Abstract
Background
Nuclear receptor subfamily 1, group H, member 3 (NR1H3, an alias for Liver X receptor α, LXRα) is a member of the LXR nuclear receptor super family and is an important regulator of lipid and fatty acid accumulation in the liver, adipose and skeletal muscle.
Methods
In this study, single-nucleotide polymorphisms (SNPs) from six populations of pig (Sus scrofa) were screened by PCR-sequencing and genotyped, and its association with backfat thickness was analyzed in a population of New Huai line (NHP, n = 117). In addition, quantitative real-time PCR and western blot were used to measure expression of NR1H3 in the liver tissue, backfat and longissimus dorsi muscle of DSP (n = 10), TP (n = 10) and YY (n = 10) pigs.
Results
Three SNPs (exon2-C105T, exon2-G106C, and exon5-A201C) were screened and exon5-A201C was identified; the genotype frequencies were significantly different between indigenous and introduced breeds. The CC genotype was associated with higher backfat thickness than the AA and AC genotypes in the NYP. NR1H3 mRNA and protein expression were higher in the liver and longissimus dorsi of DSP and TP than in those of YY. This increased NR1H3 expression might be associated with higher lipid deposition. NR1H3 expression in the backfat of YY was not lower than that in DSP or TP, which might because NR1H3 has an alternative regulatory function for lipid metabolism in the subcutaneous fat of pigs.
Conclusions
Our results suggest that allele A of the exon5-A201C in NR1H3 may promote a reduction in backfat thickness, and differences in NR1H3 expression may be associated with differences in lipid deposition capacity among pigs.
Keywords: NR1H3, Lipid deposition, SNP, Pig
Background
NR1H3 is a member of the LXR nuclear super receptor family [1]. These genes are mainly distributed in the liver, adipose tissue, kidney, small intestine, and macrophages, and their main physiological function is to maintain the homeostasis of cholesterol level, lipoprotein metabolism, and fat synthesis [2–4].
NR1H3 is activated by oxysterols and intermediates from the cholesterol biosynthetic pathway. NR1H3 signaling is associated with the development of pathogenic conditions, such as hepatic steatosis. NR1H3 signaling contributes to increases in hepatic triglyceride content by upregulating lipogenic genes. Downregulation of NR1H3 expression in steatotic hepatocytes in vitro decreases the triglyceride content of the hepatocytes and promotes the recovery from hepatocyte steatosis [5]. Genetic studies have defined the NR1H3 subtype as the major regulator of hepatic lipogenesis [6, 7].
Pig NR1H3 maps to chromosome 2, is comprised of ten exons, and is 1711 bp in length. Based on the important roles of NR1H3 in lipogenesis and myogenesis in humans and mice [8, 9], as well as their location in the pig genome, NR1H3 is an attractive candidate gene for lean muscle growth and fat content, and might influence carcass composition and meat quality in pigs. The aims of this study were to investigate differences in NR1H3 expression and SNP among several breeds of pig, to analyze the association of NR1H3 with lipid deposition in pigs, and to provide a theoretical basis for the use of molecular markers in marker assisted selection (MAS).
Methods
Experimental materials
A total of 330 ear tissue samples were collected from six populations of pig (Sus scrofa) for DNA extraction. The populations included Tibetan pigs (TP, n = 50) from Linzhi, Tibet; Diannan small-eared pigs (DSP, n = 59) from Xishuang Banna, Yunnan; Landrace pigs (LP, n = 54) from Beijing Zhongshun Jingsheng Farm; Dapulian black pigs (DBP, n = 42) from Jining, Shandong; and Yorkshire (YY, n = 56); Duroc pigs (DP, n = 69) from Hefei, Anhui of China.
In addition, three groups of pigs (DSP, TP, and YY) were raised under the same conditions in Beijing. Ten individuals from each group were humanely slaughtered at 6 months of age using a normal procedure. Tissue samples of liver, backfat adipose and longissimus dorsi muscle were collected from each individual and immediately frozen in liquid nitrogen, and then stored at −80 °C until RNA and protein extraction.
