Abstract
The metazoan-specific POU domain transcription factor family comprises activities underpinning developmental processes such as embryonic pluripotency and neuronal specification. Some POU family proteins efficiently bind an 8-bp DNA element known as the octamer motif. These proteins are known as Oct transcription factors. Oct1/POU2F1 is the only widely expressed POU factor. Unlike other POU factors it controls no specific developmental or organ system. Oct1 was originally described to operate at target genes associated with proliferation and immune modulation, but more recent results additionally identify targets associated with oxidative and cytotoxic stress resistance, metabolic regulation, stem cell function and other unexpected processes. Oct1 is pro-oncogenic in multiple contexts, and several recent reports provide broad evidence that Oct1 has prognostic and therapeutic value in multiple epithelial tumor settings. This review focuses on established and emerging roles of Oct1 in epithelial tumors, with an emphasis on mechanisms of transcription regulation by Oct1 that may underpin these findings.
Keywords: Oct1/POU2F1, NuRD, Jmjd1a/KDM3A, Gastric cancer, Cervical cancer, Breast cancer, Colorectal cancer, Prostate cancer, Lung adenocarcinoma, Thyroid cancer
1. Introduction
Gene transcription is orchestrated by sequence-specific DNA binding transcription factors. A mammalian genome encodes several thousands of these transcription factors, which have varied expression patterns, upstream regulatory mechanisms and downstream modes of action. Typically the ultimate consequence of transcription factor activity is to enable or inhibit functional RNA polymerase II (Pol II) complexes at target genes, thus augmenting or attenuating transcription rates and gene expression.
The functions of transcription factors have been most commonly delineated in one of three ways: 1) forward genetic screens, often in model organisms such as C. elegans and D. melanogaster, 2) reverse-genetic approaches, and 3) identification of regulatory sites in genes with particular function, followed by the identification of transcription factors that associate with the sites. It was through this latter method that Oct1 was first described.
One of the earliest described mammalian transcription factors, Oct1 was identified as a protein associated with regulatory DNA binding sites in animal viruses that were used to study gene regulation during the 1980s: adenovirus, SV-40 and herpes simplex virus-1 [1–3]. These binding sites consist of a recurring 8-bp sequence (5′ATGC(A/T)AAT) that came to be known as the octamer motif. Oct1 was also identified through its ability to bind conserved binding sites in endogenous cellular genes, including the cell type-specific immunoglobulin heavy and light chain and Interleukin-2 genes, and widely expressed genes such as those encoding histones and U snRNAs [4–9]. In cell-free transcription assays, or when overexpressed with plasmids containing artificial reporter genes, Oct1 could enhance transcriptional output. However, the augmentation of transcription was typically weak compared to other transcription factors such as AP-1 and NF-κB [10]. This weak activity suggested that in order to function, Oct1 might require chromatin contexts not recapitulated in these classic assay systems.
These early findings on Oct1 are linked, via a circuitous route, to later work implicating Oct1 as a potent tumor promoter, most prominently in epithelial malignancies, and to a recent crop of biochemical, genomic and in vivo findings further supporting a pro-tumorigenic role. A brief description of that route, with its stopovers and waypoints, and a summation of what is known currently regarding Oct1’s roles in malignancy, is the focus of this review.
2. Oct1 Molecular characterization and DNA binding
The Oct1 gene contains a bipartite DNA binding motif consisting of two distinct sub-motifs [11]. The N-terminal motif is distantly related to a homeobox, while the C-terminal motif resembles a classic homeobox. The full DNA binding domain came to be known as the POU domain, and the two sub-motifs were termed POUS (for POU-specific domain) and POUH (for POU-homeodomain). POU is an acronym that stands for the founding members of the family, Pit-1, Oct1/2, and UNC-86 [12]. In humans and mice, there are some 13 POU transcription factors, 8 of which display specificity for the octamer motif and are hence referred to as Oct proteins [13]. Oct1 is the only Oct protein, and only POU family protein, that is widely expressed. Analysis of Oct1 mRNA expression, e.g. with GeneAtlas (http://biogps.org/dataset), reveals little variance in human or mouse expression among organs such as kidney, pancreas, lung, thyroid and prostate. In contrast, other Oct proteins such as Oct2/POU2F2, Oct11/Skn-1/POU2F3, Oct6/POU3F1, Brn2/POU3F2, Brn1/POU3F3, Brn4/POU3F4 and Oct4/POU5F1 do not appear to be significantly expressed in these organs, or in epithelial cells generally. Therefore Oct1 is the predominant, if not sole, Oct transcription factor in many epithelial tissues. One exception is the expression of Oct2, the most closely related Oct1 paralog, in mouse and human normal and malignant mammary gland epithelial cells [14, 15].
Structural studies revealed that Oct1, as predicted by sequence and biochemical analysis, recognizes DNA through the two independently folded DNA binding subdomains. The POUH and POUS domains are separated by a flexible ~20 amino acid linker [16]. The classic Oct1 binding sequence is the octamer motif, though several changes are tolerated. Even greater deviation can be tolerated in the context of dual or compound binding sites. In these cases, DNA binding to sub-optimal sequences is stabilized by the presence of a second Oct1 protein (Fig. 1A). The heptamer-octamer sequence in immunoglobulin genes is the oldest example [17]. The “heptamer” sequence is a degenerate octamer motif. Another example is a dyad octamer sequence identified in the imprinted H19/Igf2 locus between Igf2 and the H19 lncRNA [18]. For many of these sequences structural information on DNA binding is scarce, however dual sites have been described in two structurally defined configurations: the PORE (Palindromic Octamer Related Element, ATTTGAAATGCAAAT) and MORE (More PORE, ATGCATATGCAT). The PORE is essentially two octamer motifs inverted with respect to one another. Osteopontin (Spp1/Opn) is a classic PORE-containing Oct1 target gene [19, 20], with the PORE located in the first intron. In contrast, binding to the MORE (Fig. 1A) rearranges the spatial distribution of the DNA binding subdomains relative to each other such that rather than binding major groves on opposite sides of the DNA helix, the two domains bind adjacent major grooves on the same face of the DNA [21]. Oct1 binding to MOREs is inducible by oxidative and genotoxic stress, through phosphorylation of a conserved Ser385 residue in the POUH DNA binding sub-domain [22].
Fig. 1.

Different modes of Oct1 DNA binding. A) Modes of Oct1 DNA binding. The best-documented examples are shown, but clear structural information is only available for the subset on the left: canonical octamer, tandem/PORE and MORE. In many cases, such as TMFORE, conserved arrangements of half-sites are seen without knowing how Oct1 molecules are arranged on DNA. B) Expansion of one specific DNA binding modality, the MORE. Binding is inducible by stress signals. Example target genes identified by ChIPseq [22] or specific target gene analysis [23] are shown. All sites are conserved to mouse. Consensus MORE sequence is shown at the top. At the right is the position of the binding site relative to the transcription initiation site, and functional annotation. Some target genes have been heavily studied and some much less so.
Although originally described as a synthetic element, MORE-like elements were identified in several endogenous target genes, through inducible Oct1 binding as determined by ChIPseq (Fig. 1B). One of the strongest described is a dyad MORE sequence (binding four Oct1 molecules) located about 2 kb upstream of Polr2a, which encodes the large subunit of Pol II [20, 22]. This element is conserved across the mammalian lineage. Aside from Polr2a, MORE-like sequences were also described in Ahcy (S-adenosyl methionine metabolism), Ell (Pol II elongation factor), Bmp4 (cancer-associated signaling protein), Hmgb3 (HMG-box DNA binding transcription factor), Blcap (imprinted oncoprotein), Kdm2b/Jhdm1b/Fbxl10 (oncogenesis-associated lysine demethylase), Rras and Rras2 (signal-transducing oncoproteins), and Abcb1 (stem cell-associated efflux transporter) [22, 23]. A different element termed TMFORE (Taf12, Mili, Foxo4 Octamer Related Element, AAATTATGCTTCCGAAATCTCTTGATGTC) was found in the eponymous mouse genes rather than through structural studies. This element is well-conserved in mammals and is composed of octamer half-sites in paired and inverted combinations distinct from either a PORE or a MORE. It also displays stress-inducible Oct1 binding. Complex binding sites such as the PORE, MORE and TMFORE easily bind Oct proteins and may represent a significant fraction of in vivo binding sites, especially in situations where there is no match to known weight matrices [24]. In addition to Oct1 homodimers, heterodimers with Oct2, Oct4 or Oct6 can assemble cooperatively on multimeric sequences in vitro [25–27]. Oct1 has been shown to form a complex with Oct2 at the inducible nitric oxide synthase Nos2 (iNos) promoter, inhibiting recruitment of Pol II. In the absence of Oct2, Oct1 binds the iNOS promoter allowing recruitment of Pol II and transcription initiation [28]. The rules governing which Oct proteins assemble at which elements have not been systematically explored, though in a few cases simultaneous binding of Oct1 and Oct4 has been demonstrated at target genes in embryonic stem cells [26, 25].
Outside of the Oct transcription factor family, described Oct1 cooperative transcription factor binding partners (Fig. 1A, lower right) include C/EBPβ [29, 30], SP-1 [31], STAT-5 [32, 33], CREB [34], glucocorticoid receptor [32, 35, 36], androgen receptor [37], thyroid hormone receptor beta-1 [38], retinoid X receptor [39] and NF-κB/RelA [40]. In summary, Oct1 behaves similarly to other transcription factors in that it can recognize with high affinity and specificity strong matches to its consensus binding site, and can partner with itself, Oct1 paralogs and other classes to transcription factors to recognize more degenerate binding sites.
3. Oct1 Knockout phenotypes
Because Oct1 is widely expressed, and because it associates with multiple critically important genes such as histones, U snRNAs, RNA polymerase II subunits and TBP-associated factors (TAFs), a reasonable hypothesis would be that loss of Oct1 is incompatible with cell growth and viability. Such a result would assign Oct1 the function of a “housekeeping” transcription factor that is necessary for the expression of essential targets. The alternative would be that Oct1 plays a more nuanced role. Oct1 disruption in mice and cells supports the alternative model. Loss of Oct1 in untransformed cells for example does not appear to affect growth or morphology. Additionally, whole body knockout embryos survive to mid-gestation. Three disrupted Pou2f1 (Oct1) mouse alleles have been generated:
A severely hypomorphic germline-deficient allele [41] results in mid-gestation embryonic lethality (embryonic day 11.5–12.5). Runting and anemia with pale fetal liver are present at these time points, though with variable penetrance. The animals live long enough to derive mouse embryonic fibroblasts (MEFs) and to obtain fetal liver hematopoietic progenitors. Surprisingly, Oct1 is dispensable for proliferation of primary cells in this system. Oct1 deficient MEFs proliferate normally in standard conditions [41], while Oct1 deficient hematopoietic progenitors efficiently transplant recipient animals and give rise to stably-engrafted blood cells [42, 23]. Oct1 deficient fetal liver cells do however show poor engraftment potential when used in serial or competitive transplant situations, or following brief culture [23].
A germline-null allele [43] implants but dies after gastrulation. Importantly, the early embryonic lethality can be rescued by tetraploid complementation, indicating that it is not embryo-intrinsic. Further investigation revealed that the extra-embryonic restriction is due to defects in trophectoderm stem cells. Tetraploid-complemented embryos survive to embryonic day 8.5–9.5. MEFs taken from these embryos also proliferate normally, but following glucose or amino acid starvation fail to arrest at the G1 phase of the cell cycle [44].
A recently developed conditional-null allele [45] thus far only has been used for deletion in T cells. In this model, T cell development and activation are normal but defects manifest in CD4 memory T cells. Whole body deletion of this allele is embryonic lethal [45], but careful staging has not been performed. As with many conditional alleles, incomplete deletion is an issue that needs to be taken into account in future studies. However there are equally important issues with using a severe hypomorph allele (above) and the residual protein product typically seen with RNAi (below).
Acute RNAi-mediated Oct1 knockdown results in similar conclusions: cancer cell lines such as A549 (lung), MCF-7 (breast) and MDA-MB-231 (breast) engineered with doxycycline-inducible shRNAs show no growth defects upon induction of Oct1 shRNA [23, 46]. Cumulatively, these results indicate that Oct1 is not critical for the expression of many target genes (such as histones and U snRNAs) under standard conditions. The mouse phenotypes also indicate that Oct1 is dispensable for many developmental pathways. These findings are seemingly paradoxical given the conservation of Oct1 binding elements in critical genes, and the demonstrated binding of Oct1 to these elements using ChIP/ChIPseq, however discarding the naïve expectation that a transcription factor bound to a target gene necessarily contributes to its baseline expression easily solves this conundrum (below).
4. Oct1 revisited
The lack of cellular lethality upon loss of Oct1 raises three significant questions: 1) What is the function of Oct1 at “housekeeping” genes such as histones, U snRNAs, RNA polymerase II subunits and TAFs? 2) What is its role at cell type-specific genes? 3) What is Oct1’s physiological function? Regarding the third question, one insight came with the discovery that Oct1 deficient cells are hypersensitive to genotoxic and oxidative stress generated using ionizing radiation, doxorubicin or hydrogen peroxide [47]. Oct1 had already been shown to regulate the induction of Gadd45a in response to DNA damage [48–50], suggesting that the hypersensitive phenotype of Oct1 deficient cells may stem from Oct1 responding to stress signals and altering target gene expression.
