Skip to main content
PeerJ logoLink to PeerJ
. 2016 May 17;4:e2041. doi: 10.7717/peerj.2041

Isolation and characterization of eight microsatellite loci from Galeocerdo cuvier (tiger shark) and cross-amplification in Carcharhinus leucas, Carcharhinus brevipinna, Carcharhinus plumbeus and Sphyrna lewini

Agathe Pirog 1,, Sébastien Jaquemet 1, Antonin Blaison 1,2, Marc Soria 2, Hélène Magalon 1,3
Editor: David Coltman
PMCID: PMC4878374  PMID: 27231661

Abstract

The tiger shark Galeocerdo cuvier (Carcharhinidae) is a large elasmobranch suspected to have, as other apex predators, a keystone function in marine ecosystems and is currently considered Near Threatened (Red list IUCN). Knowledge on its ecology, which is crucial to design proper conservation and management plans, is very scarce. Here we describe the isolation of eight polymorphic microsatellite loci using 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries. Their characteristics were tested on a population of tiger shark (n = 101) from Reunion Island (South-Western Indian Ocean). All loci were polymorphic with a number of alleles ranging from two to eight. No null alleles were detected and no linkage disequilibrium was detected after Bonferroni correction. Observed and expected heterozygosities ranged from 0.03 to 0.76 and from 0.03 to 0.77, respectively. No locus deviated from Hardy-Weinberg equilibrium and the global FIS of the population was of 0.04NS. Some of the eight loci developed here successfully cross-amplified in the bull shark Carcharhinus leucas (one locus), the spinner shark Carcharhinus brevipinna (four loci), the sandbar shark Carcharhinus plumbeus (five loci) and the scalloped hammerhead shark Sphyrna lewini (two loci). We also designed primers to amplify and sequence a mitochondrial marker, the control region. We sequenced 862 bp and found a low genetic diversity, with four polymorphic sites, a haplotype diversity of 0.15 and a nucleotide diversity of 2 × 10−4.

Keywords: Carcharhiniform, Microsatellites, Control region, Population Genetics

Introduction

The tiger shark Galeocerdo cuvier is a large carcharhinid (up to 5.5 m in total length for the largest females), which lives in warm temperate, tropical and subtropical waters (Compagno, 1984; Randall, 1992). This species is opportunistic and feeds on a very large range of preys according to their availability in the environment. It is considered as a generalist forager (Lowe et al., 1996; Simpfendorfer, Goodreid & McAuley, 2001). Different studies estimated the age of sexual maturity around seven to ten years for both sexes (Branstetter, Musick & Colvocoresses, 1987; Natanson et al., 1999; Kneebone et al., 2008), and a lifespan between 27 and 29 years for males and females, respectively (Kneebone et al., 2008). The species favours coastal habitats (Heithaus et al., 2006; Papastamatiou et al., 2013) and can be highly reef associated (Meyer, Papastamatiou & Holland, 2010) even if transoceanic movements are regularly observed (Rooney et al., 2006; Heithaus et al., 2007; Lea et al., 2015). Tiger sharks occupy defined but very large home ranges (Holland et al., 1999), which renders difficult the implementation of adapted conservation measures. Galeocerdo cuvier is classified as Near Threatened by the International Union for Conservation of Nature (IUCN) Red List of Endangered Species (Simpfendorfer, 2009). Although it is one of the largest marine predators, little is known about the ecology of this species, which has mostly been studied using in situ and direct observations. To our knowledge, only one study has focused on population genetics of G. cuvier, in Hawaii (Bernard, Feldheim & Shivji, 2015), and characterized nine microsatellite loci for this species. Another study (Chen et al., 2014) mapped the entire mitogenome for this species but did not test for mitochondrial markers that would be useful for population genetics studies.

