyme gene from Moraxella bovis
- MEM
minimum essential medium
- MgCL2
magnesium chloride
- min
minutes
- mL
milliliter
- mM
milimolar
- mRNA
messenger RNA
- NaCl
sodium chloride
- NF-κB
nuclear factor kappa-light-chain-enhancer of activated B cells
- ng
nanogram
- NGFRAP1
nerve growth factor receptor (TNFRSF16) associated protein 1
- nM
nanomolar
- p16
cyclin-dependent kinase inhibitor 2A
- P450
cytochrome P450
- pb
base pairs
- PCR
polymerase chain reaction
- PTEN
phosphatase and tensin homolog
- RaSH
rapid subtraction hybridization
- Rb
retinoblastoma
- RNA
ribonucleic acid
- RNase H
ribonuclease H
- RT
reverse transcriptase
- RT-qPCR
quantitative PCR
- SDS
sodium dodecyl sulfate
- Sub I
subtraction I - tester = Hep-2 control cells (no treatment) versus driver = Hep-2 cells treated with aveloz
- Sub II
subtraction II - tester = Hep-2 cells treated with aveloz versus driver = Hep-2 control cells (no treatment)
- T4 DNA Pol
T4 DNA Polymerase
- TCEA1
transcription elongation factor A protein 1
- TE
buffer Tris-EDTA
- TGF-β
transforming growth factor beta
- TP53
tumor protein p53
- TPA
12-O-tetradecanoilphorbol-13-acetato
- Tris-HCl
hydroxymethyl aminomethane hydrochloride
- Trizol
monophasic solution of phenol and guanidine thiocyanate
- U
units
- XhoI
enzyme gene from Xanthomonas holcicola
- μg
microgram
- μL
microliters
- μM
micromolar
Additional files
Patente Euphorbia tirucalli. (PDF 96 kb)
Excel spreadsheet about Figure 1C – raw data on cell count. (XLS 41 kb)
Excel spreadsheet about Figure 1D – raw data on cell count. (XLS 23 kb)
Excel spreadsheet about Figure 3 – raw data on quantitative PCR. (XLS 74 kb)
Footnotes
Competing interests
The authors declare that they have no competing interests.
Authors’ contributions
GBF-S carried out the cell culture experiments, RaSH assay, real-time PCR assay, performed the statistical analysis, and drafted the manuscript. JP assisted with the cell culture experiments and RaSH assay. ARDS and WASJr assisted with the RaSH assay. BRC assisted with the real-time PCR assay. EHT and SMO were involved in drafting the manuscript or revising it critically for important intellectual content. FCR-L conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All of the authors read and approved the final manuscript.
References
- 1.Islami F, Fedirko V, Tramacere I, Bagnardi V, Jenab M, Scotti L, Rota M, Corrao G, Garavello W, Schuz J, Straif K, Negri E, Boffetta P, La Vecchia C. Alcohol drinking and esophageal squamous cell carcinoma with focus on light-drinkers and never-smokers: a systematic review and meta-analysis. Int J Cancer. 2011;129(10):2473–84. doi: 10.1002/ijc.25885. [DOI] [PubMed] [Google Scholar]
- 2.Pai SI, Westra WH. Molecular pathology of head and neck cancer: implications for diagnosis, prognosis, and treatment. Annu Rev Pathol. 