A second insight came from the 2009 finding that Oct1 controls cellular metabolism. Although Oct1 deficient MEFs grow at normal rates in rich media and are morphologically normal as assessed by light microscopy [41, 51], they have reduced glucose uptake and increased mitochondrial genome number, membrane potential, respiratory rate and reactive oxygen species (ROS) concentrations [46, 51]. Electron micrographs of these same cells reveal increased mitochondrial articulation, while metabolomic analysis indicates increased TCA intermediates and decreased lactate. Consistent with these changes, amino acid uptake and oxidation are greatly increased in Oct1 deficient cells. Similar results were observed using whole mouse knockout embryos, primary B and T cells isolated from Oct1 deficient fetal liver transplant recipients, and RNAi in cell lines. The opposite result – a more glycolytic phenotype – was observed in cells overexpressing Oct1. Wild-type immortalized MEFs (3T3 cells) die after 5–6 days in culture medium lacking glucose, whereas Oct1 deficient MEFs arrest but remain viable [44, 46, 52]. Consistent with these changes, multiple Oct1 targets, including stress- and signal-responsive target genes, encode metabolic regulators [46, 47, 53, 54]. Examples include Gpx3, Pcx, Pdk4 and Hmgcl.
A final insight, inconsistent with the notion that Oct1 is a monolithic factor that maintains baseline target gene expression, is the finding that Oct1 is a signal integrator. Oct1 is modified in multiple ways, including by phosphorylation, O-GlcNAcylation, and ubiquitylation (Fig. 2). Of these modifications, the best studied is phosphorylation. Oct1 Ser385 phosphorylation in the POUH DNA binding subdomain allows the protein to adopt a configuration that allows it to bind more favorably to genes containing a MORE-like sequence [22] (Fig. 1B). Phosphorylation at Ser335 in the other DNA binding subdomain, POUS, abrogates DNA binding. NEK7 catalyzes this modification during M-phase [55], but AMPK can also phosphorylate Ser335 in response to glucose deprivation [56]. Finally, the Oct1 N-terminus is phosphorylated in vitro by DNA-PK at multiple residues in a manner that dampens transcriptional activity, though these modifications have not been confirmed in cells [57]. Information on other Oct1 modifications is scarce. Other Oct1/POU2F1 phosphorylation events have been documented in large screens but are not functionally annotated [58, 59]. Mass spectroscopy indicates that the protein is both ubiquitylated and O-GlcNAcylated [52]. The ubiquitin ligase(s) and deubiquitinases are unknown, as is the significance of the ubiquitylation events, but it is known that Oct1 is stabilized at the protein level in stem cells (see below). O-GlcNAcylation appears to control Oct1 transcriptional activity at the level of association with the nuclear periphery (below).
Fig. 2.

Oct1 post-translational modifications verified to occur in cells using mass spectroscopy. A) Schematic is shown with known modifications. Not all modifications have been functionally annotated. Modifications identified in large phosphorylation screens are as follows: Daub et al. [138]: phospho-Ser267, phospho-Ser335 (annotated as the smaller POU2F2/Oct2 which would score more highly, but the peptide is identical to Oct1), phospho-Ser385, phospho-Ser441, phospho-Thr445; Dephoure et al. [139]: phospho-Ser269, phospho-Thr270, phospho-Thr276, phospho-Ser278, phospho-Ser283, phospho-Ser335 (annotated as the smaller POU2F2/Oct2 which would score more highly, but the peptide is identical to Oct1), phospho-Ser385, phospho-Ser447, phospho-Ser448; Van Hoof et al. [58]: phospho-Thr270, phospho-Ser278, phospho-Thr445, phospho-Thr446, phospho-Thr448. Modifications identified in Oct1-targeted studies are as follows: Kang et al. [52]: Ub-Lys9, O-GlcNAc-Thr255, phospho-Ser270, phospho-Ser276, phospho-Ser278, phospho-Ser283, phospho-Ser335, phospho-Ser385, Ub-Lys403, phospho-Thr448, O-GlcNAc-Ser728; Segil and Heintz [140]: phospho-Ser385. B) Complete sequence of the major isoform of human Oct1 is shown, with modifications.
To summarize this section, the last ten years have seen the identification of roles for Oct1 in stress responses and metabolic control, and provided evidence that Oct1 integrates multiple signal inputs through multiple post-translational modifications.
5. Oct1 transcriptional mechanisms
Early studies of Oct1’s transcriptional properties relied on plasmid-based reporter systems in which octamer elements coupled to reporter genes were used with transiently transfected and overexpressed Oct1. Like other Oct/POU family members such as Oct4, Oct1 is not very robust in these classic transcription activity assays. These findings run counter to both the high conservation of Oct1, and the conservation of its binding sites in important target genes. Multiple labs have undertaken to better understand its transcriptional properties, with the idea that mechanistic insights may result in a more sophisticated and biologically accurate view of its functions. Oct1 can interact with components of the core transcription machinery [60, 61], suggesting that when localized to the core promoter it can regulate gene expression by recruiting transcription complex components. In breast cancer cell lines, Oct1 regulates rapid induction of Nos2 (iNOS) through a binding site that must be positioned close to the TATA box in the proximal promoter. Prior to induction, this gene has an engaged Pol II, indicating that Oct1 likely regulates this gene at the level of transcript elongation [62]. Oct1 activation of Nos2 can be inhibited by expression of, and association with, Oct2 [28].
Additionally, new models for Oct1 transcription regulation have emerged in which Oct1 can associate with different cofactors – and with the nuclear periphery – to mediate either transcription activation, repression or a third output – termed “gene poising.” Oct1 can switch between different modes via the action of upstream regulatory inputs (for example MAPK signaling), even at the same gene. These contrasting transcriptional modalities may underpin its many functions in malignancy, delineated in section 6.
5.1 Gene activation and repression by Oct1
The action of Oct1 on chromatin has been primarily studied using HeLa cells, fibroblasts, T cells and colon cancer cells lines [45, 63]. Affinity purification/mass spectroscopy studies have shown that Oct1 interacts with a multi-subunit repressive chromatin complex known as NuRD (Nucleosome Remodeling and Deacetylase). NuRD mediates transcriptional repression through ATP-dependent nucleosome remodeling, histone deacetylase and DNA methylation mechanisms [64–66]. NuRD recruitment by Oct1 is closely associated with target gene silencing (Fig. 3).
Fig. 3.

Mechanisms of transcription regulation by Oct1. Top: Oct1 has been described to repress transcription via association with the chromatin modifying complex NuRD [63]. NuRD possesses both histone deacetylase activity and ATP-dependent chromatin remodeling activity and can potently suppress transcription. Bottom: in response to signals (including MAP kinase signaling through ERK in T cells), NuRD dissociates from Oct1 and the histone lysine demethylase Jmjd1a/KDM3A associates.
In response to MAPK signaling, Oct1 can dissociate from NuRD and recruit Jmjd1a/KDM3A to target sites in chromatin [63]. Jmjd1a is a histone lysine demethylase with specificity for H3K9me2 and me1. These modifications repress transcription and thus by removing them Jmjd1a potentiates gene expression (Fig. 3). Association with Jmjd1a correlates with loss of the repressive H3K9me2 mark [45, 63] and with either active gene expression, or with a silent but poised state in which a gene is held in a readily inducible configuration (below). The Oct1 interaction with NuRD and Jmjd1a is mutually exclusive, suggesting a molecular switch in which Oct1 can switch from repressive to permissive potentialities in response to upstream signals.
5.2 “Gene poising” by Oct1
Gene regulation is often viewed from the standpoint of “on/off switches”, but the maintenance of genes in silent but readily inducible configurations is important for many biological systems. Stem cells and memory immune cells for example must maintain cohorts of genes in a transcriptionally silent state that must be induced upon reception of the correct developmental and immunological cues. Mechanistically, one way to establish poised gene expression states is by the maintenance of chromatin free of repressive modifications. H3K9me2 is one such modification, and the H3K9me2 demethylating enzyme Jmjd1a is an Oct1 cofactor [63]. Investigation of Oct1, Jmjd1a and other cofactors in T cells showed that Oct1 can maintain target genes in a poised configuration for later induction by antigen re-encounter [64]. The chromatin at these target genes is free of H3K9me2 and free of DNA methylation. In these absence of Oct1 these marks accumulate and the target gene is induced only poorly. In vivo, loss of Oct1 in CD4+ T cells specifically ablates the memory phase [45]. This poising mechanism also may be important in stem cells, which have similar characteristics to memory cells including long life, low-level homeostatic proliferation and homing to specific niches.
5.3 Oct1 target gene regulation via nuclear organization
Cell biology-based methods have identified Oct1 regulation by sub-nuclear localization, and by the tethering of distant binding sites together in space. One early study showed that Oct1 dissociation from the nuclear periphery correlated with cellular aging and regulation of the target gene Mmp1 (Collagenase) [67]. Another study indirectly associated Oct1 with the nuclear periphery, and with nuclear lamins, by a strong enrichment of octamer elements in lamin-associated chromatin domains or LADs [68]. Oct1 and B-type lamins interact [53, 55], supporting these findings. LADs are associated with gene repression, and may thus correlate with complexes of Oct1 bound to NuRD (Fig. 3). Subsequent work tied Oct1 association with the nuclear periphery to oxidative stress sensing [53]. In this study, Malhas and Vaux showed reduced Oct1 association with the nuclear periphery in cells lacking functional lamin B1. Oct1 binding to oxidative stress-responsive target genes such as Gpx3 and Rdm1 increases in these cells, which like Oct1 deficient cells have elevated ROS levels and are hypersensitive to oxidative stress. The association of Oct1 with the nuclear periphery may be regulated by O-GlcNAcylation, as mutation of O-GlcNAcylated sites within the protein affects both association with the nuclear periphery and association with the stress-responsive Oct1 target gene Gadd45a [52]. Regulation of Oct1 by nuclear-cytoplasmic shuttling has also been identified in response to oxidative stress and cAMP [69, 70].
Recent findings in T cells show that Oct1 interacts with CTCF, a protein involved in nuclear organization and intra-/inter-chromosomal interactions between widely spaced regions of DNA [71]. This same study showed that Oct1 can cross-regulate T cell-specific target loci located on different chromosomes, maintaining one locus in a more repressed configuration following T cell stimulation. Maintenance of these loci together in space during a specific temporal window is dependent on Oct1. These findings have yet to be extended to epithelial cells.
6. Role of Oct1 in Tumor Initiation/Progression
Mechanism-oriented studies have identified a pro-tumorigenic role for Oct1. Loss of Oct1 in primary Tp53−/− MEFs for example blocks transformation by activated H-Ras and growth on soft agar. Oct1 has no effect on immortalization by serial passage, suggesting specific inhibition of oncogenic transformation [46]. Consistent with these findings is the observation that reduced Oct1 levels protect mice from p53-generated tumors in a mouse model of thymic lymphoma [46]. Pro-tumorigenic functions of Oct1, emphasizing its metabolic functions, have also been described in non-epithelial tumors including glioblastoma, Hodgkin’s lymphoma, thymic lymphoma and melanoma [46, 54, 72–74]. Adding to this literature, recent reports continue to build on the idea that Oct1 has potential prognostic and therapeutic significance for multiple cancer types, in particular cancers of the GI tract, lung and breast. Combined, these malignancies account for the majority of cancer incidence and deaths in much of the developed world [75, 76]. Documented Oct1 alterations in different tumor types are summarized in Fig. 4. Collectively, these data indicate that Oct1 can be a powerful facilitator of epithelial tumor potential.
Fig. 4.

Summary of the different described alterations to Oct1 status in different epithelial tumor types. References are provided at bottom. Progressing from left to right: deletion, focal amplification, increased mRNA expression, increased proteins levels, increased protein activity on target genes, point mutation. Note that Oct1 has not been described to be systematically deleted or mutated in malignancy.
6.1 Oct1 Deletion
Deletion of tumor suppressor genes is common in cancer. Due to Oct1’s pro-tumorigenic functions, in the simplest models recurrent deletion of the Pou2f1 gene encoding Oct1 would not be expected in tumors. Indeed, data available in the Broad Institute Tumorscape database [77] indicate that Pou2f1 is not deleted at a significant rate in any of the 10844 tumors of different types available in the dataset, or located in a focal peak region of deletion. Cancer types studied in this survey include breast, prostate, lung and many others. To our knowledge, no reports of Pou2f1 spontaneous deletion exist in the literature.
6.2 Oct1 focal amplification
A common somatic alteration leading to tumorigenesis is the focal amplification of chromosomal regions containing genes encoding oncoproteins. In a recent study, Qian et al. performed copy number variation analysis in gastric cancer tissues using data from the TCGA, the Singapore dataset and the VU University Medical Center (VUMC) cohorts [78]. They showed Oct1 to be focally amplified in 10% of primary diffuse-type gastric cancer samples. Supporting these findings, data available from Tumorscape show that Pou2f1 is significantly focally amplified across the entire dataset consisting of 10844 tumor types [77]. In addition to genomic amplification, Oct1 expression is frequently increased in certain tumors, as will be discussed below, suggesting that much of the Oct1 overexpression observed in malignancy may stem from transcriptional or post-transcriptional mechanisms.
