Skip to main content
NCBI home page
The Journal of Biological Chemistry logoLink to The Journal of Biological Chemistry
. 2016 Apr 20;291(22):11566–11571. doi: 10.1074/jbc.C116.724799

Inter-isoform-dependent Regulation of the Drosophila Master Transcriptional Regulator SIN3*

Ashlesha Chaubal ‡, Sokol V Todi §, Lori A Pile ‡,1
PMCID: PMC4882427  PMID: 27129248

Abstract

SIN3 is a transcriptional corepressor that acts as a scaffold for a histone deacetylase (HDAC) complex. The SIN3 complex regulates various biological processes, including organ development, cell proliferation, and energy metabolism. Little is known, however, about the regulation of SIN3 itself. There are two major isoforms of Drosophila SIN3, 187 and 220, which are differentially expressed. Intrigued by the developmentally timed exchange of SIN3 isoforms, we examined whether SIN3 187 controls the fate of the 220 counterpart. Here, we show that in developing tissue, there is interplay between SIN3 isoforms: when SIN3 187 protein levels increase, SIN3 220 protein decreases concomitantly. SIN3 187 has a dual effect on SIN3 220. Expression of 187 leads to reduced 220 transcript, while also increasing the turnover of SIN3 220 protein by the proteasome. These data support the presence of a novel, inter-isoform-dependent mechanism that regulates the amount of SIN3 protein, and potentially the level of specific SIN3 complexes, during distinct developmental stages.

Keywords: Drosophila, gene transcription, histone modification, proteasome, protein stability, SIN3

Introduction

Normal cell function requires precise and coordinated regulation of abundance, localization, and interaction of numerous proteins and associated factors. This systematic regulation is brought about by several synchronized processes that govern the production, subcellular location, and timely degradation of proteins. Key among these processes is the ubiquitin-proteasome system, which eliminates specific proteins at determined time points (1). Disturbance of the ubiquitin-proteasome system has serious consequences in cellular function that can directly cause cell death (2). This is especially true for controlling the steady-state levels of master regulatory proteins that regulate diverse transcriptional networks. Specific examples include the histone-modifying enzymes, which govern chromatin organization and thus regulate gene networks. Dysregulation of histone-modifying enzymes can be disastrous for the cell, because it not only leads to aberrant gene expression, but also affects genome stability (3).

The SIN3 HDAC2 complex, evolutionarily conserved from yeast to mammals, is one such important histone-modifying complex (4, 5). The protein SIN3 serves as a scaffold for the assembly of this complex (5). SIN3 is a master transcriptional regulator that, when deleted or mutated, causes embryonic lethality in Drosophila and mice (6–9). Previous work from our laboratory showed that depletion of Drosophila SIN3 affects several biological processes, resulting in severe developmental defects, increased sensitivity to oxidative stress, and reduced life span (10–12). Although many of the gene networks and biological processes regulated by SIN3 are known, the regulation of the SIN3 protein itself is poorly understood.

In Drosophila, a single Sin3A gene gives rise to multiple SIN3 isoforms, SIN3 187, SIN3 190, and SIN3 220. These isoforms vary only at the C terminus due to the presence of unique C-terminal exons, form distinct HDAC complexes, are functionally non-redundant, and are differentially expressed during development (timeline summarized in Fig. 1A (11, 13)). SIN3 220 is the predominant isoform expressed in proliferating cells, whereas SIN3 187 expression is comparatively higher in differentiated tissue (11). This distinct pattern of expression led us to wonder what regulates the isoforms so that they function at different stages during development and in adults. We found a highly interdependent relationship between SIN3 187 and SIN3 220 proteins. SIN3 187 expression causes increased proteasomal degradation of SIN3 220, while also reducing its mRNA levels. To the best of our knowledge, this type of multi-level, inter-isoform regulation that dictates the abundance of a master regulatory protein has not been reported previously.

FIGURE 1.

FIGURE 1.