All procedures were carried out in strict accordance with the protocol approved by the Animal Welfare Committee of China Agricultural University (Permit Number: XK622).
DNA, RNA, protein extraction, and cDNA preparation
Genomic DNA was isolated from the ear tissues using the method described by Sambrook et al. [10], dissolved in Tris-EDTA (TE) buffer, and stored at −20 °C.
Total RNA was extracted from tissues with TRIZOL® Reagent (Invitrogen, San Diego, CA, USA) according to the manufacturer’s instructions. The concentration and purity of the RNA samples were checked using a Nanodrop 2000 Biophotometer (Thermo Fisher Scientific Inc., West Palm Beach, FL, USA; pure RNA samples were indicated by a 260/280 nm absorbance ratio of 1.8–2.0) and electrophoresed to verify their integrity. Two-microgram RNA samples in a 20 μl reaction volume were reverse transcribed to cDNA using ImProm-IITM Reverse Transcriptase (Promega Biotech Co., Ltd., China).
Total protein was isolated from the liver, backfat and longissimus dorsi muscle using SDS Lysis Buffer (P0013B, Beyotime Ltd. China). Protein content was measured using an enhanced BCA protein assay kit (P0010, Beyotime, Ltd. China).
SNP screening
Six pairs of primers for pig NR1H3 (NM_001101814) were designed using Primer Premier 5.0 software (PREMIER Biosoft International, CA, USA). Amplicons of the primers covered all exons of the gene (Table 1 and Fig. 1). PCR products amplified from 10 samples of each group were pooled and sequenced to identify SNPs using Chromas Pro v.1.33 (Technelysium Pty Ltd, Helensvale, Australia) and DNAMAN6.0 software (Lynnon, Pointe-Claire, QC, Canada).
Table 1.
Six pairs of primers used for SNP identification in pig NR1H3
| Name | Sequences (5′ to 3′) | Amplicon region | Amplicon size (bp) | annealing temperature |
|---|---|---|---|---|
| NR1H3-1 | F: TCCCACTCTGAGGTTCTTTTT | Exon 1 | 235 | 58 °C |
| R: CTTACGGACCTGACACTGGA | ||||
| NR1H3-2 | F:GCCAGGAAAGCCTTAGCACA | Exon 2 | 361 | 60 °C |
| R: AGGAGGCAAGCAACAGCAAG | ||||
| NR1H3-3 | F:CTGAGACCCCCCCTGTGC | Exon 3 | 259 | 59 °C |
| R: GCCCCTACCTCCTCCAAATC | ||||
| NR1H3-4 | F: GAACATTAAGCCTCTTCCAT | Exon 4 | 347 | 54 °C |
| R: TTCCCTCTTTCCTATCAGC | ||||
| NR1H3-5 | F: ATCTCTTCCTTGTCTTTACCC | Exon 5, exon 6 and exon 7 | 889 | 56 °C |
| R: CAATCCCTTTGTGATCTCAG | ||||
| NR1H3-6 | F: AGCAGTTTCCTCAGTTGAGC | Exon 8, exon 9 and exon 10 | 1029 | 56 °C |
| R: AGGGTCAGTACCGTCTTCAC |
Fig. 1.

Structure of the pig NR1H3 gene and the positions of primers used for SNP identification. The thick black lines represent introns; the grey blocks represent exons of the NR1H3 gene; the thin black lines represent positions of amplicons. Pig total DNA was used as PCR templates for the NR1H3-1, NR1H3-2, NR1H3-3, NR1H3-4, NR1H3-5 and NR1H3-6 primers
SNP genotyping
After screening, the SNP genotypes of exon 5-A201C of the NR1H3 gene were determined using PCR-restriction fragment length polymorphism (RFLP). The primers for NR1H3 exon 5 were forward-AAG AAA CTG AAG CGG CAA GAG and reverse-ATC GCA GAG GTC TTT AGG AGG, and the restriction enzyme was Taq I (New England Biolabs, USA). The amplicon size was 426 bp, and individuals with 348 and 113 bp fragments had genotype AA; individuals with 348, 290, 113, and 58 bp fragments had genotype AC; and individuals with 290, 113, and 58 bp fragments had genotype CC.