6.3 Increased Oct1 mRNA levels
Gene expression profiling of cancer cells compared to normal cells is a common way of identifying genes which when overexpressed might contribute to tumor generation, progression or maintenance. Reports focused on epithelial malignancies demonstrate significant increases in Oct1 gene expression. For example, several studies analyzing global gene expression changes in gastric cancer compared to normal gastric tissues have identified elevated levels of Pou2f1 mRNA [79–81]. In a recent study on colorectal cancer (CRC), Wang et al. identified increased Pou2f1 levels in 50% of the 38 total primary CRC tissues, compared to paired normal tissues [82]. Multiple studies as well as TCGA data sets show that Pou2f1 expression is modestly increased in both infiltrating and superficial bladder carcinoma, compared to levels in normal bladder [83–86]. In breast cancer, gene expression profiling studies reveal increases in Pou2f1 expression (between 1.3- and 1.4-fold, averaged across all samples, though some samples vary by more than 5-fold) in invasive ductal as well as lobular breast carcinoma [83, 87–89]. A recent study by Xiao et al. found that Pou2f1 was expressed at almost 6-fold higher levels in cervical cancer tissues compared to paired non-cancerous controls [90]. Pou2f1 mRNA was also detected at higher levels in head and neck squamous cell carcinoma (HNSCC) cell lines compared to normal keratinocytes, and in primary HNSCC tissues compared to normal tissues [91]. In this study, the authors demonstrate that Oct1 acts as a transcriptional activator of the HOX genes Hoxd10 and Hoxd11, both of which are overexpressed in HNSCC.
6.4 Increased protein levels
Although the nature of DNA and RNA makes them more amenable to relatively inexpensive, high-throughput analysis, it is usually the activity of functional proteins that controls cell physiology. Increased levels of a particular protein associated with tumor initiation or progression may be due to overexpression of the gene, but it is also possible that post-transcriptional and/or post-translational events increase protein levels while leaving transcription of the gene unchanged. The majority of epithelial cancers discussed in this review report increased levels of Oct1 protein. Some of the most robust reports associate elevated Oct1 with gastric cancer. For instance a recent study by Xu et al. finds that Oct1 is elevated in gastric cancer tissue and is also regulated by the AKT pathway, leading to the induction of epithelial-to-mesenchymal transition (EMT) [92]. EMT is a cellular process observed in cancer progression and metastasis in which biochemical changes in epithelial cells allow them to become more migratory as they acquire mesenchymal cell characteristics [93]. Another study, which focused specifically on intestinal-type gastric cancer, showed that 74% of the 42 gastric cancer samples analyzed showed increased Oct1 protein levels [94]. In contrast, Jeong et al. reported a smaller percentage, 36.5% of 332 tested gastric cancer patient samples, displaying Oct1 protein overexpression, while the other 63.5% showed reduced Oct1 expression compared to matched non-cancerous tissue [95]. However, this study also identified a positive correlation between Oct1 protein levels, advanced tumor invasion and lower survival rate, suggesting that Oct1 is involved in gastric tumor progression. This possibility is further supported in a recent study by Qian et al., which confirmed elevated Oct1 protein levels in gastric cancer tissues, and identified a role for Oct1 in the regulation of synbindin, a protein involved in ERK signaling [78]. This latter study additionally showed that Oct1 expression offers superior prognostic power compared to the widely used AJCC staging.
A study by Hernández et al. presented a comprehensive analysis of the somatic genetic mutations in breast cancer. Here the authors identified genes with mutations that contribute to the neoplastic process as well as those with “passenger” mutations, or mutations that occur too infrequently to be directly linked to the neoplastic process. Hernández et al. then performed an interactome network analysis in order to determine functional interactions between proteins. Although Oct1 was not identified in the somatic mutation analyses in this study, Oct1 protein was identified in the interactome network analysis as part of a large component connecting validated and/or benchmark proteins which contribute to malignancy [96]. Protein analyses in primary tissues from breast cancer patients has also revealed higher levels of Oct1 protein compared to normal breast tissues, in the absence of mRNA alteration [23].
Oct1 protein up-regulation has also been shown in colorectal, prostate and cervical cancer. A study by Li et al. demonstrated elevated Oct1 protein levels in over 75% of the total 136 primary CRC tumors tested [97]. In addition, Wang et al. showed elevated Oct1 protein expression in ~60% of the 98 CRC tissues analyzed, and further showed that high Oct1 protein correlated with reduced disease-free and overall survival [82]. Obinata et al. showed increased Oct1 protein in prostate cancer cell lines and primary tumor tissue [98]. They identified a positive correlation between Oct1 protein levels and high Gleason scores in tissues from 102 prostate cancer patients. Survival analyses showed that patients with low Oct1 immunoreactivity had better cancer-specific survival compared to patients with high Oct1 immunoreactivity. Based on their results, the authors concluded that Oct1 may have prognostic significance for prostate cancer. Oct1 protein was also increased in cervical cancer tissues compared to normal cervical tissue [90], however this study analyzed tissues from only 10 cervical cancer patients, and more work in this area is needed to firmly conclude that Oct1 protein levels are upregulated in this cancer type.
6.5 Increased Oct1 activity
Because there are multiple Oct1 post-translational modifications, and because Oct1 association with transcription cofactors and the nuclear periphery is regulated by multiple mechanisms (above), there are many possible ways in which transcription of Oct1 target genes can be modulated without altering the levels of Oct1 protein. In a few cancer types there is evidence for increased Oct1 transcriptional activity without increased Oct1 mRNA or protein levels. In these cases, augmented Oct1 function was detected indirectly, by the tendency of coordinately regulated genes associated with malignancy to have binding sites for Oct1. The products of these genes may contribute to tumor initiation and progression.
A recent report by Kalamohan et al. [99] implicated Oct1 in coordinate regulation of gene expression associated with gastric cancer. In this study, co-expressed genes in 200 gastric cancer tumors were categorized into 21 modules. One module was considered to be the major driving force of diffuse type gastric cancer, and one of the features in this module was higher frequency of Oct1-mediated transcription, with an Oct1 binding site occurrence of over 21%, the highest identified enrichment frequency for transcription factor binding sites. For intestinal-type gastric cancer, the authors identified the genes and gene hubs in another module as the major drivers, and Oct1 was among the top 5 transcription factors whose binding sites were enriched, with over a 12% occurrence [99].
A study of c-Myc-driven lung adenocarcinoma identified a statistical enriched in Oct1 binding sites in the deregulated genes. Here the authors performed transcriptional profiling on lung adenocarcinomas of female c-Myc transgenic mice, identifying a cohort of transcriptionally induced genes in order to identify regulatory gene networks [100]. Oct1 binding site enrichment was found in a set of genes indirectly controlled by c-Myc. Two other studies identify enrichment in Oct target sites in breast cancer and other malignancies without specifically implicating Oct1 [93, 101]. Sometimes these sites are identified as Oct4 target sequences or parts of “pluripotency signatures”, despite the lack of obvious Oct4 expression in these tissues. The overlapping specificity of Oct proteins makes it difficult to conclusively identify one particular Oct protein in this analysis, making it possible that the widely expressed Oct1 protein underlies these differences in expression.
Another case in which Oct1 activity is increased leading to pro-tumorigenic effects is a recent study which identified the circadian gene Period2 (PER2) as a tumor suppressor frequently downregulated in breast cancer. PER2 was shown to act as a transcriptional corepressor by recruiting EZH2 and SUZ12 as well as HDAC2 to Oct1 binding sites in target genes including Twst1, Snai1 (Snail) and Snai2 (Slug). Downregulation of PER2 removes this inhibitory effect and allows for the transcriptional activation of Twst1, Snai1 and Snai2 by Oct1 [93].
Oct1 transcription activity is signal-responsive. For example, MAPK signals can regulate Oct1 association with cofactors (see section 5). Recent findings demonstrate an involvement for Oct1 downstream of BRAF in thyroid cancer, where BRAF-V600E mutation is the most common genetic alteration. In this study, which analyzed the role of thyroid hormone T3 in papillary thyroid cancer, the authors found that T3 binds to and activates a complex consisting of the thyroid hormone receptor TRβ1 and Oct1, leading to the translocation of this complex to the nucleus where it binds to Oct1 sites on the cyclin D1 (Ccnd1) promoter, inducing cell proliferation [38]. When the levels of T3 are increased, as in the case of hyperthyroidism, the TRβ1/Oct1 complex is over-activated, leading to overexpression of cyclin D1 and the promotion of thyroid cancer. Interestingly, Oct1 was also recently found to be activated by BRAF in order to promote expression of target genes in melanoma, a non-epithelial cancer [54]. Constitutively active BRAF-V600E activates Oct1 in melanoma cells in order to promote the expression of the metabolic/ketogenic enzyme 3-hydroxy-3methylglutaryl-CoA lyase (HMGCL), leading to accumulation of the HMGCL product acetoacetane (AA). AA promotes binding of mutant but not wild-type BRAF to MEK1, promoting MEK-ERK activation. Although active BRAF activates Oct1 in order to induce Hmgcl expression in normal cells, only in cells harboring the BRAF-V600E mutant is there a metabolic advantage in having increased accumulation of AA, and because BRAF-V600E is constitutively active, Oct1 activity is higher compared to normal cells. It will be interesting to analyze the expression and activity of Oct1 in other cancer types where BRAF mutation occurs, including breast, lung, ovarian and colorectal cancers [102]. Cumulatively, these studies identify augmented Oct1 protein activity, rather than augmented Oct1 mRNA levels, as an important correlate of tumor gene expression patterns.
Recently, a pathway by which increased Oct1 expression could lead to activation of the MAPK/ERK pathway was observed in gastric cancer cells [78]. Oct1 was found to act as a transactivator of Synbindin, a gene encoding a regulator of the MEK/ERK pathway. Synbindin binds to both ERK and MEK on the Golgi apparatus, facilitating ERK phosphorylation by MEK [78]. Because Oct1 has previously been shown to be regulated by MEK/ERK, taken together these findings suggest a complex interaction between Oct1 and MAPK signaling.
6.6 Mutation
The Sanger Institute Catalogue of Somatic Mutations in Cancer (COSMIC) database [103] reports that out of 22997 samples analyzed, only 120 Oct1 mutations have been identified. These include missense mutations and small number of frameshift events. However there has not been as yet any direct association between these mutations and epithelial cancers. In aggregate, the published findings indicate that Oct1 can contribute to malignancy at multiple levels, but is most strongly implicated post-transcriptionally including at the level of protein concentration and activity.
7. Mechanisms and target genes potentially underlying Oct1’s pro-tumorigenic role
What are the critical Oct1 targets and pathways that help to drive malignancy? This question remains incompletely answered, mostly because systematic Oct1 genomic target analyses in different tumor types have yet to be performed. However, both anecdotal results from various malignancies and systematic ChIPseq results from nonmalignant cells have identified targets that may contribute to disease. The described functions of Oct1 are numerous, and identifying those functions that allow Oct1 to promote tumorigenicity in specific malignancies may help in categorizing and treating these diseases. Based on the known target genes, and knowing that given genes can function in more than one area, the functions of Oct1 can be broadly classified into six categories: control of cell growth, cellular stress response, metabolic regulation, regulation of stem cell identity, invasion and metastasis and immune regulation (Table 1).
Table 1.