Open in a new tab

Ectopic expression of SIN3 187 causes a reduction in endogenous SIN3 220 protein. A, representation of differential expression of SIN3 isoforms during development, based on data shown in Ref. 11. Numbers within the arrow indicate stages of embryogenesis. B, wing imaginal discs were isolated from wandering third instar larvae of the indicated genotype. Wing discs were immunostained with α-HA to detect SIN3 187HA and with α-SIN3 220 to detect endogenous SIN3 220. The green fluorescence observed in the UAS-187HA control (left panels) is due to background signal. Wing discs obtained from the UAS-EGFP X en-GAL4 cross were immunostained with SIN3 220 antibody. The green fluorescence observed in this wing disc is due to EGFP expression driven by engrailed-Gal4. Scale bars represent 100 μm. C, SIN3 187HA cells were treated with CuSO4 for the indicated times to induce expression of the SIN3 187HA transgene. Protein extracts were probed with HA, RPD3, and SIN3 220 antibodies. β-Actin levels are shown as the loading control. The amount of SIN3 220 and RPD3 protein relative to actin is quantitated in the graph below. The results are the average of three independent biological replicates. Error bars represent S.E. *, p < 0.05, ***, p < 0.005.

Experimental Procedures

Cell Culture

Drosophila Schneider cell line 2 (S2) cells were cultured in Schneider's Drosophila medium (1×) + l-glutamine (Gibco) with 10% heat-inactivated fetal bovine serum (Gibco) and 50 mg/ml gentamicin (Gibco) and incubated at 27 °C. For S2 cells expressing a transgene, SIN3 187 with an HA tag (SIN3 187HA cells), 0.1 mg/ml penicillin/streptomycin (Gibco), and 0.1 mg/ml Geneticin (Gibco) was added for selection. For S2 cells carrying an HA-tagged lid (little imaginal discs) transgene, 300 μg/ml hygromycin B (Invitrogen) was added for selection.

Drosophila Stocks

Drosophila melanogaster stocks were maintained and crosses were performed according to standard laboratory procedures. The fly stocks used were as follows: en-Gal4 (#8828) and EGFP (#6658) obtained from the Bloomington Stock Center and UAS-SIN3 187HA (described in Ref. 11).

Immunostaining

Wing imaginal discs were dissected from wandering third instar larvae in 1× PBS. 20–30 discs were fixed in 4% formaldehyde in 1× PBS and blocked with 5% normal goat serum, 0.3% Triton X-100 in 1× PBS. The discs were stained as described previously (11) using the following antibodies: rabbit anti-SIN3 220 (1:500) (11), mouse anti-HA-FITC (1:200; Sigma), and Alexa Fluor 594 donkey anti-rabbit secondary antibody (1:1000; Invitrogen). The discs were stained with 2 μg/ml DAPI solution and mounted in VECTASHIELD (Vector laboratories). Photographs were taken using an Olympus IX81 or BX53 microscope. All images were taken using the 10× objective lens (Numerical aperture: 0.25) at room temperature. 5% deconvolution was applied to the images using the MicroSuite Basic edition software.

Cycloheximide and MG132 Assay

3 × 106 cells were treated with 0.7 m CuSO4 for 16 h prior to cycloheximide treatment. Cycloheximide (AG Scientific) was added to the cells to a final concentration of 100 μg/ml for 10 h. A second set of cells was simultaneously treated with 50 μm MG132 (Sigma) to inhibit the proteasome. Cycloheximide, dissolved in water, and MG132, dissolved in DMSO, were replenished after 6 h.

Time Course Assay

4 × 106 cells were treated with 0.7 m CuSO4 for 48 h. Protein and RNA extracts were made as described below at the indicated time points.

