Abstract
Di-(2-ethylhexyl) phthalate (DEHP) has the potential to disrupt the thyroid endocrine system, but the underlying mechanism is unknown. In this study, zebrafish (Danio rerio) embryos were exposed to different concentrations of DEHP (0, 40, 100, 200, 400 μg/L) from 2 to 168 hours post fertilization (hpf). Thyroid hormones (THs) levels and transcriptional profiling of key genes related to hypothalamus-pituitary-thyroid (HPT) axis were examined. The result of whole-body thyroxine (T4) and triiodothyronine (T3) indicated that the thyroid hormone homeostasis was disrupted by DEHP in the zebrafish larvae. After exposure to DEHP, the mRNA expressions of thyroid stimulating hormone (tshβ) and corticotrophin releasing hormone (crh) genes were increased in a concentration dependent manner, respectively. The expression level of genes involved in thyroid development (nkx2.1 and pax8) and thyroid synthesis (sodium/iodide symporter, nis, thyroglobulin, tg) were also measured. The transcripts of nkx2.1 and tg were significantly increased after DEHP exposure, while those of nis and pax8 had no significant change. Down-regulation of uridinediphosphate-glucuronosyl-transferase (ugt1ab) and up-regulation of thyronine deiodinase (dio2) might change the THs levels. In addition, the transcript of transthyretin (ttr) was up-regulated, while the mRNA levels of thyroid hormone receptors (trα and trβ) remained unchanged. All the results demonstrated that exposure to DEHP altered the whole-body thyroid hormones in the zebrafish larvae and changed the expression profiling of key genes related to HPT axis, proving that DEHP induced the thyroid endocrine toxicity and potentially affected the synthesis, regulation and action of thyroid hormones.
Introduction
Phthalates acid esters (PAEs) as plasticizers are wildly used in different kinds of plastic products, such as food contact materials, blood bags, toys, clothing, adhesives, plastic coating, lubricants, cosmetics and electronics, etc. PAEs have been detected in air, soil and water, and caused serious problems to the wild animals and human beings. Among the PAEs family, di-(2-ethylhexyl) phthalate (DEHP) is the most extensively used PAEs, accounting for approximately 50% of total plasticizer production [1, 2]. Due to wide usage and constant release into the environment, DEHP exists in rivers, lakes and running water at different concentration levels [3, 4]. In Germany, the concentration of DEHP in water systems was found as high as 98 μg/L, even higher to 247 μg/L in the drinking water in Croatia [5–7]. In China, previous studies reported that the concentrations of DEHP in surface waters ranged from 5 μg/L to 76 μg/L, and in Wuhan section of the Yangtze River from 3.9 μg/L to 55 μg/L [8–10]. Studies showed that DEHP released into environment can cause severe health risks [11, 12], but its developmental risks on water system organisms are still elusive.
Phthalate esters can cause endocrine disruptions in organisms by interfering with reproduction and the thyroid hormone (TH) systems [13–15]. Previous studies proved that DEHP can impair reproduction system by affecting critical factors in oogenesis and spermatogenesis in zebrafish, and disrupt the endocrine of sex hormones in Chinese rare minnow [16–18]. Moreover, DEHP could cause a risk to human health by disrupting reproductive system [19, 20]. Recent studies showed that DEHP, as an endocrine disruptor, can disturb the thyroid hormone homeostasis. Chen et al. proved that DEHP/Mono-(2-ethylhexyl) phthalate (MEHP) disturbed the body’s hormone stability and posed a serious threat to animal development [21]. Wang et al. reported that the accumulation of DEHP caused endocrine disruption in medaka embryos [22]. Zhai et al. showed that MEHP, the hydrolytic metabolite of the DEHP, induced the thyroid endocrine disruption during zebrafish embryos development [23]. However, as one of the most used plasticizers that directly released into the environment, especially into the water systems, the toxicity of DEHP to aquatic organism was seldom reported and should arise our high attention.
Thyroid hormones (THs) play important roles in the processes of differentiation, growth, metabolism, development, growth, and reproduction physiologic actions in fish [24]. The thyroid endocrine system is controlled by hypothalamus–pituitary–thyroid axis (HPT), which is responsible for the thyroid hormone synthesis, secretion, transport and metabolism [25]. In mammals, the hypothalamus secretes the thyrotropin-releasing hormone (TRH), which stimulates the secretion of thyroid-stimulating hormone (TSH) and regulates THs synthesis in HPT axis. While in amphibians and teleosts, the secretion of TSH is stimulated by corticotrophin-releasing hormone (CRH) [26]. In teleosts, THs in plasma can bind to THs transport transthyretin (TTR), and only the free ones enter into target cells to launch a response [27]. Endocrine disrupting chemicals (EDCs) can disrupt the thyroid hormone stability and HPT axis in fish by altering hormone levels, enzyme activities and the expression of genes. Those alterations can be credibly used to evaluate the chemicals effect on the thyroid endocrine disruption [28, 29]. However, the underlying mechanisms of DEHP toxicity on thyroid endocrine system in fish is still not completely clarified.
Zebrafish are widely used in the toxicological researches because of its small size, easy culture, high reproductive performance, rapid organogenesis and sensitivity to the harmful chemicals [30]. Moreover, the thyroid system in zebrafish is similar to mammalian, which can provide a valuable reference for human beings [31]. Therefore, in the present study, zebrafish were used to reveal the mechanisms of the HPT axis disturbance after exposure to DEHP.