Association of NR1H3 genotype with backfat thickness
We collected ear tissue samples from 117 individuals of the New Huai line (NHP) from Anhui Kexin Farm. Backfat thickness for each animal was adjusted to 90 kg body-weight using a previously described equation [11]. The exon 5-A201C genotypes for each animal were determined using PCR- Taq I-RFLP, and the phenotypic differences among the three genotypes were analyzed using the PROC GLM procedure in SAS 9.1 (SAS Institute, Inc.).
Quantitative PCR
NR1H3 mRNA expression in liver tissue, backfat adipose and longissimus dorsi muscle of ten biological replicates were measured using real-time PCR (RT-PCR). RT-PCR was conducted in triplicate in a Bio-Rad CFX96 System (Bio-Rad, USA) with 1.0 μL cDNA, 0.5 μL of the respective forward and reverse primers (10.0 nmol/μL) and 10.0 μL SYBR Green qPCR SuperMix (Transgen, Beijing, China), for a total volume of 20 μL. The RT-PCR basic protocol included an initial denaturation step (95 °C for 3 min) followed by 40 cycles of 95 °C for 10 s and 60 °C for 20 s, and a final melting curve analysis. The amplification efficiency was calculated as 10-1/slope of the standard curve derived from 5 standards created using a 5-fold dilution series of cDNA. The expression values were normalized using glyceraldehyde-3-phosphate dehydrogenase (GAPDH) expression as the internal reference gene to calculate ddCt expression values. Sets of primers designed with the Primer Premier 5.0 software were as follows: NR1H3 (NM_001101814) (forward: CCT AAA GAC CTC TGC GAT TGA, reverse: GGT TGA TGA ACT CCA CCT GC); GAPDH (NM_001206359) (forward: GGT CAC CAG GGC TGC TTT TA; reverse: CCT TGA CTG TGC CGT GGA AT).
Western blotting
NR1H3 protein expression in the liver tissue, backfat adipose and longissimus dorsi muscle of ten biological replicates were measured using western blotting. About 30 mg of tissue was homogenized in lysis buffer (10 mmoL/L NaH2PO4, 1 mmoL/L EDTA, 10 mmoL/L β-mercaptoethanol, 0.25 % Triton X-100 and 0.02 % NaN3, adjusted to pH 6.8) using a Mixer Mill MM400 (Retsch, Germany) for 5 min, and then centrifuged at 10,000 × g for 10 min at 4 °C. Protein concentrations were determined using a Protein Assay Kit (Bio-Rad). Proteins (40 μg) were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) according to manufacturer’s instructions (BioRad). The Separated proteins were transferred to Immobilon-P Transfer Membranes (IPVH00010) for 2 h at 300 mA using a Bio-Rad Criterion Blotter. Membranes were blocked overnight in a blocking buffer (P0023B, Beyotime Ltd., China), and then incubated at 4 °C for 2 h with primary mouse monoclonal GAPDH (AG019, Beyotime Ltd., China) and NR1H3 antibodies (ab82774, Abcam, UK). Both GAPDH and NR1H3 were diluted in primary antibody dilution buffer (1:1000 dilution, P0023A, Beyotime Ltd., China). After three washes with PBST (phosphate buffer saline containing 0.1 % Tween 20), membranes were incubated for 1 h with secondary HRP-labeled goat anti-mouse IgG antibody (H + L, A0216, Beyotime Ltd., China) diluted in secondary antibody dilution buffer (1:1000 dilution, P0023D, Beyotime Ltd., China). Immune complexes were visualized using an eECL Western Blot Kit (CW0049A, CWBIO Ltd., China), according to the manufacturer’s directions. The protein blots were analyzed using Image J 1.44 software (NIH, USA) to determine the expression ratios of NR1H3 and GAPDH.
Statistical analysis
Expression levels were analyzed by one-way ANOVA using SAS 9.1 Software (SAS Inst. Inc., Cary, NC). Graphs were prepared using SigmaPlot 10.0 (Systat Software, San Jose, CA) and data are presented as mean ± standard error. χ2 tests were used to analyze the distribution of genotypes and differences in allele frequencies between populations.