Oct1 target genes discussed in section 71
| Pathway | Gene | Description | Function | Ref |
|---|---|---|---|---|
| Control of cell growth | Ahcy | Adenosylhomocysteinase | Threonine metabolism. S-adenosyl methionine biosynthesis. | [22, 62] |
| Ccnd1 | Cyclin D1 | Component of the core cell cycle machinery. Promotes proliferation leading to tumor formation. | [33, 34, 38, 102] | |
| Polr2a | RNA polymerase II polypeptide A, 220 kDa | Protein-coding gene transcription. | [20, 22, 62] | |
| Rras, | Related RAS Viral (R-Ras) Oncogene Homolog; Related RAS Viral (R-Ras) Oncogene Homolog 2 | Small GTPases, activate signal transduction pathways. Induce cell proliferation. | [22, 23] | |
| Rras2 | ||||
| Cellular stress response | Cdkn1b/Ki p1 | Cyclin-dependent kinase inhibitor 1B | Inhibitor of cell cycle progression. | [44] |
| Esr1 | Estrogen receptor 1 | Encodes ERalpha. Hormone response. Mitogenic. Associated with mammary gland development. | [109,110] | |
| Gadd45a | Growth arrest and DNA damage-induced protein, alpha | Stress-inducible. Associated with cell cycle arrest. | [48–50, 52, 104–107] | |
| Hmgb3 | High mobility group-box protein, B3 | Transcription factor. Induces gastric cancer cell proliferation and cell cycle progression. Important for stem cell maintenance. | [23, 103] | |
| Mad2 | Mitotic arrest deficient 2 | Component of the mitotic spindle assembly checkpoint. Reduced expression leads to failure of cells to arrest in G2-M phase, leading to aberrant cell division. | [109] | |
| Nth1 | Nth Endonuclease III-Like 1; 8-Oxoguanine glycosylase; Redox factor-1/Apurinic/Apyrimidinic endonuclease | Base excision DNA repair. Detection and repair of DNA damage. | [110] | |
| Ogg1 | ||||
| Ref1 (Ape1) | ||||
| Pdrg | p53 and DNA damage regulated gene | Regulation of cell growth. | [111] | |
| Metabolic regulation | Hmgcl | HMG-CoA lyase | Accumulation of acetoacetane. Facilitates activation of MEK-ERK signaling. | [54] |
| Stem cell identity | Abcb1 | ATP-binding cassette (ABC) transporter, B1, B4, G2 | Efflux activity. Chemoresistance. | [23, 119] |
| Abcb4 | ||||
| Abcg2 | ||||
| Aldh1a1 | Aldehyde dehydrogenase 1 family, member A1 | Retinoic acid biosynthesis. Associated with stem cell activity. | [23] | |
| Invasion and metastasis | Hoxd10, | Homeobox D10; Homeobox D11 | Transcription factors. Regulate organ morphogenesis and cell differentiation during development. Promote proliferation and invasion of oral keratinocytes. | [90] |
| Hoxd11 | ||||
| Snai1 | Snail family zinc finger 1, Snail family zinc finger 2 (Slug), Twist family bHLH transcription factor 1 | Transcription factors. Induce EMT in malignant cells, leading to metastasis. | [92] | |
| Snai2 | ||||
| Twst1 | ||||
| Spp1 (Opn) | Secreted signaling glycophosphoprotein-1 (Osteopontin) | Induces migration in breast carcinoma cells. | [19, 20, 25, 123, 124] |
Immunomodulatory genes are not shown
7.1 Control of cell growth
Growth-associated Oct1 target genes include targets needed for cell proliferation and viability. Examples include histones, U snRNAs, Pol II subunits and TAFs. Additionally, growth regulators such as Ccnd1 (Cyclin D1), Rras and Rras2 are Oct1 target genes [22, 104, 33, 34]. Ccnd2 was also recently revealed to be an Oct1 target in T cells [45]. At the Ccnd1 locus, Oct1 has been described both as a directly bound transcription factor and as a transcriptional co-activator [33, 34]. In papillary thyroid cancer, where T3 levels are increased, Oct1 has been shown to form a complex with TRβ1. This complex binds T3 and translocates to the nucleus, leading to the expression of Ccnd1 and the initiation of thyroid tumors [38].
Interestingly and as mentioned above, loss of expression of many of these genes would be expected to cause cell lethality, inconsistent with the Oct1 knockdown/knockout phenotype. More likely and consistent with current findings, Oct1 modulates the expression of these genes in response to upstream signals. For example, Oct1 may regulate these genes under conditions of stress, buffering them from inappropriate repression [22, 63]. This anti-repression mechanism works by recruitment of Jmjd1a to target genes to prevent the accumulation of repressive H3K9me2 marks. In MEFs, Oct1 deficiency causes this mark to accumulate at two tested target genes, Polr2a and Ahcy. Following hydrogen peroxide exposure, these broadly expressed target genes become strongly repressed in Oct1 deficient cells [63].
7.2 Cellular stress response
When exposed to oxidative stress, Oct1 can be modified by phosphorylation at Ser385. This modification alters the binding specificity of Oct1 at target sites, allowing Oct1 to additionally bind more complex sites, such as the MORE motifs described in section 2 [22]. Target genes containing MORE sites include the high mobility group-box 3 gene Hmgb3 and the oncogenes Rras and Rras2 [23]. HMGB3 protein expression is frequently elevated in gastric cancer and is associated with poor prognosis [105].
The best-characterized stress-associated Oct1 target is Gadd45a. Gadd45 proteins are induced by endogenous and exogenous stress signals including oncogenic stress, ionizing radiation and ultraviolet light. Gadd45a’s functions are not completely understood but it is known to regulate cellular stress responses via interactions with p21, PCNA, Cyclin B1 and the p38 and JNK signaling kinases to regulate cell cycle arrest, apoptosis and DNA repair [106, 107]. Studies have shown that Gadd45a is induced through both p53-dependent and -independent mechanisms. NF-Y and Oct1 mediate p53-independent induction [48–50, 108]. The tumor suppressor BRCA1 may collaborate with Oct1 in Gadd45a regulation [109] and act as an Oct1 cofactor at the Esr1 promoter [110]. Esr1 encodes ERalpha and is an Oct1 target gene [111]. Oct1 and BRCA1 have been documented to interact [109, 112, 113]. Interestingly, BRCA1 is also implicated in Oct1 regulation of other targets, including Mad2 [113], and several targets involved in base excision DNA repair, Ogg1, Nth1, Ref1 (Ape1) [114]. Precisely how this pathway works has not been fully delineated. Other defined stress-inducible Oct1 targets include Pdrg and Cdkn1b/Kip1 [44, 115].
7.3 Metabolic regulation
The metabolic activities promoted by Oct1 described in section 4, including the switch from aerobic glycolytic metabolism, are consistent with changes observed in tumor cells [116], suggesting that Oct1 may have cancer-promoting effects via metabolic mechanisms. Consistent with this hypothesis, experiments have associated Oct1’s metabolic functions with its action in cancer. In Tp53 deficient MEFs, Oct1 deletion eliminates soft agar colony formation following transformation with H-Ras. Transformation of fibroblasts by serial passage is unaffected, suggesting that the effects are specific to Ras-induced oncogenic transformation [46]. Loss of Oct1 mimics the effects of dichloroacetate (DCA), a known inhibitor of transformation that promotes oxidative metabolism [117]. Combining DCA with Oct1 loss produces no additive effect, suggesting that DCA and Oct1 loss act in the same pathway [46]. Another study, focused on glioblastoma, identified a pathway by which Oct1 controls the expression of its direct target, miR-451, via the activity of AMPK in a manner controlled by glucose availability. Oct1 Ser335 phosphorylation by AMPK dampens its activity and reduces miR-451 expression, resulting in increased expression of repressed miR-451 targets such as CAB39 [56]. Finally a study focused on melanoma and leukemia identified Oct1 at the center of a pathway linking mutant BRAF and oncogenic MAPK signaling to lipid metabolism, through the direct Oct1 target Hmgcl [54]. Although none of these studies focuses on epithelial tumors, the players are widely expressed. Targeted studies are required to reveal whether the increased Oct1 activity consistently observed in epithelial tumors drives malignancy through these pathways.
7.4 Regulation of stem cell identity
Loss of Oct1 has been shown to decrease tumor size in xenograft models of colon cancer [82] and lung cancer [46]. In the latter model, A549 cells with inducible Oct1 knockout were used to generate subcutaneous tumors in immunodeficient recipients, yielding somewhat smaller tumors that nevertheless grew at the same rate within their hosts. These results suggested that fewer cells seed the tumor. More sophisticated limiting dilution experiments revealed that the number of cells necessary to initiate a tumor rises greatly in the Oct1 deficient condition [23]. This phenotype is frequently associated with “tumor stem cells” – cells that have been described as glycolytic and stress resistant, phenotypes also associated with Oct1. Additional work identified a direct role for Oct1 in promoting stem/progenitor cell phenotypes (e.g., dye efflux, ALDH activity), and identified relevant target genes (e.g., Abcg2, Abcb1, Abcb4 and Aldh1a1) [23].
Published work from our laboratory [23] and the Clevers laboratory [118] shows that Oct1 levels are elevated, compared to surrounding cells, in stem cells of the small intestine and colon that also express high levels of the stem cell markers Lgr5, Lrig1 and Aldh1. In the latter case, elevated Oct1 protein levels were observed without increases in Oct1 mRNA expression. Further work [23] extended these findings to malignant stem-like (CD44hiCD24lo) breast cancer samples: metastatic tumor samples with high stem cell content had high levels of Oct1 protein but not mRNA. The finding that Oct1 levels are elevated at the protein but not mRNA level in normal and malignant stem cell compartments are consistent with a model in which Oct1 protein is stabilized in stem cells. Oct1 is known to be ubiquitylated [52], and more work is required to understand possible Oct1 regulation at the level of protein stability.
A pro-stem cell function for Oct1 may enhance tumor aggressiveness, as tumor cells with expanded stem cell signatures tend to be of higher grade [119]. Stem cell phenotypes are also closely linked to chemo- and radio-resistance [120–122]. Elevated expression of ABC efflux transporters on the cell surface decreases the intracellular concentration of cytotoxic therapeutics, thus conferring resistance [123]. Increased progenitor phenotypes can also cause epithelial cells to lose cell polarity, resulting in tissue disorganization and metastatic behavior [124–126].
7.5 Invasion and metastasis
Only recently have roles of Oct1 in tumor spread begun to emerge. Examples come from breast and colon cancer. Oct1 targets include Twst1 and Snai2 (Slug), genes involved in EMT. TWIST1 and SLUG are part of a group of transcription factors that induce EMT during development as well as in tumor cells. A study by Li et al. showed that Oct1 is overexpressed in the majority of CRC tissues analyzed, and delineated a mechanism by which Oct1 might contribute to CRC progression [97]. The authors showed that Oct1 expression correlates with the expression of N-cadherin and ZEB1, which promote EMT, and that Oct1 knockdown in CRC cell lines reduces proliferation, migration and EMT markers. These changes are consistent with a role for Oct1 in CRC progression. In breast cancer, the activation of EMT-inducing genes by Oct1 has also been observed [93]. Hwang-Verslues et al., showed that the tumor suppressor PER2 acts as a transcriptional corepressor by recruiting EZH2 and SUZ12 as well as HDAC2 to Oct1 binding sites of EMT genes including Twst1, Snai1 and Snai2, therefore repressing induction of these genes. Downregulation of PER2, which is observed in both sporadic and familial primary breast cancers, removes this inhibitory effect and allows for the transcriptional activation of EMT genes by Oct1, leading to invasion and metastasis [93].
Oct1 has also been identified as a transcriptional activator of the HOX genes Hoxd10 and Hoxd11, both of which are overexpressed in HNSCC primary tissues and cell lines [91]. Overexpression of these genes in HNSCC is associated with proliferation and invasion of oral keratinocytes, leading to tumor spread.
Spp1/Opn is an Oct1 target gene [19, 20]. The product of this gene, Osteopontin, is a secreted signaling protein that has been shown to be overexpressed in breast, lung, colorectal, ovarian and gastric cancers [127]. In breast cancer, Osteopontin has been shown to play a role in metastasis and tumor progression [128].
7.6 Immune regulation
Immune-modulatory targets for Oct1 are well described and are too numerous to address completely here. Although the mechanisms and implications have not been worked out for all target genes and cell types, it is clear that Oct1 regulates multiple target genes in B cells, T cells, macrophages and NK cells. These targets include cytokines (e.g., Il-2, IL-4, IL-8) [9, 129–131], pro-inflammatory mediators (e.g., CRP, NOS2/iNOS, prostaglandin D synthase) [132–134] and immunoglobulins (heavy and light chain) [4–6]. As with other systems, Oct1 appears to be dispensable for the baseline expression of many of these genes in standard assay conditions. However it has been shown that Oct1 uses the gene poising mechanism outlined in section 5.2 to maintain silent immunomodulatory targets in a configuration that allows robust expression in memory cells. Oct1 is also required in vivo for robust helper T cell memory [45].
8. Summary and future directions for the field
After decades of being studied in other guises, a broad role is emerging for Oct1 as a tumor promoter across a range of epithelial and other tumor types. What the field requires are deep and focused studies on the role of Oct1 in specific tumors, comparing, for example, Oct1 expression to established prognostic markers for the particular tumor type. A better understanding of molecular mechanisms is also required. Surveys of common and unique Oct1 transcriptional targets in normal and malignant tissue will allow greater mechanistic insights. The availability of a conditional mouse allele [45] will allow for improved study of Oct1 in pre-clinical cancer models. Determining how Oct1 itself is regulated at the transcriptional and post-transcriptional level is necessary to identify points in different regulatory pathways that can potentially be leveraged to treat disease. The Oct1 mRNA contains a particularly long (>11 kb) 3′UTR with predicted target sites for multiple tumor suppressor microRNAs, including microRNAs expressed in epithelial cells and associated with epithelial malignancies such as let-7, miR-1, -7, -34, -128 and -218. Translational down-regulation by one or more of these microRNAs could explain the documented elevated levels of Oct1 protein in cancer cells [23]. Oct1 is regulated by the tumor suppressive microRNA miR449a in liver cancer. miR449a is also associated with tumor suppression in lung and prostate cancer, suggesting that similar mechanisms may operate [135].
Another largely unexplored area is the role that human polymorphisms in Oct1 target sites may be playing in cancer or other processes. Maurano et al. coupled genome-wide analysis of DNase I hypersensitive sites (which correspond to transcription factor binding sites) in different human cells and tissues with a meta-analysis of human genome-wide association studies to identify human disease polymorphisms co-localizing with transcription factor binding sites. Oct1 binding site polymorphisms associated with bladder cancer and a variety of autoimmune syndromes were identified in this analysis [136]. The precise molecular mechanisms underpinning these associations have yet to be followed up.
A third area ripe for exploration is the possible differential role of various Oct1 isoforms in disease. The Pou2f1 gene locus is complex, with a heterogeneous 5′ end. Multiple Oct1 isoforms have been described that vary in length and sequence at the N-terminus of the protein [137].