Here, we developed a supplementary set of eight microsatellite loci for the tiger shark, polymorphic at the population scale. Until now, 12 microsatellite loci were available for the tiger shark, including the nine developed in Bernard, Feldheim & Shivji (2015) and the three loci characterized from Carcharhinus leucas that are polymorphic in G. cuvier (Pirog et al., 2015). With these eight new loci, 20 microsatellite loci will now be available to study this species, which will be very useful when studying the genetic structure of tiger shark populations worldwide. We described their characteristics by genotyping 101 G. cuvier individuals caught at Reunion Island, South-Western Indian Ocean, and tested cross-amplification in four other carcharhiniform species. Furthermore, we designed primers to amplify and sequence the mitochondrial control region (also called D-loop).

Material and Methods

The samples were collected on tiger sharks caught during the scientific program CHARC (French acronym for “Knowledge on the ecology and the habitat of two coastal shark species”) off the west coast of Reunion Island (21°06′S, 55°36′E), South Western Indian Ocean, 700 km east from Madagascar between October 2011 and May 2013 (Blaison et al., 2015). The program CHARC was approved by Reunion Island Ethic Committee, the local representative of the French national ethic committee. For sharks tagged during an acoustic study (Blaison et al., 2015), a piece of fin tissue was biopsied on living animals. Pieces of muscle were also collected from professional fishermen by-catches. A total of 101 adults (46 males and 55 females) were sampled.

Total genomic DNA was extracted using Qiagen DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany) from small pieces of tissues (fin or muscle). The microsatellite library was developed using 11 individuals (six females and five males). Biggest tagged individuals (320–390 cm total length) were chosen to decrease the probability of sampling related individuals and thus, to increase genetic variability. Indeed, choosing both small and big individuals increases the probability to use related individuals (parents and their offspring) to construct the library. Total genomic DNA was sent to GenoScreen, Lille, France (www.genoscreen.fr). One µg was used for the development of the microsatellites library through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries as described in Malausa et al. (2011). Briefly, total DNA was mechanically fragmented and enriched for AG, AC, AAC, AAG, AGG, ACG, ACAT and ATCT repeat motifs. Enriched fragments were subsequently amplified. PCR products were purified, quantified and GsFLX libraries were then carried out following manufacturer’s protocols and sequenced on a GsFLX PTP. Sequences of the microsatellite-enriched library were analysed using the software QDD (Meglecz et al., 2010) and primer pairs were selected depending on the motif (di-, tri-, tetra-, hexanucleotide), the number of repeats (≥5) and the product size (≥100 bp) and tested on agarose gel for amplification. Then, depending on the putative allele number, the polymorphism was verified by genotyping 11 G. cuvier individuals on an ABI 3730 XL sequencer (Applied Biosystems, Foster City, CA, USA).

The developed set of microsatellite loci was then used to genotype our sampling of 101 G. cuvier individuals. Each amplification reaction contained 10 µL of PCR product. Microsatellite loci developed in this study were directly fluorochrome labelled (using 6-FAM, PET, VIC or NED), and the reaction mixture contained 5 µL of MasterMix Applied 2× (Applied Biosystems, Foster city, CA, USA), 1.5 µL of demineralized water, 0.5 µL of each primer (10 µM) and 2.5 µL of genomic DNA (10 ng/µL). The thermocycling program was: an initial denaturing step at 94 °C for 5 min, 7 cycles of 94 °C for 30 s, 62 °C (−1 °C at each cycle) for 30 s, 72 °C for 30 s, 35 cycles of 94 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, followed by a final extension step at 72 °C for 5 min. Allelic sizes were determined using Genemapper v 4.0 (Applied Biosystems, Foster city, CA).

The transferability of these loci was checked on the bull shark Carcharhinus leucas (n = 41), the spinner shark Carcharhinus brevipinna (n = 2), the sandbar shark Carcharhinus plumbeus (n = 3) and the scalloped hammerhead shark Sphyrna lewini (n = 4). These samples have been collected from professional fishermen by-catches caught at Reunion Island. Extractions and genotyping were conducted following the same protocol as above.