Results
SNP identification
The PCR amplicons obtain using the primers listed in Table 1 covered all 10 exons of the NR1H3 gene full coding regions using (Fig. 1). Sanger sequencing revealed 3 SNPs in the full-coding regions of NR1H3: exon2-C105T, exon2-G106C, and exon5-A201C in the full-coding regions of the NR1H3 gene (Fig. 2). Sequencing chromatograms (Fig. 2) showed that the sites of exon5-201 were all C in the DSP and TP populations, but were A/C in the YY population. Therefore, the SNP of exon5-A201C is genotyped using PCR-RFLP in more individuals and more populations.
Fig. 2.

Sequencing chromatograms of SNPs of exon2-C105T, exon2-G106C, and exon5-A201C. Note: YY, Yorkshire pig; DSP, Diannan small-eared pig, TP, Tibetan pig. The arrows indicate the SNP site
SNP genotype frequency
As seen from the PCR-Taq I-RFLP electrophoresis of the NR1H3 exon 5-A201C, individuals had 348,290, 113 and 58 bp fragments (Fig. 3). The genotypes and allele frequencies of exon 5-A201C in six pig breeds are shown in Table 2. The CC and AC genotypes were detected in TP and DSP, the AA and AC genotypes were found in YY and DP, and three genotypes (AA, AC, and CC) were found in DBP and LP. The AA genotype predominated in the introduced lean-type breeds (YY, LP, DP), whereas the CC genotype predominated in the Chinese indigenous fat-type breeds (TP, DSP). Only the DBP breed was predominantly AC genotype. The A allele frequency in the lean-type breeds was significantly higher than in the fat-type breeds (P < 0.01). Hardy-Weinberg equilibrium tests showed that the frequency distribution of the genotypes in these populations reached equilibrium (P > 0.05). Chi-square tests showed that the genotype distribution was significantly different between the lean- and fat-type breeds (P < 0.05).
Fig. 3.

The electrophoresis of PCR-Taq I-RFLP for NR1H3 exon 5-A201C in pigs. Note: The individual with 348 and 113 bp fragments had genotype AA (lanes 1, 2, 3, 6, 7, 9, 10, 13, 14), the individual with 348, 290, 113, and 58 bp fragments had genotype AC (lanes 4, 5, 8, 11, 12), and the individual with 290, 113, and 58 bp fragments had genotype CC (lanes 15, 16)
Table 2.
The genotype and allele frequencies of exon 5 A201C in six pig breeds
| Breed/Total number | Genotype frequency(number/frequency) | Allele gene frequency | ||||
|---|---|---|---|---|---|---|
| AA | AC | CC | χ 2 value (P value) | A | C | |
| TP/50 | 0/0 | 7/0.1400 | 43/0.8600 | 0.28 (P = 0.87) | 0.07 | 0.93 |
| DSP/59 | 0/0 | 5/0.0850 | 54/0.9150 | 0.12 (P = 0.94) | 0.0424 | 0.9576 |
| DBP/42 | 8/0.1905 | 25/0.5952 | 9/0.2143 | 1.53 (P = 0.46) | 0.4881 | 0.5119 |
| YY/56 | 37/0.6611 | 19/0.3389 | 0/0 | 2.34 (P = 0.31) | 0.8300 | 0.1700 |
| LP54 | 42/0.7778 | 10/0.1852 | 2/0.0370 | 1.74 (P = 0.42) | 0.8704 | 0.1296 |
| DP/69 | 68/0.9855 | 1/0.0145 | 0/0 | 0.00 (P = 1.00) | 0.9928 | 0.0072 |
TP represents Tibetan pigs, DSP diannan small-eared pigs, DBP dapulian black pigs, YY, Yorkshire pigs, LP landrace, DP duroc pig
Association between genotype and backfat thickness in the New Huai Line
The genotypes of 117 individuals from the New Huai line were determined and the number of pigs with the AA, AC, and CC genotypes were 68, 44 and 5, respectively, and the genotype distribution conformed to Hardy-Weinberg equilibrium (Table 3). The backfat thickness of the CC genotype was significantly higher than that of the AC and AA genotypes (P < 0.05), and there was no significant difference between the AC and AA genotypes (P > 0.05).