2009;4:49–70. doi: 10.1146/annurev.pathol.4.110807.092158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Hashibe M, Brennan P, Chuang SC, Boccia S, Castellsague X, Chen C, Curado MP, Dal Maso L, Daudt AW, Fabianova E, Fernandez L, Wünsch-Filho V, Franceschi S, Hayes RB, Herrero R, Kelsey K, Koifman S, La Vecchia C, Lazarus P, Levi F, Lence JJ, Mates D, Matos E, Menezes A, McClean MD, Muscat J, et al. Interaction between tobacco and alcohol use and the risk of head and neck cancer: pooled analysis in the International Head and Neck Cancer Epidemiology Consortium. Cancer Epidemiol Biomarkers Prev. 2009;18(2):541–50. doi: 10.1158/1055-9965.EPI-08-0347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Negri E, Boffetta P, Berthiller J, Castellsague X, Curado MP, Dal Maso L, Daudt AW, Fabianova E, Fernandez L, Wünsch-Filho V, Franceschi S, Hayes RB, Herrero R, Koifman S, Lazarus P, Lence JJ, Levi F, Mates D, Matos E, Menezes A, Muscat J, Eluf-Neto J, Olshan AF, Rudnai P, Shangina O, Sturgis EM, et al. Family history of cancer: pooled analysis in the International Head and Neck Cancer Epidemiology Consortium. Int J Cancer. 2009;124(2):394–401. doi: 10.1002/ijc.23848. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Maurya SS, Katiyar T, Dhawan A, Singh S, Jain SK, Pant MC, Parmar D. Gene-environment interactions in determining differences in genetic susceptibility to cancer in subsites of the head and neck. Environ Mol Mutagen. 2014;55(2):134–44. doi: 10.1002/em.21837. [DOI] [PubMed] [Google Scholar]
- 6.Jorde LB, Carey JC, Bamshad MJ, White RL. Genética Médica. 2. Rio de Janeiro: Guanabara Koogan; 2000. Genética do Câncer; pp. 197–212. [Google Scholar]
- 7.Choi S, Myers JN. Molecular pathogenesis of oral squamous cell carcinoma: implications for therapy. J Dent Res. 2008;87(1):14–32. doi: 10.1177/154405910808700104. [DOI] [PubMed] [Google Scholar]
- 8.Dasgupta S, Dash R, Das SK, Sarkar D, Fisher PB. Emerging strategies for the early detection and prevention of head and neck squamous cell cancer. J Cell Physiol. 2012;227(2):467–73. doi: 10.1002/jcp.22767. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gillison ML, D’Souza G, Westra W, Sugar E, Xiao W, Begum S, Viscidi R. Distinct risk factor profiles for human papillomavirus type 16-positive and human papillomavirus type 16-negative head and neck cancers. J Natl Cancer Inst. 2008;100(6):407–20. doi: 10.1093/jnci/djn025. [DOI] [PubMed] [Google Scholar]
- 10.Morshed K, Polz-Gruszka D, Szymański M, Polz-Dacewicz M. Human Papillomavirus (HPV) - structure, epidemiology and pathogenesis. Otolaryngol Pol. 2014;68(5):213–9. doi: 10.1016/j.otpol.2014.06.001. [DOI] [PubMed] [Google Scholar]
- 11.Platek ME, Myrick E, McCloskey SA, Gupta V, Reid ME, Wilding GE, Cohan D, Arshad H, Rigual NR, Hicks WL, Jr, Sullivan M, Warren GW, Singh AK. Pretreatment weight status and weight loss among head and neck cancer patients receiving definitive concurrent chemoradiation therapy: implications for nutrition integrated treatment pathways. Support Care Cancer. 2013;21(10):2825–33. doi: 10.1007/s00520-013-1861-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Franzi SA, Silva PG. Avaliação da qualidade de vida em pacientes submetidos à quimioterapia ambulatorial no Hospital Heliópolis. Revista Brasileira de Cancerologia. 2003;49(3):153–8. [Google Scholar]
- 13.Betancur-Galvis LA, Morales GE, Forero JE, Roldan J. Cytotoxic and antiviral activities of Colombian medicinal plant extracts of the Euphorbia genus. Mem Inst Oswaldo Cruz. 2002;97(4):541–6. doi: 10.1590/S0074-02762002000400017. [DOI] [PubMed] [Google Scholar]