Fourth and finally, the two most robust recent areas of Oct1 research have been in cancer and immune biology. These studies have largely proceeded in parallel with one another. Combining these heretofore largely independent research trajectories may become an important area of future work. For example, no work has thus far been conducted on the role of Oct1 in anti-tumor immune responses.
Highlights.
Part of a larger set of articles pertaining to the Oct transcription factor family
A brief history of one of these factors, Oct1/Pou2f1
Current knowledge from the standpoint of malignancy
First-ever comprehensive review regarding epithelial malignancy (a field that has really exploded in recent years)
Acknowledgments
We thank A. Welm, R. Chan and members of the Tantin laboratory for critical reading of the manuscript. This work was supported by grants from the Concern Foundation and National Institutes of Health (R01AI100873) to D.T.
Footnotes
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- 1.Gerster T, Roeder RG. A herpesvirus trans-activating protein interacts with transcription factor OTF-1 and other cellular proteins. Proc Natl Acad Sci U S A. 1988 Sep;85(17):6347–6351. doi: 10.1073/pnas.85.17.6347. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Pruijn GJM, van Driel W, van der Vliet PC. Nuclear factor III, a novel sequence-specific DNA-binding protein from HeLa cells stimulating adenovirus DNA replication. Nature. 1986 Aug;322(6080):656–659. doi: 10.1038/322656a0. [DOI] [PubMed] [Google Scholar]
- 3.Sturm R, Baumruker T, Franza BR, Herr W. A 100-kD HeLa cell octamer binding protein (OBP100) interacts differently with two separate octamer-related sequences within the SV40 enhancer. Genes Dev. 1987 Dec;1(10):1147–1160. doi: 10.1101/gad.1.10.1147. [DOI] [PubMed] [Google Scholar]
- 4.Ballard DW, Bothwell A. Mutational analysis of the immunoglobulin heavy chain promoter region. Proc Natl Acad Sci U S A. 1986 Dec;83(24):9626–9630. doi: 10.1073/pnas.83.24.9626. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Falkner FG, Zachau HG. Correct transcription of an immunoglobulin kappa gene requires an upstream fragment containing conserved sequence elements. Nature. 1984 Jul;310(5972):71–74. doi: 10.1038/310071a0. [DOI] [PubMed] [Google Scholar]
- 6.Mason JO, Williams GT, Neuberger MS. Transcription cell type specificity is conferred by an immunoglobulin VH gene promoter that includes a functional consensus sequence. Cell. 1985 Jun;41(2):479–487. doi: 10.1016/s0092-8674(85)80021-0. [DOI] [PubMed] [Google Scholar]
- 7.Sive HL, Roeder RG. Interaction of a common factor with conserved promoter and enhancer sequences in histone H2B, immunoglobulin, and U2 small nuclear RNA (snRNA) genes. Proc Natl Acad Sci U S A. 1986 Sep;83(17):6382–6386. doi: 10.1073/pnas.83.17.6382. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Tanaka M, Grossniklaus U, Herr W, Hernandez N. Activation of the U2 snRNA promoter by the octamer motif defines a new class of RNA polymerase II enhancer elements. Genes Dev. 1988 Dec;2(12b):1764–1778. doi: 10.1101/gad.2.12b.1764. [DOI] [PubMed] [Google Scholar]
- 9.Ullman KS, Flanagan WM, Edwards CA, Crabtree GR. Activation of early gene expression in T lymphocytes by Oct-1 and an inducible protein, OAP40. Science. 1991 Oct;254(5031):558–562. doi: 10.1126/science.1683003. [DOI] [PubMed] [Google Scholar]
- 10.Hentsch B, Mouzaki A, Pfeuffer I, Rungger D, Serfling E. The weak, fine-tuned binding of ubiquitous transcription factors to the Il-2 enhancer contributes to its T cell-restricted activity. Nucleic Acids Res. 1992 Jun;20(11):2657–2665. doi: 10.1093/nar/20.11.2657. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Sturm RA, Das G, Herr W. The ubiquitous octamer-binding protein Oct-1 contains a POU domain with a homeo box subdomain. Genes Dev. 1988 Dec;2(12a):1582–1599. doi: 10.1101/gad.2.12a.1582. [DOI] [PubMed] [Google Scholar]
- 12.Herr W, Sturm RA, Clerc RG, Corcoran LM, Baltimore D, Sharp PA, Ingraham HA, Rosenfeld MG, Finney M, Ruvkun G. The POU domain: a large conserved region in the mammalian pit-1, oct-1, oct-2, and Caenorhabditis elegans unc-86 gene products. Genes Dev. 1988 Dec;2(12a):1513–1516. doi: 10.1101/gad.2.12a.1513. [DOI] [PubMed] [Google Scholar]
- 13.Tantin D. Oct transcription factors in development and stem cells: insights and mechanisms. Development. 2013 Jul;140(14):2857–2866. doi: 10.1242/dev.095927. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Jin T, Branch DR, Zhang X, Qi S, Youngson B, Goss PE. Examination of POU homeobox gene expression in human breast cancer cells. Int J Cancer. 1999 Mar;81(1):104–112. doi: 10.1002/(sici)1097-0215(19990331)81:1<104::aid-ijc18>3.0.co;2-q. [DOI] [PubMed] [Google Scholar]
- 15.Qian X, Zhao FQ. Collaborative interaction of Oct-2 with Oct-1 in transactivation of lactogenic hormones-induced β-casein gene expression in mammary epithelial cells. Gen Comp Endocrinol. 2014 Aug;204:185–194. doi: 10.1016/j.ygcen.2014.05.021. [DOI] [PubMed] [Google Scholar]
- 16.Klemm JD, Rould MA, Aurora R, Herr W, Pabo CO. Crystal structure of the Oct-1 POU domain bound to an octamer site: DNA recognition with tethered DNA-binding modules. Cell. 1994 Apr;77(1):21–32. doi: 10.1016/0092-8674(94)90231-3. [DOI] [PubMed] [Google Scholar]
- 17.Eaton S, Calame K. Multiple DNA sequence elements are necessary for the function of an immunoglobulin heavy chain promoter. Proc Natl Acad Sci U S A. 1987 Nov;84(21):7634–7638. doi: 10.1073/pnas.84.21.7634. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Hori N, Nakano H, Takeuchi T, Kato H, Hamaguchi S, Oshimura M, Sato K. A Dyad Oct-binding Sequence Functions as a Maintenance Sequence for the Unmethylated State within theH19/Igf2-imprinted Control Region. J Biol Chem. 2002 Aug;277(31):27960–27967. doi: 10.1074/jbc.M202280200. [DOI] [PubMed] [Google Scholar]
- 19.Wang D, Yamamoto S, Hijiya N, Benveniste EN, Gladson CL. Transcriptional regulation of the human osteopontin promoter: functional analysis and DNA-protein interactions. 2000 Nov;19(50) doi: 10.1038/sj.onc.1203917. Publ Online 23 Novemb 2000 Doi101038sjonc1203917. [DOI] [PubMed] [Google Scholar]
- 20.Tomilin A, Reményi A, Lins K, Bak H, Leidel S, Vriend G, Wilmanns M, Schöler HR. Synergism with the Coactivator OBF-1 (OCA-B, BOB-1) Is Mediated by a Specific POU Dimer Configuration. Cell. 2000 Dec;103(6):853–864. doi: 10.1016/s0092-8674(00)00189-6. [DOI] [PubMed] [Google Scholar]
- 21.Reményi A, Tomilin A, Pohl E, Lins K, Philippsen A, Reinbold R, Schöler HR, Wilmanns M. Differential Dimer Activities of the Transcription Factor Oct-1 by DNA-Induced Interface Swapping. Mol Cell. 2001 Sep;8(3):569–580. doi: 10.1016/s1097-2765(01)00336-7. [DOI] [PubMed] [Google Scholar]
- 22.Kang J, Gemberling M, Nakamura M, Whitby FG, Handa H, Fairbrother WG, Tantin D. A general mechanism for transcription regulation by Oct1 and Oct4 in response to genotoxic and oxidative stress. Genes Dev. 2009 Jan;23(2):208–222. doi: 10.1101/gad.1750709. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Maddox J, Shakya A, South S, Shelton D, Andersen JN, Chidester S, Kang J, Gligorich KM, Jones DA, Spangrude GJ, Welm BE, Tantin D. Transcription Factor Oct1 Is a Somatic and Cancer Stem Cell Determinant. PLoS Genet. 2012 Nov;8(11):e1003048. doi: 10.1371/journal.pgen.1003048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Tantin D, Gemberling M, Callister C, Fairbrother W. High-throughput biochemical analysis of in vivo location data reveals novel distinct classes of POU5F1(Oct4)/DNA complexes. Genome Res. 2008 Apr;18(4):631–639. doi: 10.1101/gr.072942.107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Botquin V, Hess H, Fuhrmann G, Anastassiadis C, Gross MK, Vriend G, Schöler HR. New POU dimer configuration mediates antagonistic control of an osteopontin preimplantation enhancer by Oct-4 and Sox-2. Genes Dev. 1998 Jul;12(13):2073–2090. doi: 10.1101/gad.12.13.2073. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ferraris L, Stewart AP, Kang J, DeSimone AM, Gemberling M, Tantin D, Fairbrother WG. Combinatorial binding of transcription factors in the pluripotency control regions of the genome. Genome Res. 2011 Jul;21(7):1055–1064. doi: 10.1101/gr.115824.110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Verrijzer CP, van Oosterhout JA, van der Vliet PC. The Oct-1 POU domain mediates interactions between Oct-1 and other POU proteins. Mol Cell Biol. 1992 Feb;12(2):542–551. doi: 10.1128/mcb.12.2.542-551.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Bentrari F, Chantôme A, Knights A, Jeannin JF, Pance A. Oct-2 forms a complex with Oct-1 on the iNOS promoter and represses transcription by interfering with recruitment of RNA PolII by Oct-1. Nucleic Acids Res. 2015 Nov;43(20):9757–9765. doi: 10.1093/nar/gkv829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Belsham DD, Mellon PL. Transcription Factors Oct-1 and C/EBPβ (CCAAT/Enhancer-Binding Protein-β) Are Involved in the Glutamate/Nitric Oxide/cyclic-Guanosine 5′-Monophosphate-Mediated Repression of Gonadotropin-Releasing Hormone Gene Expression. Mol Endocrinol. 2000 Feb;14(2):212–228. doi: 10.1210/mend.14.2.0418. [DOI] [PubMed] [Google Scholar]
- 30.Hatada EN, Chen-Kiang S, Scheidereit C. Interaction and functional interference of C/EBPβ with octamer factors in immunoglobulin gene transcription. Eur J Immunol. 2000 Jan;30(1):174–184. doi: 10.1002/1521-4141(200001)30:1<174::AID-IMMU174>3.0.CO;2-T. [DOI] [PubMed] [Google Scholar]
- 31.Ström AC, Forsberg M, Lillhager P, Westin G. The Transcription Factors Sp1 and Oct-1 Interact Physically to Regulate Human U2 snRNA Gene Expression. Nucleic Acids Res. 1996 Jun;24(11):1981–1986. doi: 10.1093/nar/24.11.1981. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Qian X, Zhao FQ. Interactions of the ubiquitous octamer-binding transcription factor-1 with both the signal transducer and activator of transcription 5 and the glucocorticoid receptor mediate prolactin and glucocorticoid-induced β-casein gene expression in mammary epithelial cells. Int J Biochem Cell Biol. 2013 Mar;45(3):724–735. doi: 10.1016/j.biocel.2013.01.001. [DOI] [PubMed] [Google Scholar]
- 33.Magné S, Caron S, Charon M, Rouyez MC, Dusanter-Fourt I. STAT5 and Oct-1 Form a Stable Complex That Modulates Cyclin D1 Expression. Mol Cell Biol. 2003 Dec;23(24):8934–8945. doi: 10.1128/MCB.23.24.8934-8945.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Boulon S, Dantonel JC, Binet V, Vié A, Blanchard JM, Hipskind RA, Philips A. Oct-1 Potentiates CREB-Driven Cyclin D1 Promoter Activation via a Phospho-CREB- and CREB Binding Protein-Independent Mechanism. Mol Cell Biol. 2002 Nov;22(22):7769–7779. doi: 10.1128/MCB.22.22.7769-7779.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Préfontaine GG, Walther R, Giffin W, Lemieux ME, Pope L, Haché RJG. Selective Binding of Steroid Hormone Receptors to Octamer Transcription Factors Determines Transcriptional Synergism at the Mouse Mammary Tumor Virus Promoter. J Biol Chem. 1999 Sep;274(38):26713–26719. doi: 10.1074/jbc.274.38.26713. [DOI] [PubMed] [Google Scholar]