Methods and Materials
Ethics statement
The animal protocol for this study was approved by the Animal Care and Use Committee of Chongqing in China and by the Institutional Animal Care and Use Committee of Chongqing Institute of Green and Intelligent Technology, Chinese Academy of Sciences (Approval ID: ZKCQY0063).
Chemicals
DEHP (No: ALR-097N, 99.6%) was purchased from AccuStandard (New Haven, CT, USA) and dissolved in dimethyl sulfoxide (DMSO, CAS: 67-68-5, purity≥99.5%, Sigma-Aldrich, USA). Then the DEHP stock solution A (8×107 μg/L) and B (8×106 μg/L) was stored at 4°C. 3-Aminobenzoic acid ethyl ester or methane-sulfonate salt (MS-222, CAS: 886-86-2, 98%) was obtained from Aladdin (Los Angeles, California, USA), which was used as an anesthetic to treat zebrafish larvae before sampling. All other chemicals used in the present study were of the analytical grade.
Zebrafish maintenance and embryos exposure to DEHP
Wild-type strains of zebrafish (AB) were maintained in a flow-through system at a constant temperature (28°C) and 14:10 (light: dark) photoperiod. Zebrafish were fed three times every day with the newly hatched brine shrimp (Artemia nauplii). Normal adult zebrafish were placed in the breeding box with a ratio of 2:1 (male: female) overnight. Spawning was triggered under light and was completed within 30 min. Then embryos were collected and examined under the stereomicroscope at 2 hours post fertilization (hpf). Embryos developing normally at blastula stage were selected for the subsequent experiments. Two hundred and fifty embryos were randomly distributed into each glass beakers containing 50 mL of DEHP exposure solution (0, 40, 100, 200 and 400 μg/L). There were three replicates for each group, and the exposure concentrations were previously confirmed by a dose-ranging study based on the environmental pollutant concentration. During the experimental process, the zebrafish embryos and larvae were maintained in a biochemical incubator with 28°C and 14:10 (light: dark) condition, and the exposure solutions were renewed daily. The details for preparation of DEHP buffers was shown in S1 Table. After exposure to different concentrations of DEHP until 168 hpf, the larvae were washed with UltraPure water and anesthetized in 50 mg/L of MS-222 for random sampling. Then, the samples were immediately frozen into liquid nitrogen, and stored at -80°C for the subsequent analysis of gene expression and TH assay.
Developmental toxicity
During DEHP exposure, the hatching rate of embryos at 72 hpf was calculated. The larvae developmental parameters for body weight, body length, survival rate and malformation rate at 168 hpf were also recorded. The body length of larvae was measured along the head-to-tail axis under a stereomicroscope.
Total RNA isolation and quantitative RT-PCR analysis
Total RNA were extracted from 30 zebrafish larvae by using RNAiso Plus reagent (Takara Bio Inc., Shiga, Japan) according to the manufacturer’s instructions. Then, the purity and quality of the total RNA were measured by using a spectrophotometer and 1% agarose-formaldehyde gel electrophoresis with ethidium bromide staining. The synthesis of cDNA was performed with 1 μg total RNA for each sample by using the Primer Script RT Reagent Kit (Takara Bio, Shiga, Japan) according to the manufacturer’s instructions. Quantitative real-time PCR (qRT-PCR) was performed by using the SYBR Green PCR Kit (Toyobo, Tokyo, Japan) on the ABI 7300 System (PerkinElmer Applied Biosystems, Foster City, CA, USA). The primers of the selected genes were designed by using the online Primer 3 program (http://frodo.wi.mit.edu/) and their sequences were listed in Table 1. The PCR reaction was comprised of an initial denaturation step at 95°C for 3 min, followed by 40 cycles at 95°C for 20 s, 58°C for 20 s, 72°C for 45 s. The dissociation curve used to check the specificity of PCR production was acquired by adding a step of 95°C for 15 s, 60°C for 1 min, 95°C for 15 s at the end of the amplification phase. Ribosomal protein L8 (rpl8) was chosen as the internal control according to the stability result of five candidate reference genes (S1 Fig). The expression levels of target genes were normalized to rpl8 by using 2−ΔΔCT method.
Table 1. Primers used for qRT-PCR in this study.