Table 3.
Genotype distribution of NR1H3 exon 5-A201C and backfat thickness in New Huai line pigs
| Genotype | AA | AC | CC | χ 2/P |
|---|---|---|---|---|
| Number/frequency | 68/0.5811 | 44/0.3760 | 5/0.0427 | 0.41/0.81 |
| Backfat thickness (mm) | 11.0 ± 0.8a | 12.2 ± 0.3a | 13.3 ± 0.3b |
The different superscript letters (a, b) indicate that the means are significantly different (P < 0.05)
NR1H3 mRNA expression
The NR1H3 gene expression was maximal in the liver tissue, mid-range in the backfat, and minimal in the longissimus dorsi muscle of pigs (Fig. 4). The expression level in the liver of DSP was significantly higher than that of TP and YY (P < 0.05). Expression in the longissimus dorsi muscle of YY was significantly lower than that of DSP and TP (P < 0.05), and there was no significant difference in gene expression between DSP and TP (P > 0.05). In contrast, the expression level in the backfat of YY was higher than that in DSP and TP (P < 0.05), and no significant difference was seen between TP and DSP (P > 0.05) (Fig. 4).
Fig. 4.

The mRNA expression level of NR1H3 in the three tissues of three pig breeds. Each bar represents the mean ± S.E. The different letters (a, b, c) on the bars denote significant difference between breeds for the same tissue (P < 0.05). On the Y-axis, 0.5–1 was omitted. DSP, Diannan small-eared pig (n = 10); TP, Tibetan pig (n = 10); YY, Yorkshire pig (n = 10)
NR1H3 protein expression
NR1H3 protein expression trends among the three examined pig breeds were similar to those for mRNA expression. In the liver and longissimus dorsi muscle of YY, NR1H3 expression was significantly lower than in those of DSP and TP (P < 0.05) (Fig. 5). In the backfat tissue, NR1H3 expression was lower in TP than in DSP and YY (P < 0.05), which is not consistent with the observed differences in mRNA expression between the breeds.
Fig. 5.

NR1H3 protein expression level in three tissues of pigs. Each bar represents the mean ± S.E. Different letters (a, b, c) on bars denote significant differences between pig breeds for the same tissue (P < 0.05). DSP, Diannan small-eared pig (n = 10); TP, Tibetan pig (n = 10); YY, Yorkshire pig (n = 10)
Discussion
Fatness traits, such as backfat thickness (BFT) and intramuscular fat content (IMF), are considered economically important traits in pig breeding programs, because they influence carcass composition and meat quality [12, 13]. The rate of lipids deposited in pigs is influenced by numerous factors, including diet, age/body weight, gender, breed, environmental temperature, and body site. NR1H3 plays important roles in lipogenesis and myogenesis [8, 9] and may affect lean muscle growth and fat content [14]. In the present study, three SNPs (exon2-C105T, exon2-G106C, and exon5-A201C) were found within the exon regions of NR1H3. Exon5-A201C showed interindividual variation and the frequency of the CC genotype was significantly higher in the three populations of Chinese fat-type breeds studied than in the three introduced lean-type breeds studied. The mean backfat thickness of individuals of the New Huai line with genotype CC was significantly higher than that of individuals with genotypes AC and AA (P < 0.05). These results suggest that the C allele of NR1H3-exon 5-A201C may promote lipid deposition in pigs, and increase subcutaneous fat and intramuscular fat content. NR1H3-exon5-A201C is a synonymous mutation that may affect gene function by altering the mRNA structure or protein folding [15, 16]. The mutation of allele A into allele C may have caused the binding transcription factor by changing the sequence from Hen-1 to Bsap. We can infer that the C allele is associated with high lipids deposition. Therefore, NR1H3 can be used as a DNA marker for pig breeding.