- 36.Préfontaine GG, Lemieux ME, Giffin W, Schild-Poulter C, Pope L, LaCasse E, Walker P, Haché RJG. Recruitment of Octamer Transcription Factors to DNA by Glucocorticoid Receptor. Mol Cell Biol. 1998 Jun;18(6):3416–3430. doi: 10.1128/mcb.18.6.3416. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Gonzalez MI, Robins DM. Oct-1 Preferentially Interacts with Androgen Receptor in a DNA-dependent Manner That Facilitates Recruitment of SRC-1. J Biol Chem. 2001 Mar;276(9):6420–6428. doi: 10.1074/jbc.M008689200. [DOI] [PubMed] [Google Scholar]
- 38.Perri A, Catalano S, Bonofiglio D, Vizza D, Rovito D, Qi H, Aquila S, Panza S, Rizza P, Lanzino M, Andò S. T3 enhances thyroid cancer cell proliferation through TRβ1/Oct-1-mediated cyclin D1 activation. Mol Cell Endocrinol. 2014 Jan;382(1):205–217. doi: 10.1016/j.mce.2013.10.001. [DOI] [PubMed] [Google Scholar]
- 39.Kakizawa T, Miyamoto T, Ichikawa K, Kaneko A, Suzuki S, Hara M, Nagasawa T, Takeda T, Mori J, Kumagai M, Hashizume K. Functional Interaction between Oct-1 and Retinoid X Receptor. J Biol Chem. 1999 Jul;274(27):19103–19108. doi: 10.1074/jbc.274.27.19103. [DOI] [PubMed] [Google Scholar]
- 40.van Heel DA, Udalova IA, Silva APD, McGovern DP, Kinouchi Y, Hull J, Lench NJ, Cardon LR, Carey AH, Jewell DP, Kwiatkowski D. Inflammatory bowel disease is associated with a TNF polymorphism that affects an interaction between the OCT1 and NF-κB transcription factors. Hum Mol Genet. 2002 May;11(11):1281–1289. doi: 10.1093/hmg/11.11.1281. [DOI] [PubMed] [Google Scholar]
- 41.Wang VEH, Schmidt T, Chen J, Sharp PA, Tantin D. Embryonic Lethality, Decreased Erythropoiesis, and Defective Octamer-Dependent Promoter Activation in Oct-1-Deficient Mice. Mol Cell Biol. 2004 Feb;24(3):1022–1032. doi: 10.1128/MCB.24.3.1022-1032.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Wang VEH, Tantin D, Chen J, Sharp PA. B cell development and immunoglobulin transcription in Oct-1-deficient mice. Proc Natl Acad Sci U S A. 2004 Feb;101(7):2005–2010. doi: 10.1073/pnas.0307304101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Sebastiano V, Dalvai M, Gentile L, Schubart K, Sutter J, Wu GM, Tapia N, Esch D, Ju JY, Hübner K, Bravo MJA, Schöler HR, Cavaleri F, Matthias P. Oct1 regulates trophoblast development during early mouse embryogenesis. Development. 2010 Nov;137(21):3551–3560. doi: 10.1242/dev.047027. [DOI] [PubMed] [Google Scholar]
- 44.Dalvai M, Schubart K, Besson A, Matthias P. Oct1 is required for mTOR-induced G1 cell cycle arrest via the control of p27(Kip1) expression. Cell Cycle Georget Tex. 2010 Oct;9(19):3933–3944. doi: 10.4161/cc.9.19.13154. [DOI] [PubMed] [Google Scholar]
- 45.Shakya A, Goren A, Shalek A, German CN, Snook J, Kuchroo VK, Yosef N, Chan RC, Regev A, Williams MA, Tantin D. Oct1 and OCA-B are selectively required for CD4 memory T cell function. J Exp Med. 2015 Oct;:jem.20150363. doi: 10.1084/jem.20150363. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46.Shakya A, Cooksey R, Cox JE, Wang V, McClain DA, Tantin D. Oct1 loss of function induces a coordinate metabolic shift that opposes tumorigenicity. Nat Cell Biol. 2009 Mar;11(3):320–327. doi: 10.1038/ncb1840. [DOI] [PubMed] [Google Scholar]
- 47.Tantin D, Schild-Poulter C, Wang V, Haché RJG, Sharp PA. The Octamer Binding Transcription Factor Oct-1 Is a Stress Sensor. Cancer Res. 2005 Dec;65(23):10750–10758. doi: 10.1158/0008-5472.CAN-05-2399. [DOI] [PubMed] [Google Scholar]
- 48.Takahashi S, Saito S, Ohtani N, Sakai T. Involvement of the Oct-1 Regulatory Element of the gadd45 Promoter in the p53-independent Response to Ultraviolet Irradiation. Cancer Res. 2001 Feb;61(3):1187–1195. [PubMed] [Google Scholar]
- 49.Jin S, Fan F, Fan W, Zhao H, Tong T, Blanck P, Alomo I, Rajasekaran B, Zhan Q. Transcription factors Oct-1 and NF-YA regulate the p53-independent induction of the GADD45 following DNA damage. Oncogene. 2001 May;20(21):2683–2690. doi: 10.1038/sj.onc.1204390. [DOI] [PubMed] [Google Scholar]
- 50.Hirose T, Sowa Y, Takahashi S, Saito S, Yasuda C, Shindo N, Furuichi K, Sakai T. p53-independent induction of Gadd45 by histone deacetylase inhibitor: coordinate regulation by transcription factors Oct-1 and NF-Y. Oncogene. 2003 Oct;22(49):7762–7773. doi: 10.1038/sj.onc.1207091. [DOI] [PubMed] [Google Scholar]
- 51.Bellance N, Pabst L, Allen G, Rossignol R, Nagrath D. Oncosecretomics coupled to bioenergetics identifies α-amino adipic acid, isoleucine and GABA as potential biomarkers of cancer: Differential expression of c-Myc, Oct1 and KLF4 coordinates metabolic changes. Biochim Biophys Acta BBA - Bioenerg. 2012 Nov;1817(11):2060–2071. doi: 10.1016/j.bbabio.2012.07.004. [DOI] [PubMed] [Google Scholar]
- 52.Kang J, Shen Z, Lim JM, Handa H, Wells L, Tantin D. Regulation of Oct1/Pou2f1 transcription activity by O-GlcNAcylation. FASEB J. 2013 Jul;27(7):2807–2817. doi: 10.1096/fj.12-220897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53.Malhas AN, Lee CF, Vaux DJ. Lamin B1 controls oxidative stress responses via Oct-1. J Cell Biol. 2009 Jan;184(1):45–55. doi: 10.1083/jcb.200804155. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Kang HB, Fan J, Lin R, Elf S, Ji Q, Zhao L, Jin L, Seo JH, Shan C, Arbiser JL, Cohen C, Brat D, Miziorko HM, Kim E, Abdel-Wahab O, Merghoub T, Fröhling S, Scholl C, Tamayo P, Barbie DA, Zhou L, Pollack BP, Fisher K, Kudchadkar RR, Lawson DH, Sica G, Rossi M, Lonial S, Khoury HJ, Khuri FR, Lee BH, Boggon TJ, He C, Kang S, Chen J. Metabolic Rewiring by Oncogenic BRAF V600E Links Ketogenesis Pathway to BRAF-MEK1 Signaling. Mol Cell. 2015 Aug;59(3):345–358. doi: 10.1016/j.molcel.2015.05.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55.Kang J, Goodman B, Zheng Y, Tantin D. Dynamic Regulation of Oct1 during Mitosis by Phosphorylation and Ubiquitination. PLoS ONE. 2011 Aug;6(8):e23872. doi: 10.1371/journal.pone.0023872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56.Ansari KI, Ogawa D, Rooj AK, Lawler SE, Krichevsky AM, Johnson MD, Chiocca EA, Bronisz A, Godlewski J. Glucose-Based Regulation of miR-451/AMPK Signaling Depends on the OCT1 Transcription Factor. Cell Rep. 2015 May;11(6):902–909. doi: 10.1016/j.celrep.2015.04.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Schild-Poulter C, Shih A, Tantin D, Yarymowich NC, Soubeyrand S, Sharp PA, Haché RJG. DNA-PK phosphorylation sites on Oct-1 promote cell survival following DNA damage. Oncogene. 2007 Jan;26(27):3980–3988. doi: 10.1038/sj.onc.1210165. [DOI] [PubMed] [Google Scholar]
- 58.Van Hoof D, Muñoz J, Braam SR, Pinkse MWH, Linding R, Heck AJR, Mummery CL, Krijgsveld J. Phosphorylation Dynamics during Early Differentiation of Human Embryonic Stem Cells. Cell Stem Cell. 2009 Aug;5(2):214–226. doi: 10.1016/j.stem.2009.05.021. [DOI] [PubMed] [Google Scholar]
- 59.Reim J, Bader GD. Systematic analysis of somatic mutations in phosphorylation signaling predicts novel cancer drivers. Mol Syst Biol. 2013;9:637. doi: 10.1038/msb.2012.68. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Bertolino E, Singh H. POU/TBP Cooperativity: A Mechanism for Enhancer Action from a Distance. Mol Cell. 2002 Aug;10(2):397–407. doi: 10.1016/s1097-2765(02)00597-x. [DOI] [PubMed] [Google Scholar]
- 61.Inamoto S, Segil N, Pan ZQ, Kimura M, Roeder RG. The Cyclin-dependent Kinase-activating Kinase (CAK) Assembly Factor, MAT1, Targets and Enhances CAK Activity on the POU Domains of Octamer Transcription Factors. J Biol Chem. 1997 Nov;272(47):29852–29858. doi: 10.1074/jbc.272.47.29852. [DOI] [PubMed] [Google Scholar]
- 62.Reveneau S, Petrakis TG, Goldring CE, Chantôme A, Jeannin JF, Pance A. Oct-1 cooperates with the TATA binding initiation complex to control rapid transcription of human iNOS. Cell Mol Life Sci. 2012 Feb;69(15):2609–2619. doi: 10.1007/s00018-012-0939-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63.Shakya A, Kang J, Chumley J, Williams MA, Tantin D. Oct1 Is a Switchable, Bipotential Stabilizer of Repressed and Inducible Transcriptional States. J Biol Chem. 2011 Jan;286(1):450–459. doi: 10.1074/jbc.M110.174045. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64.Zhang Y, Ng HH, Erdjument-Bromage H, Tempst P, Bird A, Reinberg D. Analysis of the NuRD subunits reveals a histone deacetylase core complex and a connection with DNA methylation. Genes Dev. 1999 Aug;13(15):1924–1935. doi: 10.1101/gad.13.15.1924. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65.Xue Y, Wong J, Moreno GT, Young MK, Côté J, Wang W. NURD, a Novel Complex with Both ATP-Dependent Chromatin-Remodeling and Histone Deacetylase Activities. Mol Cell. 1998 Dec;2(6):851–861. doi: 10.1016/s1097-2765(00)80299-3. [DOI] [PubMed] [Google Scholar]
- 66.Tong JK, Hassig CA, Schnitzler GR, Kingston RE, Schreiber SL. Chromatin deacetylation by an ATP-dependent nucleosome remodelling complex. Nature. 1998 Oct;395(6705):917–921. doi: 10.1038/27699. [DOI] [PubMed] [Google Scholar]
- 67.Imai S, Nishibayashi S, Takao K, Tomifuji M, Fujino T, Hasegawa M, Takano T. Dissociation of Oct-1 from the Nuclear Peripheral Structure Induces the Cellular Aging-associated Collagenase Gene Expression. Mol Biol Cell. 1997 Dec;8(12):2407–2419. doi: 10.1091/mbc.8.12.2407. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68.Guelen L, Pagie L, Brasset E, Meuleman W, Faza MB, Talhout W, Eussen BH, de Klein A, Wessels L, de Laat W, van Steensel B. Domain organization of human chromosomes revealed by mapping of nuclear lamina interactions. Nature. 2008 Jun;453(7197):948–951. doi: 10.1038/nature06947. [DOI] [PubMed] [Google Scholar]
- 69.Wang P, Jin T. Hydrogen peroxide stimulates nuclear import of the POU homeodomain protein Oct-1 and its repressive effect on the expression of Cdx-2. BMC Cell Biol. 2010 Jul;11(1):56. doi: 10.1186/1471-2121-11-56. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70.Wang P, Wang Q, Sun J, Wu J, Li H, Zhang N, Huang Y, Su B, Li R, Liu L, Zhang Y, Elsholtz HP, Hu J, Gaisano HY, Jin T. POU Homeodomain Protein Oct-1 Functions as a Sensor for Cyclic AMP. J Biol Chem. 2009 Sep;284(39):26456–26465. doi: 10.1074/jbc.M109.030668. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71.Kim LK, Esplugues E, Zorca CE, Parisi F, Kluger Y, Kim TH, Galjart NJ, Flavell RA. Oct-1 Regulates IL-17 Expression by Directing Interchromosomal Associations in Conjunction with CTCF in T Cells. Mol Cell. 2014 Apr;54(1):56–66. doi: 10.1016/j.molcel.2014.02.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72.García-Cosío M, Santón A, Martín P, Camarasa N, Montalbán C, García JF, Bellas C. Analysis of transcription factor OCT.1, OCT.2 and BOB.1 expression using tissue arrays in classical Hodgkin’s lymphoma. Mod Pathol. 2004 Jul;17(12):1531–1538. doi: 10.1038/modpathol.3800227. [DOI] [PubMed] [Google Scholar]