Gene name | GenBank accession No. | Primer sequence (5’-3’) | Product length (bp) |
---|---|---|---|
rpl8 | NM 200713.1 | F: TTGTTGGTGTTGTTGCTGGT; R: GGATGCTCAACAGGGTTCAT | 116 |
crh | NM 001007379.1 | F: TTCGGGAAGTAACCACAAGC; R: CTGCACTCTATTCGCCTTCC | 141 |
tshβ | NM 181494.2 | F: GCAGATCCTCACTTCACCTACC; R: GCACAGGTTTGGAGCATCTCA | 100 |
nts | NM 001089391.1 | F: GGTGGCATGAAGGCTGTAAT; R: GATACGGCATCCATTGTTGG | 124 |
tg | XM 689200.5 | F: CCAGCCGAAAGGATAGAGTTG; R: ATGCTGCCGTGGAATAGGA | 157 |
nkx2.1 | NM 131589.1 | F: AGGACGGTAAACCGTGTCAG; R: CACCATGCTGCTCGTGTACT | 168 |
pax8 | AF 072549.1 | F: GAAGATCGCGGAGTACAAGC; R: CTGCACTTTAGTGCGGATGA | 122 |
dio1 | AY 221259.1 | F: GTTCAAACAGCTTGTCAAGGACT; R: AGCAAGCCTCTCCTCCAAGTT | 121 |
dio2 | NM 212789.3 | F: GCATAGGCAGTCGCTCATTT; R: TGTGGTCTCTCATCCAACCA | 83 |
ugt1ab | NM 2213422.2 | F: CCACCAAGTCTTTCCGTGTT; R: GCAGTCCTTCACAGGCTTTC | 148 |
ttr | NM 001005598.2 | F: CGGGTGGAGTTTGACACTTT; R: GCTCAGAAGGAGAGCCAGTA | 110 |
trα | NM 131396.1 | F:CTATGAACAGCACATCCGACAAGAG; R: CACACCACACACGGCTCATC | 65 |
trβ | AF 302242.1 | F: TGGGAGATGATACGGGTTGT; R: ATAGGTGCCGATCCAATGTC | 90 |
The extraction and analysis of thyroid hormone
The method for extraction of whole-body thyroid hormone was modified from Yu et al [32]. Briefly, 200 zebrafish larvae were homogenized in 0.3 mL ELISA buffer using a homogenizer. Then samples were disrupted by intermittent sonic oscillation for 15 min on ice. Next, the samples were centrifuged at 5000 × g for 10 min at 4°C. The supernatants were collected and stored at -80°C for T3 and T4 assay by using enzyme-linked immunosorbent assay (ELISA) kit, which was purchased from Uscnlife (Wuhan, China). The detection limits of T3 and T4 for this kit were 45.5 pg/mL and 1.5 ng/mL, respectively.
Statistical analysis
The normality and homogeneity of variances were analyzed by Kolmogorov-Smirnov test and Leven’s test, respectively. Logarithmic transformation was performed for homogeneity of variance, if the data failed the Kolmogorov-Smirnov test. One-way analysis of variance (ANOVA) was applied to calculate the differences between the control and exposure groups followed by Dunnet test using SPSS 20.0 software (SPSS, Chicago, IL, USA). A value of p<0.05 was considered as statistically significant. All values were expressed as the means ± standard error (SEM).
Results
Developmental toxicity
Compared with the control groups, there were no significant developmental toxicity on zebrafish larvae at 168 hpf after exposure to DEHP (S2 Table). The parameters of hatching, growth, malformation and survival rate, body length and weight were shown in Table 2.
Table 2. Development index of zebrafish larvae after exposure to DEHP (0, 40, 100, 200, 400 μg/L) for 168 hpfa.
DEHP (μg/L) | 0 | 40 | 100 | 200 | 400 |
---|---|---|---|---|---|
Hatching (%) | 92.67±1.76 | 90.00±1.33 | 89.78±1.35 | 92.22±2.19 | 91.11±0.44 |
Survival (%) | 91.33±2.40 | 86.00±1.33 | 84.22±2.32 | 89.56±1.94 | 90.00±0.77 |
Malformation (%) | 0.32±0.32 | 1.70±0.70 | 1.40±0.41 | 0.67±0.67 | 1.31±0.32 |
Weight (mg) | 0.36±0.01 | 0.35±0.01 | 0.32±0.02 | 0.37±0.01 | 0.35±0.01 |
Length (mm) | 3.29±0.02 | 3.41±0.07 | 2.99±0.05 | 2.99±0.13 | 3.05±0.16 |
aThe values are the mean ± standard error (SEM) of six replicate groups.
The assay of whole-body T4 and T3
DEHP exposure increased the whole-body T4 and T3 contents in zebrafish larvae at the 400 μg/L concentration groups (p < 0.05) by 35.3% and 56.6%, respectively (Fig 1A and 1B). While the ratio of T4/T3 was dropped at the highest exposure groups without significant change, compared to the control (Fig 1C).
Fig 1. The whole-body levels of thyroid hormone T4 (A), T3 (B) and the T4/T3 (C) of zebrafish larvae at 168 hpf were determined after exposure to 0, 40, 100, 200, 400 μg/L of DEHP.
The results were means ± SEM of three replicate samples. *P < 0.05 indicated significant difference between exposure groups and the control groups.
mRNA expression profiles
The gene expression of tshβ in zebrafish at 168 hpf stage was significantly up-regulated by 2.02, 2.11 and 2.84 folds, respectively, after exposure to 100, 200 and 400 μg/L of DEHP (Fig 2A). Compared to the control groups, the transcriptional level of the gene crh was significantly up-regulated by 4.27 and 5.48 folds, when exposed to 200 and 400 μg/L of DEHP, respectively (Fig 2B). The transcripts of nis were down-regulated, but had no significant change relative to the control (Fig 2C).
Fig 2. The expressions of tshβ (A) and crh (B) and nis (C) of zebrafish larvae were detected by real-time PCR after exposure to 0, 40, 100, 200, 400 μg/L of DEHP at 168 hpf.
The results were means ± SEM of three replicate samples. Significant difference between exposure groups and the control groups was indicated by *P < 0.05 and **P < 0.01.