From the G. cuvier mitochondrion sequence available in GenBank (KF111728.1), we designed primers to amplify the control region (D-loop) using PRIMER3 v 4.0.0 (Rozen & Skaletsky, 2000): the forward primer Gc-CR-F (5’-CCC AAA GCC AAG ATT CTG CC-3’) and the reverse primer Gc-CR-R (5’-CGA GAC CAA CCA TGT ATA TTA AGG G-3’). These primers were used for both amplification and direct sequencing. PCR reactions were performed in a total volume of 25 µL containing 12.5 µL of Applied MasterMix 2x (Applied Biosystems, Foster city, CA), 7.5 µL of demineralized water, 1 µL of each primer (10 µM) and 3 µL of genomic DNA (10 ng/µL). The thermocycling program contained an initial denaturing step at 94 °C for 5 min, 35 cycles of (94 °C for 30 s, 56 °C for 30 s, 72 °C for 1 min 30 s), and a final extension step at 72 °C for 5 min. The sequencing of the mitochondrial DNA was realised by GenoScreen, Lille, France (www.genoscreen.fr).

Concerning microsatellite loci, presence and frequencies of null alleles, which may be responsible for an excess of homozygotes, were assessed using MicroChecker v 2.2.3 (Van Oosterhout et al., 2004). Tests of linkage disequilibrium were performed using Arlequin v 3.5.1.2 (Excoffier & Lischer, 2010). Diversity indices such as the number of alleles per locus Na, the observed and expected heterozygosities (HO and HE), the inbreeding coefficient FIS (Cockerham & Weir, 1984) were assessed, and Hardy-Weinberg equilibrium was tested using FSTAT v 2.9.3.2 (Goudet, 1995).

Mitochondrial sequences were edited and aligned using Geneious v 6.1.7 created by Biomatters (available from http://www.geneious.com/). Haplotype and nucleotide diversities were calculated using DnaSP v 5.10.1 (Librado & Rozas, 2009).

Results

Sequencing of the microsatellite-enriched library yielded 20,303 reads. A total of 6,982 sequences (34%) containing microsatellite motif were identified. After QDD analysis, 103 primer pairs were recognized. Among these, 95 primer pairs were selected depending on our criteria: 36 (37.9% ) successfully amplified. Then, depending on the putative allele number, the polymorphism of 32 primer pairs was verified by genotyping 11 G. cuvier individuals on an ABI 3730 XL sequencer. A total of eight microsatellite loci (GenBank accession numbers: KP300805, KP300806, KP300807, KP300808, KP300809, KP300810, KP300811, KP300812) were finally selected and characterized for G. cuvier (Table 1).

Table 1. Characterization of the eight microsatellite loci developed for Galeocerdo cuvier and their primer sequences (F: forward; R: reverse).

No locus deviated from Hardy-Weinberg equilibrium. Annealing temperature Ta = 55 °C.

Locus name Repeat motif Forward primer (5′–3′) Reverse primer (5′–3′) Allele size (bp) Na HO HE FIS
Gc01 (GA)6 AGGTGTGGTGGCTCTCCTC GGACGCAAAATCCAACAGAG 143–147 2 0.03 0.03 − 0.01
Gc02 (AG)7 GAGAGGGAGAAGCAAGTCAACATA GTTTCTCTTCTTGTCCTCTTCCA 93–105 4 0.15 0.15 0.01
Gc03 (TC)8 TTGATTTCTACCTGGTCGGC TCAGAGCAAAGAGCTCCAGA 121–129 3 0.56 0.58 0.04
Gc04 (TC)9 CCCCAGGGAAATAATCTAAGG CAGGGGGACGACTAGTCAAG 195–199 2 0.36 0.38 0.07
Gc05 (CT)11 CTGGGTGGCAGCAAATTAGA TGAGCCTTCTCACCCAGAGT 117–123 2 0.45 0.50 0.10
Gc06 (AC)11 CATGACGTTTCGCCACAATA TTTCCTCCCACAGTCCAAAG 116–122 3 0.13 0.14 0.07
Gc07 (CA)14 ATTGCAATCTGTGCCATCAA TTTGTGAGAGTGTCTGTATGTTTG 114–130 8 0.76 0.77 0.02
Gc08 (AGTG)6 GTGCAGGGAGGAATGTGAGT TTGTCAAGAGTCCACGTGTCTT 207–219 3 0.49 0.49 0.02

Notes.