- 14.Melo JG, Santos AG, de Amorim EL, Do Nascimento SC, de Albuquerque UP. Medicinal plants used as antitumor agents in Brazil: an ethnobotanical approach. Evid Based Complement Alternat Med. 2011;2011:365359. doi: 10.1155/2011/365359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Aquino CL, Barbosa GM, Barbosa GM, Varricchio MBA, Veiga VF, Kuster RM, Zancan P, Sola-penna M, Holandino C. High dilutions of Euphorbia tirucalli L. (aveloz) modify the viability and glycolytic metabolism of cell lines. Int J High Dil Res. 2008;7(24):132–9. [Google Scholar]
- 16.Lirio LG, Hermano ML, Fontanilla MQ. Note antibacterial activity of medicinal plants from the Philippines. Pharm Biol. 1998;36(5):357–9. doi: 10.1076/phbi.36.5.357.4656. [DOI] [Google Scholar]
- 17.Rezende JRR, Rodrigues SB, Jabor IAS, PamphilE JA, Da Rocha CLMSC. Efeito antimutagênico do látex de Euphorbia tirucalli no sistema metionina em Aspergillus nidulans. Acta Scientiarum Biol Sci. 2004;26(4):481–4. [Google Scholar]
- 18.Valadares MC, Carrucha SG, Accorsi W, Queiroz ML. Euphorbia tirucalli L. modulates myelopoiesis and enhances the resistance of tumour-bearing mice. Int Immunopharmacol. 2006;6(2):294–9. doi: 10.1016/j.intimp.2005.07.013. [DOI] [PubMed] [Google Scholar]
- 19.Santana SS, Gennari-Cardoso ML, Carvalho FC, Roque-Barreira MC, Santiago Ada S, Alvim FC, Pirovani C. Eutirucallin, a RIP-2 type lectin from the latex of Euphorbia tirucalli L. presents proinflammatory properties. PLoS One. 2014;9(2):e88422. [DOI] [PMC free article] [PubMed]
- 20.Lin MW, Lin AS, Wu DC, Wang SS, Chang FR, Wu YC, Huang YB. Euphol from Euphorbia tirucalli selectively inhibits human gastric cancer cell growth through the induction of ERK1/2-mediated apoptosis. Food Chem Toxicol. 2012;50(12):4333–9. doi: 10.1016/j.fct.2012.05.029. [DOI] [PubMed] [Google Scholar]
- 21.Passos GF, Medeiros R, Marcon R, Nascimento AF, Calixto JB, Pianowski LF. The role of PKC/ERK1/2 signaling in the anti-inflammatory effect of tetracyclic triterpene euphol on TPA-induced skin inflammation in mice. Eur J Pharmacol. 2013;698(1-3):413–20. doi: 10.1016/j.ejphar.2012.10.019. [DOI] [PubMed] [Google Scholar]
- 22.Pianowski LF, Chaves CP, Calixto JB. Active fraction of a polar solvent extract from the latex of Euphorbiaceae plants. US Patent 2009/0142421 A1; 2009
- 23.Sambrook J, Russel DW. Molecular cloning: a laboratory manual. 3. Cold Spring Harbor, N. Y.: Cold Spring Harbor Laboratory Press; 2001. [Google Scholar]
- 24.Jiang H, Kang DC, Alexandre D, Fisher PB. RaSH, a rapid subtraction hybridization approach for identifying and cloning differentially expressed genes. Proc Natl Acad Sci. 2000;97(23):12684–9. doi: 10.1073/pnas.220431297. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29(9):e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Araujo LA, Mrué F, Neves RA, Alves MM, Silva-Júnior NJ, Silva MSB, Melo-Reis PR. Effects of topical treatment with euphorbia tirucalli latex on the survival and intestinal adhesions in rats with experimental peritonitis. Arq Bras Cir Dig. 2015;28(4):243–6. doi: 10.1590/S0102-6720201500040006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kuo PL, Cho CY, Hsu YL, Lin TC, Lin CC. Putranjivain A from Euphorbia jolkini inhibits proliferation of human breast adenocarcinoma MCF-7 cells via blocking cell cycle progression and inducing apoptosis. Toxicol Appl Pharmacol. 2006;213(1):37–45. doi: 10.1016/j.taap.2005.08.003. [DOI] [PubMed] [Google Scholar]