After exposure to 200 and 400 μg/L of DEHP, the transcriptional level of nkx2.1 was significantly up-regulated by 3.62 and 4.52 folds compared to the control, respectively (Fig 3A). While pax8 has no significant difference between the exposure and control groups (Fig 3B). In the 400 μg/L exposure groups, tg transcripts were significantly increased by 1.55 folds, but lower DEHP exposure caused no significant change (Fig 3C).
Fig 3. The expressions of nkx2.1 (A) and pax8 (B) and tg (C) were measured by real-time PCR after exposure to 0, 40, 100, 200, 400 μg/L of DEHP at 168 hpf in zebrafish larvae.
The results were means ± SEM of three replicate samples. Significant difference between exposure groups and the control groups was indicated by *P < 0.05 and **P < 0.01 and ***P<0.001.
The mRNA level of ugt1ab involved in TH metabolism was significantly down-regulated by 1.68 folds after exposure to 400 μg/L of DEHP (Fig 4A). The two isoforms of deiodinases (Dio1 and Dio2) in zebrafish were checked. The expression of dio1 had no significant differences (Fig 4B), while the dio2 was increased significantly by 2.13 folds after exposure to 400 μg/L of DEHP (Fig 4C).
Fig 4. The expressions of ugt1ab (A) and dio1 (B) and dio2 (C) were checked by real-time PCR after exposure to 0, 40, 100, 200, 400 μg/L of DEHP at 168 hpf in zebrafish larvae.
The results were means ± SEM of three replicate samples. Significant difference between exposure groups and the control groups was indicated by *P < 0.05 and **P < 0.01.
In this study, ttr transcripts were up-regulated significantly by 8.81 and 11.17 folds with a dose-dependent manner in 200 and 400 μg/L of DEHP exposure groups, respectively (Fig 5A). However, the expressions of thyroid hormone nuclear receptors isoforms, trα and trβ showed no significant change at 168 hpf stage in zebrafish after exposure to 0, 40, 100, 200, 400 μg/L of DEHP, respectively (Fig 5B and 5C).
Fig 5. The expression change of ttr (A) and trα (B) and trβ (C) were measured by real-time PCR, after exposure to 0, 40, 100, 200, 400 μg/L of DEHP at 168 hpf in zebrafish larvae.
The results were means ± SEM of three replicate samples. Significant difference between exposure groups and the control groups was indicated by *P < 0.05 and **P < 0.01 and ***P<0.001.
Discussion
The pollutants of PAEs family become the major global concerns because of their harmful effects on human in the surrounding environment. DEHP, the most common member of the class of phthalates, was widely used as plasticizers. DEHP has been reported to be a xenoestrogen to disrupt the organism’s endocrine stability. It is important to investigate the molecular toxicology of DEHP because of its high concentration found in the environment. In this study, we used zebrafish embryos and larvae as the model to evaluate the mechanism of thyroid endocrine disruption caused by DEHP. After exposure to DEHP, the whole-body thyroid hormones levels and the mRNA expression of key genes related to HPT axis were systematically investigated. The results showed that DEHP changed the THs levels and genes expression of HPT axis, suggesting the disturbance effects of DEHP in zebrafish embryos/larvae.
It has been reported that the pituitary gland secreted TSH to regulate the thyroid function, and the TSH secretion could be stimulated by CRH, which might function as a regulator of the HPT axis during larvae development in fish [26, 33, 34]. Thus, TSH assay can be used to detect the functional integrity of the pituitary and thyroid gland, and explain the mechanism of chemical disruption of thyroid function [35]. In this study, we found that the transcripts of crh and tshβ gene were significantly up-regulated after DEHP exposure, indicating that DEHP activated the HPT axis. Interestingly, in the highest exposure groups, the T4 level was also increased. A previous report on zebrafish larvae also showed that chemical exposure could up-regulate the transcription level of tshβ accompanying induction of T4 [36]. However, increasing expressions of tshβ and decreasing contents of T4 in zebrafish larvae were also reported in other studies, which was involved in negative feedback mechanism [23, 37]. Since TSH could initiate TH synthesis and release from the thyroid gland, we speculated that both up-regulation of tsh and crh triggered the increase of whole-body T4 level in the zebrafish larvae.
It was reported that Pax8 protein is required for the late differentiation of the follicular cells, and the transcription factor Nkx2.1 plays an essential role in thyroid development in fish [38]. Previous studies demonstrated that nis and tg are involved in TH synthesis, and nkx2.1 is the main factor to regulate the expressions of nis and tg in the thyroid system [39, 40]. Here, we observed that exposure to DEHP significantly increased nkx2.1 and tg transcription in the highest exposure groups. Zhai et al. also reported that the transcription of nkx2.1 was significantly up-regulated by the increased expression of tg [23]. In our study, we speculated that the up-regulation levels of nkx2.1 might promote the increased tg expression, which contributed to T4 induction.