Diversity indices are issued from FSTAT v2.9.3.2;

bp
Base pairs
Na
Number of alleles per locus
HO
Observed heterozygosity
HE
Expected heterozygosity
FIS
Inbreeding coefficient

The eight loci developed in G. cuvier were then used to genotype 101 tiger sharks caught at Reunion Island between 2011 and 2013. All loci were polymorphic with a number of alleles ranging from two to eight. No null alleles were detected and no linkage disequilibrium was detected after Bonferroni nor FDR corrections. Observed and expected heterozygosities ranged from 0.03 to 0.76 and from 0.03 to 0.77, respectively (Table 1). No locus was found to deviate from Hardy-Weinberg equilibrium and the global FIS of the population was of 0.04NS, following Hardy-Weinberg proportions.

Among these eight loci, one (12.5%) successfully cross-amplified in C. leucas, four (50%) in C. brevipinna, five (62.5%) in C. plumbeus, and two (25%) in S. lewini (Table 2). The number of alleles ranged from one to four depending on the species (Table 2).

Table 2. Cross-amplification for eight microsatellite loci designed for Galeocerdo cuvier across four Carcharhiniformes: Carcharhinus leucas (n = 41), Carcharhinus brevipinna (n = 2), Carcharhinus plumbeus (n = 3) and Sphryna lewini (n = 4).

Locus name C. leucas C. brevipinna C. plumbeus S. lewini
(n = 41) (n = 2) (n = 3) (n = 4)
Gc01 +P 136-142 (3) +139(1) +135(1) +P 152–156 (3)
41/41 2/2 3/3 4/4
Gc02 +P 99-101 (2)
2/3
Gc03
Gc04 +198(1) +P 194-200 (2)
2/2 2/3
Gc05 +159(1) +105(1)
2/2 2/3
Gc06 +P 112-116 (3)
3/3
Gc07 +P 173-185 (4)
4/4
Gc08 +222(1)
2/2

Notes.

+
Amplified
+P
Polymorphic
No amplification

Size ranges in base pairs and number of alleles (in parentheses) are also indicated. Numbers of amplifications observed are indicated in bold.

The 101 G. cuvier adults were sequenced, and sequences were edited and aligned over 862 bp. All sequences were of high quality and easily readable without ambiguities. We observed four polymorphic sites (over 862 bp), distributed among only five haplotypes, which were deposited in GenBank (accession numbers: KP317128, KP317129, KP317130, KP317131, KP317132, ). The haplotype diversity (h) was 0.15 ± 0.048 (sd) and the nucleotide diversity (π) 2 × 10−4 ± 7 × 10−5 (sd). Among these haplotypes, one was over-represented (n = 93; 92% of the individuals sequenced).

Discussion

The development of these loci (nuclear and mitochondrial), added to those previously described in Bernard, Feldheim & Shivji (2015) and in Pirog et al. (2015) (three loci characterized from C. leucas polymorphic for G. cuvier), will be very useful in studying tiger shark ecology, which remains poorly documented, especially in assessing population structure and patterns of migration, effective population size and some aspects of their reproductive behaviour. Furthermore, the mitochondrial control region highlighted low genetic diversity in the tiger shark and should be useful to study the evolution of tiger shark populations.

These loci may also be used when studying other carcharhiniform species. Indeed, most shark species being heavily exploited by both artisanal and industrial fisheries, including in the Western Indian Ocean (Campana & Ferretti, 2016), it is relevant and useful to possess genetic tools to conduct population genetics analyses.