Real-time Quantitative Reverse Transcription PCR Assay

Using the RNeasy mini kit (Qiagen), total RNA was extracted from 1 × 107 SIN3 187HA cells treated with CuSO4 for different amounts of time. cDNA was generated from the total RNA with random hexamers using the ImProm-II reverse transcription system (Promega). The cDNA was used as template in a real-time quantitative PCR assay carried out in a Stratagene Mx3005P real-time thermocycler. Primers (5′-3′) used in the PCR reaction were as follows: SIN3 220, TTAAAGGCGTATTGCTCGGC and TTGCGCTACAGAGAAGGTGG; SIN3187HA, AAATCGATTGCCGTGTAACC and GCGTAATCTGGAACATCGTATGGG; pan-SIN3, AAATCGATTGCCGTGTAACC and GAGCGCAGGATTCGCCAACC; and Taf1, CTGGTCCTGGTGAGGTGA and CCGGATTCTGGGATTTGA.

Western Blotting

Protein was extracted by pelleting 106 cells through centrifugation, followed by lysis using Laemmli sample buffer (Bio-Rad). Protein concentrations were determined using the Bio-Rad DC protein assay reagent in accordance with the manufacturer's protocol. Western blotting analysis was performed according to standard protocols (14) and as described previously (15). Primary antibodies used were as follows: HA-HRP (1:6000; Sigma), pan-SIN3 (1:2000 (16)), RPD3 (1:3000 (16)), and SIN3 220 (1:2000 (11)). Donkey anti-rabbit HRP-conjugated IgG (1:3000; GE Healthcare) was used as the secondary antibody. The antibody signals were detected using the ECL Prime Western blotting detection agent (GE Healthcare). The blots were photographed using the FOTO/Analyst Investigator (FOTODYNE) or Versa Doc imaging system (Bio-Rad) and quantitated using the TotalLab TL 100 software (Nonlinear Dynamics) and Quantity One software (Bio-Rad), respectively.

Statistical Analyses

Significance values were determined by the Student's t test using GraphPad.

Results

SIN3 187 Expression Leads to Reduced SIN3 220 Protein

During Drosophila development, SIN3 isoforms exhibit differential levels of protein expression (summarized in Fig. 1A, based on data previously published by our laboratory (11)). SIN3 220 is predominantly expressed during stages 12–16 of embryogenesis and markedly reduced during stage 17, the final stage of embryogenesis (11). Conversely, the lower molecular weight isoforms, SIN3 187 and SIN3 190, exhibit a gradual increase in expression toward the later stages of embryogenesis, peaking at stage 17 (11). SIN3 190 expression is limited to embryos and adult females (11), and so will not be further considered. Additionally, we have observed that cultured Drosophila S2 cells expressing HA-tagged SIN3 187 (SIN3 187HA cells) show a significant reduction in the level of endogenous SIN3 220 protein upon induction of SIN3 187HA (17). Collectively, these earlier observations led us to investigate whether the SIN3 187 isoform controls SIN3 220 protein.

We utilized the UAS-Gal4 system (18) to analyze the impact of SIN3 187 on SIN3 220 in developing Drosophila tissue. Drosophila larval wing imaginal discs predominantly express SIN3 220 (11). We mated virgin females carrying a HA-tagged SIN3 187 transgene (UAS-SIN3 187HA) to engrailed-Gal4 driver males. Progeny of this cross exogenously express SIN3 187HA specifically in the posterior half of wing imaginal discs of wandering third instar larvae. Cells of the anterior half of the wing disc do not express the SIN3 187HA transgene and therefore serve as an internal control for endogenous SIN3 220 protein levels (Fig. 1B). We observed that the posterior half of the wing discs, which expressed the SIN3 187HA transgene, had reduced SIN3 220 staining as compared with the anterior half (Fig. 1B). The wing imaginal discs obtained from UAS-SIN3 187HA flies, which do not carry a Gal4 driver, and those obtained from a control cross between virgin females carrying the UAS-EGFP transgene and engrailed-Gal4 driver males showed uniform SIN3 220 staining throughout the wing disc, indicating that the reduction in SIN3 220 is a specific effect of SIN3 187HA expression (Fig. 1B). These data indicate that altering the amount of the SIN3 187 isoform impacts SIN3 220 protein levels in vivo.