As the major transport protein of THs, TTR plays an important role in the thyroid axis in fish [27]. Chemicals interfering with the TH binding ability to TTR may directly affect the concentration of free THs and its clearance rate in fish. The combined T4 would make it more stable to hepatic catabolism, resulting in a lesser clearance and an increased circulating TH [41, 42]. Moreover, previous studies showed that down-regulation of ttr gene expression was related to the reduction of T4 levels [23, 32]. In this study, the ttr mRNA level increased significantly after exposure to relatively higher concentrations of DEHP (200 μg/L and 400 μg/L), indicating that DEHP posed a potential risk to thyroid functions by affecting the binding and transporting ability of THs. In fish HPT axis, the biological activities of THs are primarily connected with genes binding to thyroid hormone receptors (TRs) [43]. Liu et al. reported that TRs acted as an inducible ligand-activated transcription factors and could affect the development of embryos [44]. In this study, exposure to DEHP did not alter TRs expression and also showed no significant effects on the development of zebrafish larvae, which was consistent with the previous reports [32, 45].
In fish, three types of deiodinases enzymes (Dio1, Dio2 and Dio3) play important roles in the regulation of TH levels. Studies proved that Dio1 had minimal effect on plasma TH homeostasis, but a major influence on iodine recovery and TH degradation. While Dio2 catalyzed the primary thyroxine (T4, a pro-hormone secreted from the thyroid follicles) and converted it to biological active triiodothyronine (T3) in the peripheral tissues [46, 47]. Previous study demonstrated that Dio2 played a critical role in T3 production at the early embryonic stages in zebrafish and increased the T3 availability [48]. It was also observed that the up-regulation of dio2 was related to the increase of T3 contents, when zebrafish larvae were exposed to other chemicals [23, 49]. In this study, the expression of dio2 was increased significantly after DEHP exposure at 400 μg/L, which may be partially responsible for the increase of the T3 content and the decline of T4/T3 ratio. The findings of increased dio2 and T3 levels demonstrated that DEHP as the environment endocrine disrupting chemicals (EDCs) altered dio2 expression and THs content via HPT axis in the zebrafish larvae.
It was reported that UGT (uridinedipgosphate glucoronosyltransferases) played important role in TH homeostasis by the T4 conjugation pathway [50]. Other studies proved that the decrease of T4 levels was accompanied with the increased ugt1ab expression after exposure to different pollutants [23, 32, 49]. In this study, it was observed that the gene expression of ugt1ab was down-regulated at 400 μg/L when exposed to DEHP. Thus, we supposed that the decrease of ugt1ab may be another reason for the increasing of T4 concentration in the zebrafish larvae.
THs were reported to be crucial for development, growth, differentiation and metabolism at early embryonic stages in zebrafish, especially for embryo to larval transitory phase and larval to juvenile transition phase [44, 51, 52]. Both lower concentrations of THs and excessive doses of THs might cause fish growth retardation [53, 54]. Fish larvae at early stages are more sensitive to toxic chemicals than adults because of the roles of thyroid hormones [55]. Hence, thyroid disruption can be used to reveal the toxicity of chemicals. In this study, the levels of whole-body T4 and T3 concentration were significantly up-regulated when exposed to two higher concentration of DEHP (200 μg/L and 400 μg/L), but there was no significant change for the developmental indexes, which was similar to a previous work on MEHP toxicity [23]. Reported studies indicated that 14 days or 15 days exposure to DE-71 or PFOS, respectively, in zebrafish larvae caused developmental toxicity [32, 45]. Thus, we speculate that a longer exposure to DEHP may cause the developmental toxicity in zebrafish larvae and more studies should be performed to check the chronic effects of DEHP on HPT axis.
In conclusion, this study showed that exposure to DEHP altered the whole-body THs levels and the expression of HPT axis related genes, proving the DEHP toxicity on thyroid endocrine in zebrafish larvae. This study revealed the possible mechanisms of DEHP disturbance on thyroid development. Due to DEHP as well as other PAEs is continually released into the natural environment, the potential risks caused by chronic exposure to PAEs on wild animals and human beings should be paid special attention.
Supporting Information
Pairwise variation analysis between the normalization factors NFn and NFn+1 was used to determine the optimal number of control genes for normalization.
(DOCX)
(DOCX)
(DOCX)
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
The authors are grateful for support from the Hundred Talents Program of Chinese Academy of Sciences (to D.S.P.), the West Light PhD Foundation of the Chinese Academy of Sciences (to Y.B.M.), the Key Application and Development Program of Chongqing Science and Technology Commission (Grant No. cstc2014yykfC20004 and cstc2014yykfC20002 to D.S.P.), the National Natural Science Foundation of China (Grant No. 21407146 to Y.B.M.), the Application and Development Program of Science and Technology Commission of Beibei District, Chongqing (2015-07 to D.S.P.), the Scientific Research Starting Foundation for Returned Overseas Chinese Scholars from Ministry of Education (to D.S.P.), and the National Technology Foundation for Selected Overseas Chinese Scholar of Chongqing Human Resources and Social Security Bureau, China (to D.S.P.).