Supplemental Information

Data S1. Dataset.

Microsatellite data and sequences of the control region for individuals studied. (−) indicates no data

DOI: 10.7717/peerj.2041/supp-1

Acknowledgments

The authors thank fishermen T Gazzo and C Perry, veterinaries B Reche and J Robert, D Guyomard (Comité Régional des Pêches Maritimes et des Elevages Marins de La Réunion), G Vangrevelynghe (Squal’Idées) and all the participants who took part in collecting samples. This study was carried out under the scientific program CHARC (Connaissances de l’écologie et de l’habitat de deux espèces de requins côtiers à La Réunion ; FEDER fund Convention 2011 Presage No 33021). We thank S Duthoy (Genoscreen, Lille, France) for her assistance and helpful discussions.

Funding Statement

A Pirog benefited from European Social Funds from the EU and attributed by the Reunion Island regional council to conduct her PhD. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Additional Information and Declarations

Competing Interests

The authors declare there are no competing interests.

Author Contributions

Agathe Pirog performed the experiments, analyzed the data, wrote the paper, prepared figures and/or tables, reviewed drafts of the paper.

Sébastien Jaquemet and Marc Soria conceived and designed the experiments, performed the experiments, contributed reagents/materials/analysis tools, reviewed drafts of the paper.

Antonin Blaison performed the experiments, reviewed drafts of the paper.

Hélène Magalon conceived and designed the experiments, performed the experiments, analyzed the data, contributed reagents/materials/analysis tools, reviewed drafts of the paper.

Ethics

The following information was supplied relating to ethical approvals (i.e., approving body and any reference numbers):

The program CHARC was approved by Reunion Island Ethic Committee, the local representative of the French national ethic committee (approval letter).

DNA Deposition

The following information was supplied regarding the deposition of DNA sequences:

For microsatellite sequences, GenBank accession numbers: KP300805, KP300806, KP300807, KP300808, KP300809, KP300810, KP300811, KP300812.

For mitochondrial sequences, Genbank accession numbers: KP317128, KP317129, KP317130, KP317131, KP317132.

Data Availability

The following information was supplied regarding data availability:

The raw data has been supplied as Data S1.