To further examine this relationship between SIN3 isoforms, we turned to cultured S2 cells that, like wing imaginal disc cells, are proliferative and predominantly express SIN3 220 (11). We performed a time-course experiment using SIN3 187HA cells. At distinct times following induction of SIN3 187HA, whole cell protein extracts were prepared and the expression of SIN3 isoforms was monitored by Western blotting. As compared with time 0 h, the endogenous SIN3 220 protein gradually decreased upon induced SIN3 187 expression (Fig. 1C). This effect was particularly noticeable at 36 and 48 h of induction, as compared with non-induced cells (Fig. 1C). These data are consistent with the observation made using developing fly tissue (Fig. 1B) that SIN3 187 expression significantly impacts the amount of its 220 counterpart. To determine whether the effect of SIN3 187HA was specific for SIN3 220, we analyzed the protein level of another SIN3 complex component, RPD3. No significant change was observed on the RPD3 protein level upon SIN3 187 induction (Fig. 1C). Together, the results obtained from the larval wing imaginal discs and S2 cells argue that SIN3 187 specifically regulates SIN3 220 protein levels.

SIN3 187 Accelerates Proteasomal Turnover of SIN3 220 Protein

To gain more mechanistic insight into this interplay, we examined the stability of endogenous SIN3 220 upon exogenous expression of SIN3 187 by conducting cycloheximide-based pulse-chase experiments. Cycloheximide halts the translation of new protein, thus allowing us to monitor the turnover of existing SIN3 220 protein over time. SIN3 187HA cells were induced to express SIN3 187. Non-transfected S2 cells treated in the same way were used as the control. Both sets of cells were then treated with cycloheximide, and the stability of endogenous SIN3 220 protein was monitored by Western blotting. In S2 cells, which express little SIN3 187, SIN3 220 is highly stable (Fig. 2A). When SIN3 187HA expression is induced, however, the turnover of endogenous SIN3 220 is significantly accelerated (Fig. 2B). The SIN3 220 protein level was markedly diminished upon induction of SIN3 187 expression, within 10 h of cycloheximide treatment, as compared with the level in S2 cells.

FIGURE 2.

FIGURE 2.

Open in a new tab

SIN3 187 increases SIN3 220 protein turnover by targeting it for proteasome-dependent degradation. A–C, cycloheximide (CHX) treatment was performed for S2 (A), SIN3 187HA (B), and LIDHA (C) cells. Protein extracts isolated at 0, 4, 8, and 10 h were analyzed by Western blotting. SIN3 220 levels are analyzed for two sets of cells: cells treated with CuSO4 for 16 h (Induced) and cells treated with CuSO4 for 16 h and then treated with the proteasome inhibitor MG132 for the indicated time (Induced + MG132). Protein extracts obtained from SIN3 187HA cells were probed with HA and SIN3 220 antibodies. Protein extracts obtained from S2 and LIDHA cells were probed with pan-SIN3 antibody. LIDHA protein extracts were also probed with HA antibody. β-Actin levels were used as the loading control. The relative level of SIN3 220 protein is quantitated in the adjoining graphs. The results are the average of three biological independent replicates. Error bars represent S.E.*, p < 0.05, **, p < 0.01.

Next, we examined whether increased turnover of SIN3 220 in the presence of SIN3 187 was proteasome-dependent. To this end, we performed the cycloheximide-based pulse-chase experiments in the presence of the proteasome inhibitor MG132. Treatment of cells with MG132 significantly slowed the degradation of SIN3 220 (Fig. 2B). As an additional control, we determined whether expression of a component of the SIN3 complex has a similar effect on SIN3 220 turnover. We used an S2 cell line that carries a transgene for expression of HA-tagged dKDM5/LID (little imaginal discs), referred to as LIDHA cells. Overexpression of dKDM5/LID in the presence of cycloheximide did not alter the turnover rate of SIN3 220 protein (Fig. 2C). We conclude that SIN3 187 specifically leads to increased proteasomal degradation of SIN3 220, a protein that is normally quite stable.