References
- 1.Lyche JL, Gutleb AC, Berqman A, Eriksen GS, Murk AJ, Ropstad E, et al. Reproductive and developmental toxicity of phthalates. J Toxicol Environ B Crit Rev. 2009, 12(4):225–49. [DOI] [PubMed] [Google Scholar]
- 2.Rudel RA, Perovich LJ. Endocrine disrupting chemicals in indoor and outdoor air. Atoms Environ. 2009, 43(1):170–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Horn O, Nalli S, Cooper D, Nicell J. Plasticizer metabolites in the environment. Water Res. 2004, 38(17):3693–8. [DOI] [PubMed] [Google Scholar]
- 4.Mathieu-Denoncourt J, Wallace SJ, de Solla SR, Langlois VS. Plasticizer endocrine disruption: Highlighting developmental and reproductive effects in mammals and non-mammalian aquatic species. Gen Comp Endocrinol. 2015, 219:74–88. 10.1016/j.ygcen.2014.11.003 [DOI] [PubMed] [Google Scholar]
- 5.Oehlmann J, Oetken M, Schulte-Oehlmann U. A critical evaluation of the environment risk assessment for platicizers in the freshwater environment in Europe, with special emphasis on bisphenol A and endocrine disruption. Environ Res. 2008, 108(2):140–9. [DOI] [PubMed] [Google Scholar]
- 6.Maqdouli S, Daqhrir R, Brar SK, Drogui P, Tyagi RD. Di 2-ethylhexylphthalates in the aquatic and terrestrial environment: a critical review. J Environ Manage. 2013, 127:36–49. 10.1016/j.jenvman.2013.04.013 [DOI] [PubMed] [Google Scholar]
- 7.Huerta-Fontela M, Ventura F. Traceability of emerging contaminants from wastewater to drinking water. Hdb Env Chem Vol. 2008, 5:143–168. [Google Scholar]
- 8.Wu P, Han G, Wang H. An investigation on phthalates in drinking water. J Environ Health. 1999, 16:338–9.[in Chinese]. [Google Scholar]
- 9.Zeng F, Cui K, Xie Z, Liu M, Li Y, Lin Y, et al. Occurrence of phthalate esters in water and sediment of urban lakes in a subtropical city, Guangzhou, South China. Environ Int. 2008, 34(3):372–80. [DOI] [PubMed] [Google Scholar]
- 10.Wang F, Xia X, Sha Y. Distribution of phthalic acid esters in Wuhan section of the Yangtze River, China. J Harzard Mater. 2008, 154(1–3):317–24. [DOI] [PubMed] [Google Scholar]
- 11.Erythropel HC, Maric M, Nicell JA, Leask RL, Yargeau V. Leaching of the plasticizer di(2-ethylhexyl)phthalate (DEHP) from plastic containers and the question of human exposure. Appl Microbiol Biotechnol. 2014, 98(24):9967–81. 10.1007/s00253-014-6183-8 [DOI] [PubMed] [Google Scholar]
- 12.Chao KP, Huang CS, Wei CY. Health risk assessments of DEHP released from chemical protective gloves. J Hazard Mater. 2015, 283:53–9. 10.1016/j.jhazmat.2014.09.010 [DOI] [PubMed] [Google Scholar]
- 13.Ghisari M, Bonefeld-Jorgensen EC. Effects of plasticizers and their mixture on estrogen receptor and thyroid hormone functions. Toxicol Lett. 2009, 189(1):67–77. 10.1016/j.toxlet.2009.05.004 [DOI] [PubMed] [Google Scholar]
- 14.Weir SM, Wooten KJ, Smith PN, Salice CJ. Phthalate ester leachates in aquatic mesocosms: implications for ecotoxicity studies of endocrine disrupting compounds. Chemosphere. 2014, 103:44–50. 10.1016/j.chemosphere.2013.10.097 [DOI] [PubMed] [Google Scholar]
- 15.Oehlmann J, Schulte-Oehlmann U, Kloas W, Jagnytsch O, Lutz I, Kusk KO, et al. A critical analysis of the biological impacts of plasticizers on wildlife. Philos Trans R Soc Lond B Biol Sci. 2009, 364(1526):2047–62. 10.1098/rstb.2008.0242 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Carnevali O, Tosti L, Speciale C, Peng C, Zhu Y, Maradonna F. DEHP impairs zebrafish reproduction by affecting critical factors in oogenesis. PLoS One. 2010, 5(4):e10201 10.1371/journal.pone.0010201 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Corradetti B, Stronati A, Tosti L, Manicardi G, Carnevali O, Bizzaro D. Bis-(2-ethylexhyl) phthalate impairs spermatogenesis in zebrafish (Danio rerio). Reprod Biol. 2013, 13(3):195–202. 10.1016/j.repbio.2013.07.003 [DOI] [PubMed] [Google Scholar]
- 18.Guo Y, Yang Y, Gao Y, Wang X, Zhou B. The impact of long term exposure to phthalic acid esters on reproduction in Chinese rare minnow (Gobiocypris rarus). Environ Pollut. 2015, 203:130–6. 10.1016/j.envpol.2015.04.005 [DOI] [PubMed] [Google Scholar]
- 19.Matsumoto M, Hirata-Koizumi M, Ema M. Potential adverse effects of phthalic acid esters on human health: a review of recent studies on reproduction. Requal Toxicol Pharmacol. 2008, 50(1):37–49. [DOI] [PubMed] [Google Scholar]