NR1H3, a key regulatory gene of liver lipid metabolism, belongs to the orphan nuclear receptor family, and has abundant expression in the liver. In previous studies, two Chinese indigenous breeds (DSP, TP) had high backfat thickness and intramuscular fat content (IMF), whereas the Yorkshire pig, an introduced breed, had low backfat thickness and IMF [17, 18]. This indicates that DSP and TP have a distinct ability to deposit lipids. It is noteworthy that the mRNA and protein expression of NR1H3 in the liver and longissimus dorsi muscles was higher in DSP and TP animals than in YY animals, which suggests that increased NR1H3 expression may promote lipid deposition and accumulation in pigs, as it does in humans [19, 20]. An experiment on genetically obese mice demonstrated that the hepatic NR1H3 signal induced lipogenesis and independently contributed to the development of fatty liver [21, 22]. NR1H3 has also been linked to lipid metabolism in the liver, and it may channel fatty acids into triglyceride synthesis rather than into β-oxidation and energy production [23].
Unlike in the liver and muscle, NR1H3 mRNA expression in the backfat tissue of YY was higher than that of DSP and TP, and the NR1H3 protein levels in DSP and YY were higher than that in TP. This may be the result of different NR1H3 regulatory mechanisms for lipid metabolism in the subcutaneous fat tissue and in other tissues of pigs. NR1H3 is a potent stimulator of fatty acid and triglyceride synthesis, but it also represents a second subset of lipid-sensing receptors that are well known for their ability to sense oxysterols and regulate genes that can decrease total body cholesterol levels [24]. In the absence of NR1H3, the balance between fat storage and oxidation is altered, and the accumulation of hepatic cholesterol then drives the peripheral tissues to aberrantly dissipate fat-derived energy. Cholesterol is often a component of a high-fat diet and shares common metabolic pathways with lipids, and the LXR regulation of lipid metabolism is interdependent on its ability to maintain cholesterol homeostasis. Our results suggest that NR1H3 promotes large amounts of fat synthesis and leads to a certain amount of fat accumulation. In order to maintain homeostasis, NR1H3 also promotes fat oxidation, which may be the reason for the relatively high expression of NR1H3 in the backfat tissue of YY. Endogenous hepatic NR1H3 activity is essential for maintaining normal lipid and sterol homeostasis [25]. Understanding NR1H3 helps in understanding the important metabolic conundrum of how to limit the accumulation of cholesterol, while simultaneously permitting the deposition of fat as an energy-rich fuel source and keeping the balance between storage and oxidation of dietary fat [26].
Conclusions
NR1H3-exon-5-A201C is correlated with backfat thickness, and the expression of NR1H3 gene may regulate lipid deposition in pigs. Further work will be necessary to investigate whether NR1H3 plays a role in those traits involved in lean muscle fat content. Our study provides a molecular marker or functional gene that may be used for improving both the quantity and quality of pig meat production. However, further studies will be needed prior to using this marker in breeding programs. These studies should include analysis of correlations between NR1H3 expression levels and backfat thickness and IMF content, and between SNP genotypes and lipid deposition traits.
Abbreviations
DBP, dapulian black pig; DP, duroc pig; DSP, Diannan small-eared pig; eECL, enhanced electrochemiluminescence; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IMF, intramuscular fat; LP, landrace pig; LXRα, liver X receptor alpha; MAS, marker assisted selection; mRNA, messenger RNA; NR1H3, nuclear receptor subfamily 1, group H, member 3; PBST, phosphate buffer saline containing 0.1 % Tween 20; PCR-RFLP, polymerase chain reaction restriction fragment length polymorphism; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; SNP, single nucleotide polymorphism; TP, Tibetan pig; YY, Yorkshire pig.
Acknowledgements
This work was supported by the National Major Special Project on New Varieties Cultivation for Transgenic Organisms (No. 2016ZX08009-003-006) and the National Key Technology R&D Program (2012BAD03B03) and the Program for Changjiang Scholar and Innovation Research Team in University (IRT1191).
Authors’ contributions
BZ, PS, AXS carried out the molecular genetic studies and the statistical analysis, and BZ drafted the manuscript. BZ, PS carried out the genotyping. HZ, BZ, and ASX participated in the design of the study. PS and ZXW conceived of the study, participated in its design and coordination, and helped to draft the manuscript. All authors read and approved the final manuscript.