- 28.Rodrigues-Lisoni FC, Peitl Jr P, Vidotto A, Polachini GM, Maniglia JV, Carmona-Raphe J, et al. Genomics and proteomics approaches to the study of cancer-stroma interactions. BMC Med Genomics. 2010;3:1–15. [DOI] [PMC free article] [PubMed]
- 29.Calmon MF, Rodrigues RV, Kaneto CM, Moura RP, Silva SD, Mota LD, et al. Epigenetic silencing of CRABP2 and MX1 in head and neck tumors. Neoplasia. 2009;11(12):1329–39. [DOI] [PMC free article] [PubMed]
- 30.Liang F, Li L, Wang M, Niu X, Zhan J, He X, Yu C, Jiang M, Lu A. Molecular network and chemical fragment-based characteristics of medicinal herbs with cold and hot properties from Chinese medicine. J Ethnopharmacol. 2013;148(3):770–9. doi: 10.1016/j.jep.2013.04.055. [DOI] [PubMed] [Google Scholar]
- 31.Lencesova L, Hudecova S, Csaderova L, Markova J, Soltysova A, Pastorek M, Sedlak J, Wood ME, Whiteman M, Ondrias K, Krizanova O. Sulphide signaling potentiates apoptosis through the up-regulation of IP3 receptor types 1 and 2. Acta Physiol (Oxf) 2013;208(4):350–61. doi: 10.1111/apha.12105. [DOI] [PubMed] [Google Scholar]
- 32.Berridge MJ. Inositol trisphosphate and calcium signalling. Nature. 1993;361(6410):315–25. doi: 10.1038/361315a0. [DOI] [PubMed] [Google Scholar]
- 33.Demaurex N, Distelhorst C. Apoptosis - the calcium connection. Science. 2003;300(5616):65–7. doi: 10.1126/science.1083628. [DOI] [PubMed] [Google Scholar]
- 34.Khan MT, Wagner L, 2nd, Yule DI, Bhanumathy C, Joseph SK. Akt kinase phosphorylation of inositol 1,4,5-trisphosphate receptors. J Biol Chem. 2006;281(6):3731–7. doi: 10.1074/jbc.M509262200. [DOI] [PubMed] [Google Scholar]
- 35.Oliani SM, Paul-Clark MJ, Cristian HC, Flower RJ, Perretti M. Neutrophil interaction with inflamed post-capillary venule endothelium alters annexin 1 expression. Am J Pathol. 2001;158(2):603–15. doi: 10.1016/S0002-9440(10)64002-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Gerke V, Moss SE. Annexins: from structure to function. Physiol Rev. 2002;2:331–71. doi: 10.1152/physrev.00030.2001. [DOI] [PubMed] [Google Scholar]
- 37.Jorge YC, Mataruco MM, Araújo LP, Rossi AF, de Oliveira JG, Valsechi MC, Caetano A, Miyazaki K, Fazzio CS, Thomé JA, Rahal P, Oliani SM, Silva AE. Expression of annexin-A1 and Galectin-1 anti-inflammatory proteins and mRNA in chronic gastritis and gastric cancer. Mediat Inflamm. 2013;2013:152860. doi: 10.1155/2013/152860. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Gastardelo TS, Cunha BR, Raposo LS, Maniglia JV, Cury PM, Lisoni FC, Tajara EH, Oliani SM. Inflammation and cancer: role of annexin A1 and FPR2/ALX in proliferation and metastasis in human laryngeal squamous cell carcinoma. PLoS One. 2014;9(12):e111317. doi: 10.1371/journal.pone.0111317. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39.Lublin DM, Atkinson JP. Decay-accelerating factor: biochemistry, molecular biology, and function. Ann Rev Immunol. 1989;7(1):35–58. doi: 10.1146/annurev.iy.07.040189.000343. [DOI] [PubMed] [Google Scholar]
- 40.Lawrence DW, Bruyninckx WJ, Louis NA, Lublin DM, Stahl GL, Parkos CA, Colgan SP. Antiadhesive role of apical decay-accelerating factor (CD55) in human neutrophil transmigration across mucosal epithelia. J Exp Med. 2003;198(7):999–1010. doi: 10.1084/jem.20030380. [DOI] [PMC free article] [PubMed] [Google Scholar]