- 20.Ji Y, Wang F, Zhang L, Shan C, Bai Z, Sun Z, et al. A comprehensive assessment of human exposure to phthalates from environment media and food in Tianjin, China. J Hazard Mater. 2014, 279:133–40. 10.1016/j.jhazmat.2014.06.055 [DOI] [PubMed] [Google Scholar]
- 21.Chen X, Xu S, Tan T, Lee ST, Cheng SH, Lee FW, et al. Toxicity and estrogenic endocrine disrupting activity of phthalates and their mixtures. Int J Environ Res Public Health. 2014, 11(3):3156–68. 10.3390/ijerph110303156 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Ye T, Kang M, Huang Q, Fang C, Chen Y, Liu L. Accumulation of di(2-ethylhexyl) phthalate causes endocrine-disruptive effects in marine medaka (Oryzias melastigma) embryos. Environ Toxicol. 2014, 10.1002/tox.22028 [DOI] [PubMed] [Google Scholar]
- 23.Zhai W, Huang Z, Chen L, Feng C, Li B, Li T. Thyroid endocrine disruption in zebrafish larvae after exposure to mono-(2-ethylhexyl) phthalate(MEHP). PLoS One. 2014, 9(3):e92465 10.1371/journal.pone.0092465 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Blanton ML, Specker JL. The hypothalamic-pituitary-thyroid (HPT) axis in fish and its role in fish development and reproduction. Crit Rev Toxicol. 2007, 37(1–2):97–115. [DOI] [PubMed] [Google Scholar]
- 25.Fliers E, Kalsbeek A, Boelen A. Beyond the fixed setpoint of the hypothalamus-pituitary-thyroid axis. Eur J Endocrinol. 2014, 171(5):R197–208. 10.1530/EJE-14-0285 [DOI] [PubMed] [Google Scholar]
- 26.De Groef B, Van der Geyten S, Darras VM, Kühn ER. Role of corticotrophin releasing hormones as a thyrotropin-releasing factor in non-mammalian vertebrates. Gen Comp Endocrinol. 2006, 146(1):62–68. [DOI] [PubMed] [Google Scholar]
- 27.Power DM, Elias NP, Richardson SJ, Mendes J, Soares CM, Stantos CR. Evolution of the thyroid hormone-binding protein, transthyretin. Gen Comp Endocrinol. 2000, 119(3):241–55. [DOI] [PubMed] [Google Scholar]
- 28.Sun HJ, Li HB, Xiang P, Zhang X, Ma LQ. Short-term exposure of arsenite disrupted thyroid endocrine system and altered gene transcription in the HPT axis in zebrafish. Environ Pollut. 2015, 205:145–52. 10.1016/j.envpol.2015.05.037 [DOI] [PubMed] [Google Scholar]
- 29.Wang Q, Liang K, Liu J, Yang L, Guo Y, Liu C, et al. Exposure of zebrafish embryos/larvae to TDCPP alters concentrations of thyroid hormones and transcription of genes involved in the hypothalamic-pituitary-thyroid axis. Aquat Toxicol. 2013, 126:207–13. 10.1016/j.aquatox.2012.11.009 [DOI] [PubMed] [Google Scholar]
- 30.Dai YJ, Jia YF, Chen N, Bian WP, Li QK, Ma YB, et al. Zebrafish as a model system to study toxicology. Environ Toxicol Chem. 2014, 33(1):11–7. 10.1002/etc.2406 [DOI] [PubMed] [Google Scholar]
- 31.Segner H. Zebrafish (Danio rerio) as a model organism for investigating endocrine disruption. Comp Biochem Physiol C Toxicol Pharmacol. 2009, 149(2):187–95. 10.1016/j.cbpc.2008.10.099 [DOI] [PubMed] [Google Scholar]
- 32.Yu L, Deng J, Shi X, Liu C, Yu K, Zhou B. Exposure to DE-71 alters thyroid hormone levels and gene transcription in the hypothalamic-pituitary-thyroid axis of zebrafish larvae. Aquat Toxicol. 2010, 97(3):226–33. 10.1016/j.aquatox.2009.10.022 [DOI] [PubMed] [Google Scholar]
- 33.Manchado M, Infante C, Asensio E, Planas JV, Cañavate JP. Thyroid hormones down-regulate thyrotropin beta subunit and thyroglobulin during metamorphosis in the flatfish Senegalese sole (Solea senegalensis Kaup). Gen Comp Endocrinol. 2008, 155(2):447–55. [DOI] [PubMed] [Google Scholar]
- 34.Chiamolera MI, Wondisford FE. Minireview: thyrotropin-releasing hormone and the thyroid hormone feedback mechanism. Endocrinology. 2009, 150(3):1091–6. 10.1210/en.2008-1795 [DOI] [PubMed] [Google Scholar]
- 35.Zoeller RT, Tyl RW, Tan SW. Current and potential rodent screens and tests for thyroid toxicants. Crit Rev Toxicol. 2007, 37(1–2):55–95. [DOI] [PubMed] [Google Scholar]
- 36.Liu S, Chang J, Zhao Y, Zhu G. Changes of thyroid hormone levels and related gene expression in zebrafish on early life stage exposure to triadimefon. Environ Toxcicol Pharmacol. 2011, 32(3):472–7. [DOI] [PubMed] [Google Scholar]
- 37.Yu L, Chen M, Liu Y, Gui W, Zhu G. Thyroid endocrine disruption in zebrafish larvae following exposure to hexaconazole and tebuconazole. Aquat Toxicol. 2013, 138–139:35–42. 10.1016/j.aquatox.2013.04.001 [DOI] [PubMed] [Google Scholar]