SIN3 187 Regulates SIN3 220 Transcript

The impact of SIN3 187 on SIN3 220 protein turnover led us to wonder whether the interplay between these isoforms occurs at multiple levels. To explore this possibility, we analyzed the effect of SIN3 187 expression on SIN3 220 transcript. Total RNA was extracted from SIN3 187HA cells that had been induced for different amounts of time to express the SIN3 187 transgene. Real-time quantitative reverse transcription PCR analysis was performed using isoform-specific primers to quantify the level of the different Sin3A transcripts (Fig. 3). We observed a reduction in the amount of SIN3 220 transcript upon induction of SIN3 187HA as compared with non-induced cells (Fig. 3). The data in Figs. 2 and 3 provide evidence of multiple levels of control exerted by SIN3 187 on to SIN3 220, which collectively result in decreased SIN3 220 protein levels.

FIGURE 3.

FIGURE 3.

Open in a new tab

Presence of SIN3 187 causes a reduction in the SIN3 220 transcript. Real-time quantitative reverse transcription PCR analysis was performed using SIN3 isoform-specific primers. In the schematic representing the Sin3A gene, filled squares indicate common exons, and squares with diagonal, vertical, and horizontal lines indicate unique SIN3 187, SIN3 190, and SIN3 220 exons, respectively. The small triangle, circle, and square indicate the positions of the primers. Taf1 was used as a control for normalizing transcript levels. The results are the average of three biological independent replicates. Error bars represent S.E. **, p < 0.01.

Discussion

SIN3 is well studied as a master transcriptional regulator that governs several important cellular pathways, including cell proliferation and energy metabolism (19). Although SIN3 functions continue to be explored, the processes that regulate SIN3 itself remain poorly understood. In this study, we report an interplay between the predominant isoforms of SIN3. SIN3 187 expression caused a substantial reduction in the level of SIN3 220 protein in developing flies and in cultured cells. Expression of SIN3 187 impacted SIN3 220 at both transcript and protein levels. The 187 isoform led to reduced 220 mRNA, while also increasing the proteasomal turnover of its protein. Collectively, our data suggest the presence of an active regulatory signal that is triggered by SIN3 187 to reduce the amount of SIN3 220. Control of SIN3 220 at multiple levels likely ensures efficient removal of this isoform during specific developmental stages and highlights the possibility that regulation of SIN3 isoform expression is critically important.

We showed the involvement of the proteasome in maintaining the level of SIN3 220. It is likely that post-translational modifications play a role in targeting SIN3 220 to this degradative machinery. Mammalian SIN3 is SUMOylated and ubiquitinated (20, 21). It remains to be determined whether a similar situation exists in Drosophila. In initial attempts to examine post-translational modifications of Drosophila SIN3, we performed stringent immunoprecipitation experiments using either antibodies for endogenous and HA-tagged SIN3 or a high-affinity ubiquitin binding resin to detect ubiquitinated SIN3 species. No distinct higher molecular weight bands indicative of ubiquitinated SIN3 were observed in our preliminary experiments (data not shown). As an alternative approach, we selected three lysine residues in the fly ortholog that are reportedly ubiquitinated in the human counterpart (22, 23). Mutating these residues into the similar but non-ubiquitinatable amino acid arginine, alone or in combination, did not impact SIN3 220 cellular protein levels (data not shown). It is possible that other lysine residues in Drosophila SIN3 are ubiquitinated, or that its proteasomal degradation might be ubiquitin-independent. There is a growing number of proteins that do not require ubiquitination to be degraded by the proteasome (24). Our initial studies, however, do not definitively rule out the possibility that ubiquitination of SIN3 220 is involved at some point to regulate its turnover.