References

  • Bernard, Feldheim & Shivji (2015).Bernard AM, Feldheim KA, Shivji MS. Isolation and characterization of polymorphic microsatellite markers from a globally distributed marine apex predator, the tiger shark (Galeocerdo cuvier) Conservation Genetics Resources. 2015;7:509–511. doi: 10.1007/s12686-014-0408-0. [DOI] [Google Scholar]
  • Blaison et al. (2015).Blaison A, Jaquemet S, Guyomard D, Vangrevelynghe G, Gazzo T, Cliff G, Cotel P, Soria M. Seasonal variability of bull and tiger shark presence on the west coast of Reunion Island, western Indian Ocean. African Journal of Marine Science. 2015;37:199–208. doi: 10.2989/1814232X.2015.1050453. [DOI] [Google Scholar]
  • Branstetter, Musick & Colvocoresses (1987).Branstetter S, Musick JA, Colvocoresses JA. A comparison of the age and growth of the tiger shark, Galeocerdo cuvier, from off Virginia and from the northwestern Gulf of Mexico. Fishery Bulletin. 1987;85:269–279. [Google Scholar]
  • Campana & Ferretti (2016).Campana SE, Ferretti F. The first global integrated marine assessment, World Ocean Assessment I, United Nations. United Nations; New York: 2016. Sharks and other elasmobranchs; pp. 1437–1451. [Google Scholar]
  • Chen et al. (2014).Chen X, Yu J, Zhang S, Ding W, Xiang D. Complete mitochondrial genome of the tiger shark Galeocerdo cuvier (Carcharhiniformes: Carcharhinidae) Mitochondrial DNA. 2014;25:441–442. doi: 10.3109/19401736.2013.809450. [DOI] [PubMed] [Google Scholar]
  • Cockerham & Weir (1984).Cockerham CC, Weir BS. Estimating F-statistics for the analysis of population structure. Evolution. 1984;38:1358–1370. doi: 10.2307/2408641. [DOI] [PubMed] [Google Scholar]
  • Compagno (1984).Compagno LJV. FAO Fisheries Synopsis, 125. Rome: FAO; 1984. FAO species catalogue: Vol 4. Sharks of the world: an annotated and illustrated catalogue of shark species known to date. Part 2 - Carcharhiniformes. [Google Scholar]
  • Excoffier & Lischer (2010).Excoffier L, Lischer HEL. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resources. 2010;10:564–567. doi: 10.1111/J.1755-0998.2010.02847.X. [DOI] [PubMed] [Google Scholar]
  • Goudet (1995).Goudet J. FSTAT (Version 1.2): a computer program to calculate F-statistics. Journal of Heredity. 1995;86:485–486. [Google Scholar]
  • Heithaus et al. (2006).Heithaus MR, Hamilton IM, Wirsing AJ, Dill LM. Validation of a randomization procedure to assess animal habitat preferences: microhabitat use of tiger sharks in a seagrass ecosystem. Journal of Animal Ecology. 2006;75:666–676. doi: 10.1111/J.1365-2656.2006.01087.X. [DOI] [PubMed] [Google Scholar]
  • Heithaus et al. (2007).Heithaus MR, Wirsing AJ, Dill LM, Heithaus LI. Long-term movements of tiger sharks satellite-tagged in Shark Bay, Western Australia. Marine Biology. 2007;151:1455–1461. doi: 10.1007/S00227-006-0583-Y. [DOI] [Google Scholar]
  • Holland et al. (1999).Holland KN, Wetherbee BM, Lowe CG, Meyer CG. Movements of tiger sharks (Galeocerdo cuvier) in coastal Hawaiian waters. Marine Biology. 1999;134:665–673. doi: 10.1007/S002270050582. [DOI] [Google Scholar]
  • Kneebone et al. (2008).Kneebone J, Natanson LJ, Andrews AH, Howell WH. Using bomb radiocarbon analyses to validate age and growth estimates for the tiger shark, Galeocerdo cuvier, in the western North Atlantic. Marine Biology. 2008;154:423–434. doi: 10.1007/S00227-008-0934-Y. [DOI] [Google Scholar]
  • Lea et al. (2015).Lea JSE, Wetherbee BM, Queiroz N, Burnie N, Aming C, Sousa LL, Mucientes GR, Humphries NE, Harvey GM, Sims DW, Shivji MS. Repeated, long-distance migrations by a philopatric predator targeting highly contrasting ecosystems. Scientific Reports. 2015;5 doi: 10.1038/srep11202. Article 11202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • Librado & Rozas (2009).Librado P, Rozas J. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics. 2009;25:1451–1452. doi: 10.1093/Bioinformatics/Btp187. [DOI] [PubMed] [Google Scholar]