- 73.Schreiber E, Merchant RE, Wiestler OD, Fontana A. Primary brain tumors differ in their expression of octamer deoxyribonucleic acid-binding transcription factors from long-term cultured glioma cell lines. Neurosurgery. 1994 Jan;34(1):129–135. [PubMed] [Google Scholar]
- 74.Thomson JA, Parsons PG, Sturm RA. In vivo and in vitro expression of octamer binding proteins in human melanoma metastases, brain tissue, and fibroblasts. Pigment Cell Res Spons Eur Soc Pigment Cell Res Int Pigment Cell Soc. 1993 Feb;6(1):13–22. doi: 10.1111/j.1600-0749.1993.tb00576.x. [DOI] [PubMed] [Google Scholar]
- 75.DeSantis CE, Lin CC, Mariotto AB, Siegel RL, Stein KD, Kramer JL, Alteri R, Robbins AS, Jemal A. Cancer treatment and survivorship statistics, 2014. CA Cancer J Clin. 2014 Jul;64(4):252–271. doi: 10.3322/caac.21235. [DOI] [PubMed] [Google Scholar]
- 76.Cancer Statistics Review, 1975–2012 - SEER Statistics. [Online]. Available: http://seer.cancer.gov/csr/1975_2012/. [Accessed: 23-Oct-2015]
- 77.Tumorscape. [Online]. Available: http://www.broadinstitute.org/tumorscape/pages/portalHome.jsf. [Accessed: 04-Oct-2015]
- 78.Qian J, Kong X, Deng N, Tan P, Chen H, Wang J, Li Z, Hu Y, Zou W, Xu J, Fang JY. OCT1 is a determinant of synbindin-related ERK signalling with independent prognostic significance in gastric cancer. Gut. 2015 Jan;64(1):37–48. doi: 10.1136/gutjnl-2013-306584. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79.Chen X, Leung SY, Yuen ST, Chu KM, Ji J, Li R, Chan ASY, Law S, Troyanskaya OG, Wong J, So S, Botstein D, Brown PO. Variation in Gene Expression Patterns in Human Gastric Cancers. Mol Biol Cell. 2003 Aug;14(8):3208–3215. doi: 10.1091/mbc.E02-12-0833. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80.Wang J, Yang YH, Wang AQ, Yao B, Xie G, Feng G, Zhang Y, Cheng ZS, Hui L, Dai TZ, Du XB, Wang D. Immunohistochemical detection of the Raf kinase inhibitor protein in nonneoplastic gastric tissue and gastric cancer tissue. Med Oncol. 2009 Mar;27(2):219–223. doi: 10.1007/s12032-009-9194-z. [DOI] [PubMed] [Google Scholar]
- 81.D’Errico M, de Rinaldis E, Blasi MF, Viti V, Falchetti M, Calcagnile A, Sera F, Saieva C, Ottini L, Palli D, Palombo F, Giuliani A, Dogliotti E. Genome-wide expression profile of sporadic gastric cancers with microsatellite instability. Eur J Cancer. 2009 Feb;45(3):461–469. doi: 10.1016/j.ejca.2008.10.032. [DOI] [PubMed] [Google Scholar]
- 82.Wang Y, Song G, Chen J, Xiao C, Li C, Zhong L, Sun X, Wang Z, Deng G, Yu F, Xue Y, Tang H, Peng Z, Wang X. Elevated OCT1 participates in colon tumorigenesis and independently predicts poor prognoses of colorectal cancer patients. Tumor Biol. 2015 Oct;:1–9. doi: 10.1007/s13277-015-4080-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 83.Oncomine Main. [Online]. Available: https://www.oncomine.org/resource/main.html#a%3A1830%3Bd%3A22218696%3Bdso%3AgeneOverex%3Bdt%3ApredefinedClass%3Bec%3A%5B2%5D%3Bepv%3A150001.151078%2C3508%3Bet%3Aover%3Bf%3A542580%3Bg%3A5451%3Bp%3A200001281%3Bpg%3A1%3Bpvf%3A2938%2C31927%2C150004%3Bscr%3Adatasets%3Bss%3Aanalysis%3Bth%3Ag100.0%2Cp1.000%2Cfc0.0%3Bv %3A18. [Accessed: 15-Oct-2015]
- 84.Lee JS, Leem SH, Lee SY, Kim SC, Park ES, Kim SB, Kim SK, Kim YJ, Kim WJ, Chu IS. Expression Signature of E2F1 and Its Associated Genes Predict Superficial to Invasive Progression of Bladder Tumors. J Clin Oncol. 2010 Jun;28(16):2660–2667. doi: 10.1200/JCO.2009.25.0977. [DOI] [PubMed] [Google Scholar]
- 85.Sanchez-Carbayo M, Socci ND, Lozano J, Saint F, Cordon-Cardo C. Defining Molecular Profiles of Poor Outcome in Patients With Invasive Bladder Cancer Using Oligonucleotide Microarrays. J Clin Oncol. 2006 Feb;24(5):778–789. doi: 10.1200/JCO.2005.03.2375. [DOI] [PubMed] [Google Scholar]
- 86.Dyrskjøt L, Kruhøffer M, Thykjaer T, Marcussen N, Jensen JL, Møller K, Ørntoft TF. Gene Expression in the Urinary Bladder A Common Carcinoma in Situ Gene Expression Signature Exists Disregarding Histopathological Classification. Cancer Res. 2004 Jun;64(11):4040–4048. doi: 10.1158/0008-5472.CAN-03-3620. [DOI] [PubMed] [Google Scholar]
- 87.Finak G, Bertos N, Pepin F, Sadekova S, Souleimanova M, Zhao H, Chen H, Omeroglu G, Meterissian S, Omeroglu A, Hallett M, Park M. Stromal gene expression predicts clinical outcome in breast cancer. Nat Med. 2008 May;14(5):518–527. doi: 10.1038/nm1764. [DOI] [PubMed] [Google Scholar]
- 88.Zhao H, Langerød A, Ji Y, Nowels KW, Nesland JM, Tibshirani R, Bukholm IK, Kåresen R, Botstein D, Børresen-Dale AL, Jeffrey SS. Different Gene Expression Patterns in Invasive Lobular and Ductal Carcinomas of the Breast. Mol Biol Cell. 2004 Jun;15(6):2523–2536. doi: 10.1091/mbc.E03-11-0786. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 89.Curtis C, Shah SP, Chin SF, Turashvili G, Rueda OM, Dunning MJ, Speed D, Lynch AG, Samarajiwa S, Yuan Y, Gräf S, Ha G, Haffari G, Bashashati A, Russell R, McKinney S, Metabric Group. Langerød A, Green A, Provenzano E, Wishart G, Pinder S, Watson P, Markowetz F, Murphy L, Ellis I, Purushotham A, Børresen-Dale AL, Brenton JD, Tavaré S, Caldas C, Aparicio S. The genomic and transcriptomic architecture of 2,000 breast tumours reveals novel subgroups. Nature. 2012 Jun;486(7403):346–352. doi: 10.1038/nature10983. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 90.Xiao S, Liao S, Zhou Y, Jiang B, Li Y, Xue M. High expression of octamer transcription factor 1 in cervical cancer. Oncol Lett. 2014 Jun;7(6):1889–1894. doi: 10.3892/ol.2014.2023. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 91.Sharpe DJ, Orr KS, Moran M, White SJ, McQuaid S, Lappin TR, Thompson A, James JA. POU2F1 activity regulates HOXD10 and HOXD11 promoting a proliferative and invasive phenotype in Head and Neck cancer. Oncotarget. 2014 Sep;5(18):8803–8815. doi: 10.18632/oncotarget.2492. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 92.Xu SH, Huang JZ, Xu ML, Yu G, Yin XF, Chen D, Yan GR. ACK1 promotes gastric cancer epithelial–mesenchymal transition and metastasis through AKT–POU2F1–ECD signalling. J Pathol. 2015 Jun;236(2):175–185. doi: 10.1002/path.4515. [DOI] [PubMed] [Google Scholar]
- 93.Hwang-Verslues WW, Chang PH, Jeng YM, Kuo WH, Chiang PH, Chang YC, Hsieh TH, Su FY, Lin LC, Abbondante S, Yang CY, Hsu HM, Yu JC, Chang KJ, Shew JY, Lee EYHP, Lee WH. Loss of corepressor PER2 under hypoxia up-regulates OCT1-mediated EMT gene expression and enhances tumor malignancy. Proc Natl Acad Sci. 2013 Jul;110(30):12331–12336. doi: 10.1073/pnas.1222684110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 94.Almeida R, Almeida J, Shoshkes M, Mendes N, Mesquita P, Silva E, Van Seuningen I, Reis CA, Santos-Silva F, David L. OCT-1 is over-expressed in intestinal metaplasia and intestinal gastric carcinomas and binds to, but does not transactivate, CDX2 in gastric cells. J Pathol. 2005 Dec;207(4):396–401. doi: 10.1002/path.1861. [DOI] [PubMed] [Google Scholar]
- 95.Jeong SH, Lee YJ, Cho BI, Ha WS, Choi SK, Jung EJ, Ju YT, Jeong CY, Ko GH, Yoo J, Hong SC. OCT-1 overexpression is associated with poor prognosis in patients with well-differentiated gastric cancer. Tumor Biol. 2014 Feb;35(6):5501–5509. doi: 10.1007/s13277-014-1724-4. [DOI] [PubMed] [Google Scholar]
- 96.Hernández P, Solé X, Valls J, Moreno V, Capellá G, Urruticoechea A, Pujana MA. Integrative analysis of a cancer somatic mutome. Mol Cancer. 2007 Feb;6(1):13. doi: 10.1186/1476-4598-6-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 97.Li Y, Dong M, Kong F, Zhou J. Octamer transcription factor 1 mediates epithelial-mesenchymal transition in colorectal cancer. Tumor Biol. 2015 Jul;:1–6. doi: 10.1007/s13277-015-3766-7. [DOI] [PubMed] [Google Scholar]
- 98.Obinata D, Takayama K, Urano T, Murata T, Kumagai J, Fujimura T, Ikeda K, Horie-Inoue K, Homma Y, Ouchi Y, Takahashi S, Inoue S. Oct1 regulates cell growth of LNCaP cells and is a prognostic factor for prostate cancer. Int J Cancer. 2012 Mar;130(5):1021–1028. doi: 10.1002/ijc.26043. [DOI] [PubMed] [Google Scholar]
- 99.Kalamohan K, Periasamy J, Bhaskar Rao D, Barnabas GD, Ponnaiyan S, Ganesan K. Transcriptional coexpression network reveals the involvement of varying stem cell features with different dysregulations in different gastric cancer subtypes. Mol Oncol. 2014 Oct;8(7):1306–1325. doi: 10.1016/j.molonc.2014.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 100.Reymann S, Borlak J. Transcription profiling of lung adenocarcinomas of c-myc-transgenic mice: Identification of the c-myc regulatory gene network. BMC Syst Biol. 2008 May;2(1):46. doi: 10.1186/1752-0509-2-46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 101.Ben-Porath I, Thomson MW, Carey VJ, Ge R, Bell GW, Regev A, Weinberg RA. An embryonic stem cell–like gene expression signature in poorly differentiated aggressive human tumors. Nat Genet. 2008 May;40(5):499–507. doi: 10.1038/ng.127. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 102.Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, Teague J, Woffendin H, Garnett MJ, Bottomley W, Davis N, Dicks E, Ewing R, Floyd Y, Gray K, Hall S, Hawes R, Hughes J, Kosmidou V, Menzies A, Mould C, Parker A, Stevens C, Watt S, Hooper S, Wilson R, Jayatilake H, Gusterson BA, Cooper C, Shipley J, Hargrave D, Pritchard-Jones K, Maitland N, Chenevix-Trench G, Riggins GJ, Bigner DD, Palmieri G, Cossu A, Flanagan A, Nicholson A, Ho JWC, Leung SY, Yuen ST, Weber BL, Seigler HF, Darrow TL, Paterson H, Marais R, Marshall CJ, Wooster R, Stratton MR, Futreal PA. Mutations of the BRAF gene in human cancer. Nature. 2002 Jun;417(6892):949–954. doi: 10.1038/nature00766. [DOI] [PubMed] [Google Scholar]
- 103.Forbes SA, Beare D, Gunasekaran P, Leung K, Bindal N, Boutselakis H, Ding M, Bamford S, Cole C, Ward S, Kok CY, Jia M, De T, Teague JW, Stratton MR, McDermott U, Campbell PJ. COSMIC: exploring the world’s knowledge of somatic mutations in human cancer. Nucleic Acids Res. 2015 Jan;43(Database issue):D805–811. doi: 10.1093/nar/gku1075. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 104.Brockman JL, Schuler LA. Prolactin signals via Stat5 and Oct-1 to the proximal cyclin D1 promoter. Mol Cell Endocrinol. 2005 Jul;239(1–2):45–53. doi: 10.1016/j.mce.2005.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 105.Tang HR, Luo XQ, Xu G, Wang Y, Feng ZJ, Xu H, Shi YW, Zhang Q, Wu LG, Xue CQ, Wang CW, Wu CY. High mobility group-box 3 overexpression is associated with poor prognosis of resected gastric adenocarcinoma. World J Gastroenterol. 2012 Dec;18(48):7319–7326. doi: 10.3748/wjg.v18.i48.7319. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 106.Hoffman B, Liebermann DA. Gadd45 in Modulation of Solid Tumors and Leukemia. In: Liebermann DA, Hoffman B, editors. Gadd45 Stress Sensor Genes. Springer; New York: 2013. pp. 21–33. [DOI] [PubMed] [Google Scholar]