Drosophila SIN3 isoforms differ only at the C-terminal region. 187 and 220 isoforms both interact with a core group of HDAC complex components that are conserved across species (13). Perhaps the SIN3 protein needs to be amid this core complex to be stable. One possibility to account for SIN3 220 protein reduction by SIN3 187HA expression is that excess SIN3 187 sequesters the common complex components and exposes SIN3 220 for proteasomal degradation.

SIN3 220 transcript is also reduced upon exogenous expression of SIN3 187. The molecular mechanism governing this effect remains to be elucidated. Perhaps some regulatory factor detects the presence of SIN3 187 transcript and alters splicing at the Sin3A gene, resulting in reduced SIN3 220 transcript. Another possibility could be transgene-induced post-transcriptional gene silencing (25). When the SIN3 187HA transgene is expressed, the overall level of Sin3A mRNA is very high. This may trigger degradation of the Sin3A transcript. Further investigation will help us better understand which mechanism is responsible for regulating the amount of SIN3 220 transcript.

It will be interesting to determine whether mechanisms akin to the ones that we reported here exist to regulate SIN3 in organisms other than Drosophila. Our finding of inter-isoform-dependent regulation of SIN3 expands the overall understanding of avenues through which master switches are controlled during development. It also suggests that similar processes may apply to other key proteins with isoform-specific properties.

Author Contributions

A. C. participated in the design of the study, carried out all experiments, and drafted the manuscript. S. V. T. participated in the design of the study and helped draft the manuscript. L. A. P. conceived the study, participated in its design, and helped draft the manuscript. All authors read and approved the final manuscript.

Acknowledgments

We thank Drs. Athar Ansari and Xiang-Dong Zhang for their suggestions and comments throughout the progress of this research. We thank all members of the Pile laboratory for critical evaluation of the manuscript.

*

This work was supported by National Institutes of Health Grant 1R01GM088886-01A2 (to L. A. P.). The authors declare that they have no conflicts of interest with the contents of this article. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