Competing interests
The authors declare that they have no competing interests.
References
- 1.Zhang X, Liu J, Su W, Wu J, Wang C, Kong X, et al. Liver X receptor activation increases hepatic fatty acid desaturation by the induction of SCD1 expression through an LXRalpha-SREBP1c-dependent mechanism. J Diabetes. 2014;6:212–20. doi: 10.1111/1753-0407.12081. [DOI] [PubMed] [Google Scholar]
- 2.Calkin AC, Tontonoz P. Liver x receptor signaling pathways and atherosclerosis. Arterioscler Thromb Vasc Biol. 2010;30:1513–8. doi: 10.1161/ATVBAHA.109.191197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Uemura T, Goto T, Kang MS, Mizoguchi N, Hirai S, Lee JY, et al. Diosgenin, the main aglycon of fenugreek, inhibits LXRalpha activity in HepG2 cells and decreases plasma and hepatic triglycerides in obese diabetic mice. J Nutr. 2011;141:17–23. doi: 10.3945/jn.110.125591. [DOI] [PubMed] [Google Scholar]
- 4.Jakobsson T, Treuter E, Gustafsson JA, Steffensen KR. Liver X receptor biology and pharmacology: new pathways, challenges and opportunities. Trends Pharmacol Sci. 2012;33:394–404. doi: 10.1016/j.tips.2012.03.013. [DOI] [PubMed] [Google Scholar]
- 5.Nakamuta M, Fujino T, Yada R, Yada M, Yasutake K, Yoshimoto T, et al. Impact of cholesterol metabolism and the LXRalpha-SREBP-1c pathway on nonalcoholic fatty liver disease. Int J Mol Med. 2009;23:603–8. doi: 10.3892/ijmm_00000170. [DOI] [PubMed] [Google Scholar]
- 6.Quinet EM, Savio DA, Halpern AR, Chen L, Schuster GU, Gustafsson JA, et al. Liver X receptor.LXR;-beta regulation in LXRalpha-deficient mice: implications for therapeutic targeting. Mol Pharmacol. 2006;70:1340–9. doi: 10.1124/mol.106.022608. [DOI] [PubMed] [Google Scholar]
- 7.Bischoff ED, Daige CL, Petrowski M, Dedman H, Pattison J, Juliano J, et al. Non-redundant roles for LXRalpha and LXRbeta in atherosclerosis susceptibility in low density lipoprotein receptor knockout mice. J Lipid Res. 2010;51:900–6. doi: 10.1194/jlr.M900096. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Hummasti S, Laffitte BA, Watson MA, Galardi C, Chao LC, Ramamurthy L, et al. Liver X receptors are regulators of adipocyte gene expression but not differentiation: identification of apoD as a direct target. J Lipid Res. 2004;45:616–25. doi: 10.1194/jlr.M300312-JLR200. [DOI] [PubMed] [Google Scholar]
- 9.Ulven SM, Dalen KT, Gustafsson JA, Nebb HI. LXR is crucial in lipid metabolism. Prostaglandins Leukot Essent Fatty Acids. 2005;73:59–63. doi: 10.1016/j.plefa.2005.04.009. [DOI] [PubMed] [Google Scholar]
- 10.Sambrook J, Russell D. Molecular Cloning: A Laboratry Manual. 3. New York: Cold Spring Harbor Laboratory Press; 2001. [Google Scholar]
- 11.Zhang Y. Animal Breeding. China: Chinese Agriculture Press; 2004. [Google Scholar]
- 12.Aslan O, Hamill RM, Davey G, McBryan J, Mullen AM, Gispert M, et al. Variation in the IGF2 gene promoter region is associated with intramuscular fat content in porcine skeletal muscle. Mol Biol Rep. 2012;39:4101–10. doi: 10.1007/s11033-011-1192-5. [DOI] [PubMed] [Google Scholar]
- 13.Chen QM, Wang H, Zeng YQ, Chen W. Developmental changes and effect on intramuscular fat content of H-FABP and A-FABP mRNA expression in pigs. J Appl Genet. 2013;54:119–23. doi: 10.1007/s13353-012-0122-0. [DOI] [PubMed] [Google Scholar]