  • Lowe et al. (1996).Lowe CG, Wetherbee BM, Crow GL, Tester AL. Ontogenetic dietary shifts and feeding behavior of the tiger shark, Galeocerdo cuvier, in Hawaiian waters. Environmental Biology of Fishes. 1996;47:203–211. doi: 10.1007/Bf00005044. [DOI] [Google Scholar]
  • Malausa et al. (2011).Malausa T, Gilles A, Meglecz E, Blanquart H, Duthoy S, Costedoat C, Dubut V, Pech N, Castagnone-Sereno P, Delye C, Feau N, Frey P, Gauthier P, Guillemaud T, Hazard L, Le Corre V, Lung-Escarmant B, Male PJG, Ferreira S, Martin JF. High-throughput microsatellite isolation through 454 GS-FLX Titanium pyrosequencing of enriched DNA libraries. Molecular Ecology Resources. 2011;11:638–644. doi: 10.1111/J.1755-0998.2011.02992.X. [DOI] [PubMed] [Google Scholar]
  • Meglecz et al. (2010).Meglecz E, Costedoat C, Dubut V, Gilles A, Malausa T, Pech N, Martin JF. QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics. 2010;26:403–404. doi: 10.1093/Bioinformatics/Btp670. [DOI] [PubMed] [Google Scholar]
  • Meyer, Papastamatiou & Holland (2010).Meyer CG, Papastamatiou YP, Holland KN. A multiple instrument approach to quantifying the movement patterns and habitat use of tiger (Galeocerdo cuvier) and Galapagos sharks (Carcharhinus galapagensis) at French Frigate Shoals, Hawaii. Marine Biology. 2010;157:1857–1868. doi: 10.1007/S00227-010-1457-X. [DOI] [Google Scholar]
  • Natanson et al. (1999).Natanson LJ, Casey JG, Kohler NE, Colket T. Growth of the tiger shark, Galeocerdo cuvier, in the western North Atlantic based on tag returns and length frequencies; and a note on the effects of tagging. Fishery Bulletin. 1999;97:944–953. [Google Scholar]
  • Papastamatiou et al. (2013).Papastamatiou YP, Meyer CG, Carvalho F, Dale JJ, Hutchinson MR, Holland KN. Telemetry and random-walk models reveal complex patterns of partial migration in a large marine predator. Ecology. 2013;94:2595–2606. doi: 10.1890/12-2014.1. [DOI] [PubMed] [Google Scholar]
  • Pirog et al. (2015).Pirog A, Blaison A, Jaquemet S, Soria M, Magalon H. Isolation and characterization of 20 microsatellite markers from Carcharhinus leucas (bull shark) and cross-amplification in Galeocerdo cuvier (tiger shark), Carcharhinus obscurus (dusky shark) and Carcharhinus plumbeus (sandbar shark) Conservation Genetics Resources. 2015;7:121–124. doi: 10.1007/s12686-014-0308-3. [DOI] [Google Scholar]
  • Randall (1992).Randall JE. Review of the biology of the tiger shark (Galeocerdo cuvier) Australian Journal of Marine and Freshwater Research. 1992;43:21–31. doi: 10.1071/MF9920021. [DOI] [Google Scholar]
  • Rooney et al. (2006).Rooney N, McCann KS, Gellner G, Moore JC. Structural asymmetry and the stability of diverse food webs. Nature. 2006;442:265–269. doi: 10.1038/nature04887. [DOI] [PubMed] [Google Scholar]
  • Rozen & Skaletsky (2000).Rozen S, Skaletsky H. Primer 3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology. 2000;132:365–386. doi: 10.1385/1-59259-192-2:365. [DOI] [PubMed] [Google Scholar]
  • Simpfendorfer (2009).Simpfendorfer CA. The IUCN Red List of Threatened Species. Version 2015.1. Gland: IUCN; 2009. Galeocerdo cuvier. (accessed 12 January 2015) [Google Scholar]
  • Simpfendorfer, Goodreid & McAuley (2001).Simpfendorfer CA, Goodreid AB, McAuley RB. Size, sex and geographic variation in the diet of the tiger shark, Galeocerdo cuvier, from Western Australian waters. Environmental Biology of Fishes. 2001;61:37–46. doi: 10.1023/A:1011021710183. [DOI] [Google Scholar]
  • Van Oosterhout et al. (2004).Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P. MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes. 2004;4:535–538. doi: 10.1111/j.1471-8286.2004.00684.x. [DOI] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data S1. Dataset.

Microsatellite data and sequences of the control region for individuals studied. (−) indicates no data

DOI: 10.7717/peerj.2041/supp-1

Data Availability Statement

The following information was supplied regarding data availability:

The raw data has been supplied as Data S1.


Articles from PeerJ are provided here courtesy of PeerJ, Inc

RESOURCES