2
The abbreviations used are:
HDAC
histone deacetylase
UAS
upstream activating sequence
EGFP
enhanced GFP.

References

  • 1. Komander D., and Rape M. (2012) The ubiquitin code. Annu. Rev. Biochem. 81, 203–229 [DOI] [PubMed] [Google Scholar]
  • 2. Ciechanover A. (1998) The ubiquitin-proteasome pathway: on protein death and cell life. EMBO J. 17, 7151–7160 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Bannister A. J., and Kouzarides T. (2011) Regulation of chromatin by histone modifications. Cell Res. 21, 381–395 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Silverstein R. A., and Ekwall K. (2005) Sin3: a flexible regulator of global gene expression and genome stability. Curr. Genet. 47, 1–17 [DOI] [PubMed] [Google Scholar]
  • 5. Grzenda A., Lomberk G., Zhang J. S., and Urrutia R. (2009) Sin3: master scaffold and transcriptional corepressor. Biochim. Biophys. Acta 1789, 443–450 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Cowley S. M., Iritani B. M., Mendrysa S. M., Xu T., Cheng P. F., Yada J., Liggitt H. D., and Eisenman R. N. (2005) The mSin3A chromatin-modifying complex is essential for embryogenesis and T-cell development. Mol. Cell. Biol. 25, 6990–7004 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Dannenberg J. H., David G., Zhong S., van der Torre J., Wong W. H., and Depinho R. A. (2005) mSin3A corepressor regulates diverse transcriptional networks governing normal and neoplastic growth and survival. Genes Dev. 19, 1581–1595 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Neufeld T. P., Tang A. H., and Rubin G. M. (1998) A genetic screen to identify components of the sina signaling pathway in Drosophila eye development. Genetics 148, 277–286 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Pennetta G., and Pauli D. (1998) The Drosophila Sin3 gene encodes a widely distributed transcription factor essential for embryonic viability. Dev. Genes Evol. 208, 531–536 [DOI] [PubMed] [Google Scholar]
  • 10. Barnes V. L., Bhat A., Unnikrishnan A., Heydari A. R., Arking R., and Pile L. A. (2014) SIN3 is critical for stress resistance and modulates adult lifespan. Aging (Albany NY) 6, 645–660 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Sharma V., Swaminathan A., Bao R., and Pile L. A. (2008) Drosophila SIN3 is required at multiple stages of development. Dev. Dyn. 237, 3040–3050 [DOI] [PubMed] [Google Scholar]
  • 12. Swaminathan A., and Pile L. A. (2010) Regulation of cell proliferation and wing development by Drosophila SIN3 and String. Mech. Dev. 127, 96–106 [DOI] [PubMed] [Google Scholar]
  • 13. Spain M. M., Caruso J. A., Swaminathan A., and Pile L. A. (2010) Drosophila SIN3 isoforms interact with distinct proteins and have unique biological functions. J. Biol. Chem. 285, 27457–27467 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Sambrook J., and Russell D. W. (2001) Molecular Cloning: A Laboratory Manual, Third Ed., pp. A8.40–A8.55, Cold Spring Harbor Laboratory Press, New York [Google Scholar]
  • 15. Gajan A., Barnes V. L., Liu M., Saha N., and Pile L. A. (2016) The histone demethylase dKDM5/LID interacts with the SIN3 histone deacetylase complex and shares functional similarities with SIN3. Epigenetics Chromatin 9, 4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Pile L. A., and Wassarman D. A. (2000) Chromosomal localization links the SIN3-RPD3 complex to the regulation of chromatin condensation, histone acetylation and gene expression. EMBO J. 19, 6131–6140 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Saha N., Liu M., Gajan A., and Pile L. A. (2016) Genome-wide studies reveal novel and distinct biological pathways regulated by SIN3 isoforms. BMC Genomics 17, 111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Brand A. H., and Perrimon N. (1993) Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118, 401–415 [DOI] [PubMed] [Google Scholar]
  • 19. Kadamb R., Mittal S., Bansal N., Batra H., and Saluja D. (2013) Sin3: insight into its transcription regulatory functions. Eur. J. Cell Biol. 92, 237–246 [DOI] [PubMed] [Google Scholar]
  • 20. Kong Q., Zeng W., Wu J., Hu W., Li C., and Mao B. (2010) RNF220, an E3 ubiquitin ligase that targets Sin3B for ubiquitination. Biochem. Biophys. Res. Commun. 393, 708–713 [DOI] [PubMed] [Google Scholar]
  • 21. Pungaliya P., Kulkarni D., Park H. J., Marshall H., Zheng H., Lackland H., Saleem A., and Rubin E. H. (2007) TOPORS functions as a SUMO-1 E3 ligase for chromatin-modifying proteins. J. Proteome Res. 6, 3918–3923 [DOI] [PubMed] [Google Scholar]
  • 22. Kim W., Bennett E. J., Huttlin E. L., Guo A., Li J., Possemato A., Sowa M. E., Rad R., Rush J., Comb M. J., Harper J. W., and Gygi S. P. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol. Cell 44, 325–340 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Mertins P., Qiao J. W., Patel J., Udeshi N. D., Clauser K. R., Mani D. R., Burgess M. W., Gillette M. A., Jaffe J. D., and Carr S. A. (2013) Integrated proteomic analysis of post-translational modifications by serial enrichment. Nat. Methods 10, 634–637 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Blount J. R., Tsou W. L., Ristic G., Burr A. A., Ouyang M., Galante H., Scaglione K. M., and Todi S. V. (2014) Ubiquitin-binding site 2 of ataxin-3 prevents its proteasomal degradation by interacting with Rad23. Nat. Commun 5, 4638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Cogoni C., and Macino G. (2000) Post-transcriptional gene silencing across kingdoms. Curr. Opin. Genet. Dev. 10, 638–643 [DOI] [PubMed] [Google Scholar]

Articles from The Journal of Biological Chemistry are provided here courtesy of American Society for Biochemistry and Molecular Biology

RESOURCES