- 107.Salvador JM, Brown-Clay JD, A JF., Jr . Gadd45 in Stress Signaling, Cell Cycle Control, and Apoptosis. In: Liebermann DA, Hoffman B, editors. Gadd45 Stress Sensor Genes. Springer; New York: 2013. pp. 1–19. [DOI] [PubMed] [Google Scholar]
- 108.Mancini M, Leo E, Aluigi M, Marcozzi C, Borsi E, Barbieri E, Santucci MA. Gadd45a transcriptional induction elicited by the Aurora kinase inhibitor MK-0457 in Bcr-Abl-expressing cells is driven by Oct-1 transcription factor. Leuk Res. 2012 Aug;36(8):1028–1034. doi: 10.1016/j.leukres.2012.03.025. [DOI] [PubMed] [Google Scholar]
- 109.Fan W, Jin S, Tong T, Zhao H, Fan F, Antinore MJ, Rajasekaran B, Wu M, Zhan Q. BRCA1 Regulates GADD45 through Its Interactions with the OCT-1 and CAAT Motifs. J Biol Chem. 2002 Mar;277(10):8061–8067. doi: 10.1074/jbc.M110225200. [DOI] [PubMed] [Google Scholar]
- 110.Harte MT, O’Brien GJ, Ryan NM, Gorski JJ, Savage KI, Crawford NT, Mullan PB, Harkin DP. BRD7, a Subunit of SWI/SNF Complexes, Binds Directly to BRCA1 and Regulates BRCA1-Dependent Transcription. Cancer Res. 2010 Mar;70(6):2538–2547. doi: 10.1158/0008-5472.CAN-09-2089. [DOI] [PubMed] [Google Scholar]
- 111.Bhar A, Haubrock M, Mukhopadhyay A, Maulik U, Bandyopadhyay S, Wingender E. Coexpression and coregulation analysis of time-series gene expression data in estrogen-induced breast cancer cell. Algorithms Mol Biol. 2013;8:9. doi: 10.1186/1748-7188-8-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 112.Hosey AM, Gorski JJ, Murray MM, Quinn JE, Chung WY, Stewart GE, James CR, Farragher SM, Mulligan JM, Scott AN, Dervan PA, Johnston PG, Couch FJ, Daly PA, Kay E, McCann A, Mullan PB, Harkin DP. Molecular basis for estrogen receptor alpha deficiency in BRCA1-linked breast cancer. J Natl Cancer Inst. 2007 Nov;99(22):1683–1694. doi: 10.1093/jnci/djm207. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 113.Wang RH, Yu H, Deng CX. A requirement for breast-cancer-associated gene 1 (BRCA1) in the spindle checkpoint. Proc Natl Acad Sci U S A. 2004 Dec;101(49):17108–17113. doi: 10.1073/pnas.0407585101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 114.Saha T, Rih JK, Roy R, Ballal R, Rosen EM. Transcriptional Regulation of the Base Excision Repair Pathway by BRCA1. J Biol Chem. 2010 Jun;285(25):19092–19105. doi: 10.1074/jbc.M110.104430. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 115.Luo X, Huang Y, Sheikh MS. Cloning and characterization of a novel gene PDRG that is differentially regulated by p53 and ultraviolet radiation. Oncogene. 2003;22(46):7247–7257. doi: 10.1038/sj.onc.1207010. [DOI] [PubMed] [Google Scholar]
- 116.Cairns RA, Harris IS, Mak TW. Regulation of cancer cell metabolism. Nat Rev Cancer. 2011 Feb;11(2):85–95. doi: 10.1038/nrc2981. [DOI] [PubMed] [Google Scholar]
- 117.Bonnet S, Archer SL, Allalunis-Turner J, Haromy A, Beaulieu C, Thompson R, Lee CT, Lopaschuk GD, Puttagunta L, Bonnet S, Harry G, Hashimoto K, Porter CJ, Andrade MA, Thebaud B, Michelakis ED. A Mitochondria-K+ Channel Axis Is Suppressed in Cancer and Its Normalization Promotes Apoptosis and Inhibits Cancer Growth. Cancer Cell. 2007 Jan;11(1):37–51. doi: 10.1016/j.ccr.2006.10.020. [DOI] [PubMed] [Google Scholar]
- 118.Muñoz J, Stange DE, Schepers AG, van de Wetering M, Koo BK, Itzkovitz S, Volckmann R, Kung KS, Koster J, Radulescu S, Myant K, Versteeg R, Sansom OJ, van Es JH, Barker N, van Oudenaarden A, Mohammed S, Heck AJR, Clevers H. The Lgr5 intestinal stem cell signature: robust expression of proposed quiescent ‘+4’ cell markers. EMBO J. 2012 Jul;31(14):3079–3091. doi: 10.1038/emboj.2012.166. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 119.Bane A, Viloria-Petit A, Pinnaduwage D, Mulligan AM, O’Malley FP, Andrulis IL. Clinical-pathologic significance of cancer stem cell marker expression in familial breast cancers. Breast Cancer Res Treat. 2013 Jul;140(1):195–205. doi: 10.1007/s10549-013-2591-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 120.Diehn M, Cho RW, Lobo NA, Kalisky T, Dorie MJ, Kulp AN, Qian D, Lam JS, Ailles LE, Wong M, Joshua B, Kaplan MJ, Wapnir I, Dirbas FM, Somlo G, Garberoglio C, Paz B, Shen J, Lau SK, Quake SR, Brown JM, Weissman IL, Clarke MF. Association of reactive oxygen species levels and radioresistance in cancer stem cells. Nature. 2009 Apr;458(7239):780–783. doi: 10.1038/nature07733. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 121.Phillips TM, McBride WH, Pajonk F. The response of CD24(−/low)/CD44+ breast cancer-initiating cells to radiation. J Natl Cancer Inst. 2006 Dec;98(24):1777–1785. doi: 10.1093/jnci/djj495. [DOI] [PubMed] [Google Scholar]
- 122.Bao S, Wu Q, McLendon RE, Hao Y, Shi Q, Hjelmeland AB, Dewhirst MW, Bigner DD, Rich JN. Glioma stem cells promote radioresistance by preferential activation of the DNA damage response. Nature. 2006 Dec;444(7120):756–760. doi: 10.1038/nature05236. [DOI] [PubMed] [Google Scholar]
- 123.Durmus S, Hendrikx JJMA, Schinkel AH. Chapter one - Apical ABC Transporters and Cancer Chemotherapeutic Drug Disposition. In: S JD, Ishikawa T, editors. Advances in Cancer Research. Vol. 125. Academic Press; 2015. pp. 1–41. [DOI] [PubMed] [Google Scholar]
- 124.Charafe-Jauffret E, Ginestier C, Iovino F, Wicinski J, Cervera N, Finetti P, Hur MH, Diebel ME, Monville F, Dutcher J, Brown M, Viens P, Xerri L, Bertucci F, Stassi G, Dontu G, Birnbaum D, Wicha MS. Breast Cancer Cell Lines Contain Functional Cancer Stem Cells with Metastatic Capacity and a Distinct Molecular Signature. Cancer Res. 2009 Feb;69(4):1302–1313. doi: 10.1158/0008-5472.CAN-08-2741. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 125.Gupta GP, Perk J, Acharyya S, de Candia P, Mittal V, Todorova-Manova K, Gerald WL, Brogi E, Benezra R, Massagué J. ID genes mediate tumor reinitiation during breast cancer lung metastasis. Proc Natl Acad Sci U S A. 2007 Dec;104(49):19506–19511. doi: 10.1073/pnas.0709185104. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 126.Li F, Tiede B, Massagué J, Kang Y. Beyond tumorigenesis: cancer stem cells in metastasis. Cell Res. 2007 Jan;17(1):3–14. doi: 10.1038/sj.cr.7310118. [DOI] [PubMed] [Google Scholar]
- 127.Rodrigues LR, Teixeira JA, Schmitt FL, Paulsson M, Lindmark-Mänsson H. The Role of Osteopontin in Tumor Progression and Metastasis in Breast Cancer. Cancer Epidemiol Biomarkers Prev. 2007 Jun;16(6):1087–1097. doi: 10.1158/1055-9965.EPI-06-1008. [DOI] [PubMed] [Google Scholar]
- 128.Tuck AB, Elliott BE, Hota C, Tremblay E, Chambers AF. Osteopontin-induced, integrin-dependent migration of human mammary epithelial cells involves activation of the hepatocyte growth factor receptor (Met) J Cell Biochem. 2000 Sep;78(3):465–475. doi: 10.1002/1097-4644(20000901)78:3<465::aid-jcb11>3.0.co;2-c. [DOI] [PubMed] [Google Scholar]
- 129.Pfeuffer I, Klein-Hessling S, Heinfling A, Chuvpilo S, Escher C, Brabletz T, Hentsch B, Schwarzenbach H, Matthias P, Serfling E. Octamer factors exert a dual effect on the IL-2 and IL-4 promoters. J Immunol. 1994 Dec;153(12):5572–5585. [PubMed] [Google Scholar]
- 130.Cron RQ, Zhou B, Brunvand MW, Lewis DB. Octamer proteins inhibit IL-4 gene transcription in normal human CD4 T cells. Genes Immun. 2001 Dec;2(8):464–468. doi: 10.1038/sj.gene.6363811. [DOI] [PubMed] [Google Scholar]
- 131.Kaushansky K, Shoemaker SG, O’Rork CA, McCarty JM. Coordinate regulation of multiple human lymphokine genes by Oct-1 and potentially novel 45 and 43 kDa polypeptides. J Immunol. 1994 Feb;152(4):1812–1820. [PubMed] [Google Scholar]
- 132.Voleti B, Agrawal A. Regulation of Basal and Induced Expression of C-Reactive Protein through an Overlapping Element for OCT-1 and NF-κB on the Proximal Promoter. J Immunol. 2005 Sep;175(5):3386–3390. doi: 10.4049/jimmunol.175.5.3386. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 133.Kim YM, Ko CB, Park YP, Kim YJ, Paik SG. Octamer Motif and Downstream NF-κB-mediated Induction of the Inducible Nitric Oxide Synthase Gene Expression in RAW 264.7 Macrophages. Mol Cells. 1999 Feb;9(1):99–109. [PubMed] [Google Scholar]
- 134.Fujimori K, Kanaoka Y, Sakaguchi Y, Urade Y. Transcriptional Activation of the Human Hematopoietic Prostaglandin D Synthase Gene in Megakaryoblastic Cells ROLES OF THE Oct-1 ELEMENT IN THE 5′-FLANKING REGION AND THE AP-2 ELEMENT IN THE UNTRANSLATED EXON 1. J Biol Chem. 2000 Dec;275(51):40511–40516. doi: 10.1074/jbc.M007688200. [DOI] [PubMed] [Google Scholar]
- 135.Liu Y, Wang Y, Sun X, Mei C, Wang L, Li Z, Zha X. miR-449a promotes liver cancer cell apoptosis by down-regulation of Calpain6 and POU2F1. Oncotarget. 2015 Aug; doi: 10.18632/oncotarget.4821. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 136.Maurano MT, Humbert R, Rynes E, Thurman RE, Haugen E, Wang H, Reynolds AP, Sandstrom R, Qu H, Brody J, Shafer A, Neri F, Lee K, Kutyavin T, Stehling-Sun S, Johnson AK, Canfield TK, Giste E, Diegel M, Bates D, Hansen RS, Neph S, Sabo PJ, Heimfeld S, Raubitschek A, Ziegler S, Cotsapas C, Sotoodehnia N, Glass I, Sunyaev SR, Kaul R, Stamatoyannopoulos JA. Systematic localization of common disease-associated variation in regulatory DNA. Science. 2012 Sep;337(6099):1190–1195. doi: 10.1126/science.1222794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 137.Pankratova EV, Deyev IE, Zhenilo SV, Polanovsky OL. Tissue-specific isoforms of the ubiquitous transcription factor Oct-1. Mol Genet Genomics MGG. 2001 Oct;266(2):239–245. doi: 10.1007/s004380100549. [DOI] [PubMed] [Google Scholar]
- 138.Daub H, Olsen JV, Bairlein M, Gnad F, Oppermann FS, Körner R, Greff Z, Kéri G, Stemmann O, Mann M. Kinase-selective enrichment enables quantitative phosphoproteomics of the kinome across the cell cycle. Mol Cell. 2008 Aug;31(3):438–448. doi: 10.1016/j.molcel.2008.07.007. [DOI] [PubMed] [Google Scholar]
- 139.Dephoure N, Zhou C, Villén J, Beausoleil SA, Bakalarski CE, Elledge SJ, Gygi SP. A quantitative atlas of mitotic phosphorylation. Proc Natl Acad Sci U S A. 2008 Aug;105(31):10762–10767. doi: 10.1073/pnas.0805139105. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 140.Segil N, Roberts SB, Heintz N. Mitotic phosphorylation of the Oct-1 homeodomain and regulation of Oct-1 DNA binding activity. Science. 1991 Dec;254(5039):1814–1816. doi: 10.1126/science.1684878. [DOI] [PubMed] [Google Scholar]