- 38.Wendl T, Lun K, Mione M, Favor J, Brand M, Wilson SW, et al. Pax2.1 is required for the development of thyroid follicles in zebrafish. Development. 2002, 129(15):3751–60. [DOI] [PubMed] [Google Scholar]
- 39.Porazzi P, Calebiro D, Benato F, Tiso N, Persani L. Thyroid gland development and function in the zebrafish model. Mol Cell Endocrinol. 2009, 312(1–2):14–23. 10.1016/j.mce.2009.05.011 [DOI] [PubMed] [Google Scholar]
- 40.Zoeller RT, Tan SW, Try RW. General background on the hypothalamic-pituitary-thyroid (HPT) axis. Crit Rev Toxicol. 2007, 37(1–2):11–53. [DOI] [PubMed] [Google Scholar]
- 41.Morgado I, Santos CR, Jacinto R, Power DM. Regulation of transthyretin by thyroid hormones in fish. Gen Comp Endocrinol. 2007, 152(2–3):189–97. [DOI] [PubMed] [Google Scholar]
- 42.Fernie KJ, Shutt JL, Mayne G, Hoffman D, Letcher RJ, Drouillard KG, et al. Exposure to polybrominated diphenyl ethers (PBDEs): changes in thyroid, vitamin A, glutathione homeostasis, and oxidative stress in American kestrels (Falco sparverius). Toxicol Sci. 2005, 88(2):375–83. [DOI] [PubMed] [Google Scholar]
- 43.Marchand O, Safi R, Escriva H, Van Rompaey E, Prunet P, Laudet V. Molecular cloning and characterization of thyroid hormone receptors in teleost fish. J Mol Endocrinol. 2001, 26(1):51–65. [DOI] [PubMed] [Google Scholar]
- 44.Liu YW, Chan WK. Thyroid hormones are important for embryonic to larval transitory phase in zebrafish. Differentiation. 2002, 70(1):36–45. [DOI] [PubMed] [Google Scholar]
- 45.Shi X, Liu C, Wu G, Zhou B. Waterborne exposure to PFOS causes disruption of the hypothalamus-pituitary-thyroid axis in zebrafish larvae. Chemophere. 2009, 77(7):1010–8. [DOI] [PubMed] [Google Scholar]
- 46.Orozco A, Valverde-R C. Thyroid hormone deiodination in fish. Thyroid. 2005, 15(8):799–813. [DOI] [PubMed] [Google Scholar]
- 47.Van der Geyten S, Toquyeni A, Baroiller JF, Fauconneau B, Fostier A, Sanders JP, et al. Hypothyroidism induces type I iodothyronine deiodinase expression in tilapia liver. Gen Comp Endocrinol, 2001, 124(3):333–42. [DOI] [PubMed] [Google Scholar]
- 48.Walpita CN, Crawford AD, Janssens ED, Van der Geyten S, Darras VM. Type 2 iodothyronine deiodinase is essential for thyroid hormone-dependent embryonic development and pigmentation in zebrafish. Endocrinology. 2009, 150(1):530–9. 10.1210/en.2008-0457 [DOI] [PubMed] [Google Scholar]
- 49.Chen Q, Yu L, Yang L, Zhou B. Bioconcentration and metabolism of decabromodiphenyl ether (BDE-209) result in thyroid endocrine disruption in zebrafish larvae. Aquat Toxicol. 2012, 110–111:141–8. 10.1016/j.aquatox.2012.01.008 [DOI] [PubMed] [Google Scholar]
- 50.Hood A, Klaassen CD. Differential effects of microsomal enzyme inducers on in vitro thyroxine (T(4)) and triiodothyronine (T(3)) glucuronidation. Toxicol Sci. 2000, 55(1):78–84. [DOI] [PubMed] [Google Scholar]
- 51.Schnitzler JG, Klaren PH, Mariavelle E, Das K. The thyroid gland and thyroid hormones in sheepshead minnow (Cyprinodon variegatus) during early development and metamorphosis. Fish Physiol Biochem. 2016, 42(2):607–16. 10.1007/s10695-015-0163-5 [DOI] [PubMed] [Google Scholar]
- 52.Power DM, Llewellyn L, Faustino M, Nowell MA, Björnsson BT, Einarsdottir IE, et al. Thyroid hormones in growth and development of fish. Comp Biochem Physiol C Toxicol Pharmacol. 2001, 130(4):447–59. [DOI] [PubMed] [Google Scholar]
- 53.Brown CL, Kim BG. Combined application of cortisol and triiodothyronine in the culture of larvae marine finfish. Aquaculture. 1995, 135:70–86. [Google Scholar]
- 54.Lam TJ, Juario JV, Banno J. Effects of thyroxine on growth and development in post-yolksac larvae of milk-fish, Chanos chanos. Aquaculture. 1985, 46:179–84. [Google Scholar]
- 55.Crane HM, Pickford DB, Hutchinson TH, Brown JA. Developmental changes of thyroid hormones in the fathead minnow, Pimephales promelas. Gen Comp Endocrinol. 2004, 139(1):55–60. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Pairwise variation analysis between the normalization factors NFn and NFn+1 was used to determine the optimal number of control genes for normalization.
(DOCX)
(DOCX)
(DOCX)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.