- 14.Yu M, Geiger B, Deeb N, Rothschild MF. Liver X receptor alpha and beta genes have the potential role on loin lean and fat content in pigs. J Anim Breed Genet. 2006;123:81–8. doi: 10.1111/j.1439-0388.2006.00576.x. [DOI] [PubMed] [Google Scholar]
- 15.Nackley AG, Shabalina SA, Tchivileva IE, Satterfield K, Korchynskyi O, Makarov SS, et al. Human catechol-omethyltransferase haplotypes modulate protein expression by altering mRNA secondary structure. Science. 2006;314:1930–7. doi: 10.1126/science.1131262. [DOI] [PubMed] [Google Scholar]
- 16.Drummond DA, Wilke CO. Mistranslation-induced protein misfolding as a dominant constraint on codingsequence evolution. Cell. 2008;134:341. doi: 10.1016/j.cell.2008.05.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Li QG, Wang ZX, Zhang B, Lu YF, Yang YZ, Ban DM, et al. Single nucleotide polymorphism scanning and esxpression of the pig PPARGC1A gene in different breeds. Lipids. 2014;49:1047–55. doi: 10.1007/s11745-014-3928-1. [DOI] [PubMed] [Google Scholar]
- 18.Plastow GS, Carrion D, Gil M, Garcia-Regueiro JA, i Furnols MF, Gispert M, et al. Quality pork genes and meat production. Meat Sci. 2005;70:409–21. doi: 10.1016/j.meatsci.2004.06.025. [DOI] [PubMed] [Google Scholar]
- 19.Muscat GE, Wagner BL, Hou J, Tangirala RK, Bischoff ED, Rohde P, et al. Regulation of cholesterol homeostasis and lipid metabolism in skeletal muscle by liver X receptors. J Biol Chem. 2002;277:40722–8. doi: 10.1074/jbc.M206681200. [DOI] [PubMed] [Google Scholar]
- 20.Kase ET, Wensaas AJ, Aas V, Hojlund K, Levin K, Thoresen GH, et al. Skeletal muscle lipid accumulation in type 2 diabetes may involve the liver X receptor pathway. Diabetes. 2005;54:1108–15. doi: 10.2337/diabetes.54.4.1108. [DOI] [PubMed] [Google Scholar]
- 21.Matsusue K, Aibara D, Hayafuchi R, Matsuo K, Takiguchi S, Gonzalez FJ, et al. Hepatic PPARgamma and LXRalpha independently regulate lipid accumulation in the livers of genetically obese mice. Febs Lett. 2014;588:2277–81. doi: 10.1016/j.febslet.2014.05.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Kim DI, Park MJ, Lim SK, Park JI, Yoon KC, Han HJ, et al. PRMT3 regulates hepatic lipogenesis through direct interaction with LXRalpha. Diabetes. 2015;64:60–71. doi: 10.2337/db13-1394. [DOI] [PubMed] [Google Scholar]
- 23.Schultz JR, Tu H, Luk A, Repa JJ, Medina JC, Li L, et al. Role of LXRs in control of lipogenesis. Genes Dev. 2000;14:2831–8. doi: 10.1101/gad.850400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Tontonoz P, Mangelsdorf DJ. Liver X receptor signaling pathways in cardiovascular disease. Mol Endocrinol. 2003;17:985–93. doi: 10.1210/me.2003-0061. [DOI] [PubMed] [Google Scholar]
- 25.Zhang Y, Breevoort SR, Angdisen J, Fu M, Schmidt DR, Holmstrom SR, et al. Liver LXRalpha expression is crucial for whole body cholesterol homeostasis and reverse cholesterol transport in mice. J Clin Invest. 2012;122:1688–99. doi: 10.1172/JCI59817. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Kalaany NY, Gauthier KC, Zavacki AM, Mammen PP, Kitazume T, Peterson JA, et al. LXRs regulate the balance between fat storage and oxidation. Cell Metab. 2005;1:231–44. doi: 10.1016/j.cmet.2005.03.001. [DOI] [PubMed] [Google Scholar]
