Southern blight disease of tomato control by 1-aminocyclopropane-1-carboxylate (ACC) deaminase producing Paenibacillus lentimorbus B-30488

abstract

Tomato cultivation is highly susceptible for soil born diseases and among them southern blight disease caused by Scelerotium rolfsii is very common. For its management use of chemical fungicides is not very successful as their spores are able to survive for many years in the soil. As an alternative eco-friendly approach to control the disease antagonistic microbes are being characterized.Among them plant growth promoting rhizobacteria Paenibacillus lentimorbus B-30488 (B-30488) with antagonistic properties, multiple PGP attributes stress tolerance and ACC deaminase enzyme activity is characterized to decipher its mode of action against S. rolfsii under in vitro and in vivo conditions. In vitro results obtained from this study clearly demonstrate that B-30488 has ability to show antagonistic properties under different abiotic stresses against S. rolfsii. Similar results were also obtained from in vivo experiments where B-30488 inoculation has efficiently controlled the disease caused by S. rolfsii and improve the plant growth. Deleterious enhanced ethylene level in S. rolfsii infected plants was also ameliorated by inoculation of ACC deaminase producing B-30488. The ACC accumulation, ACO and ACS activities were also modulated in S. rolfsii infected plants. Results from defense enzymes and other biochemical attributes were also support the role of B-30488 inoculation in ameliorating the biotic stress caused by S. rolfsii in tomato plants. These results were further validated by pathogen related gene expression analysis by real time PCR. Overall results from the present study may be concluded that ACC deaminase producing B-30488 has ability to control the southern blight disease caused by S. rolfsii and commercial bioinoculant package may be developed.

Introduction

India is the second largest producer of tomato in the world, by growing it in 0.5 million hectares with annual production of 7.4 million tonnes and productivity of 14.3 tonnes/hectare.¹ Cultivation of tomato is highly susceptible for many phytopathogens, which resulted in the major yield loss and deterioration in fruit quality. Major fungal phytopathogens in tomato are causing Fusarium wilt (Fusarium oxysporum f. sp. lycopersici), Verticillium wilt (Verticillium dahliae), early blight (Alternaria solani), late blights (Phytophthora infestans) and southern blight disease (Scelerotium rolfsii). Among all the fungal diseases, southern blight is one of the most devastating disease caused by pathogen S.rolfsii, a soil born fungus infect the collar region of plant and showed lesions on the stem at or near the soil line.² These lesions develop very rapidly, girdling the stem and resulting in a sudden and permanent wilting of the plant. The pathogens of sclerotial diseases cause damping-off of seedlings, stem canker, crown blight, root, crown, bulb, tuber and fruit rots.^3,4

During management of such plant diseases it is extremely difficult to control soil-borne fungi via use of chemical fungicides since their spores are able to survive for many years in the soil.⁵ Alternative eco-friendly approach to control the disease is the use of natural antagonistic microorganisms. The microorganisms with biological control of plant disease are selected from the native source which can be either fungi or bacteria with ability to induce systemic defense responses and control the diseases.^1,5,6 A group of bacteria which have ability to compete in the rhizosphere with antagonistic potential toward phytopathogens and stress tolerance by enhancing the secondary metabolites, hormones, antibiotics, enzymes are consider as potential strain to develop the formulation. A common bacterial enzyme 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase which has been reported to ameliorate abiotic and biotic stresses with plant growth promotion in several host plants.⁶ Bacteria producing ACC deaminase enzyme decreases the ACC concentration which is the immediate precursor of ethylene synthesis by enhancing the ACC oxidase activity and ACC synthase under stressed conditions.^6,7 The inoculation of tomato plants with ACC deaminase producing plant PGPR which act as a biocontrol agent of plant diseases might be helpful to reduce the damage caused by the southern blight disease.^8,9 During normal environmental conditions, reactive oxygen species (ROS) productionin plants is low but it increases dramatically when plants are subjected to any stress. Plant cells posses different antioxidant enzymes such as catalase (CAT), superoxide dismutase (SOD), guaiacol peroxidase (GPX), ascorbate peroxidase (APX) that eliminate these reactive free radicals or suppress their formation and convert into less harmful species.^10-12 Plants stimulate many adaptive strategies in response to various stresses and activate signaling by formation of ROS and induced pathogenesis related proteins which degrade pathogen's cell wall ultimately.¹³ This signaling is responsible for defense reaction and provides antimicrobial activity. Ethylene has also been increased with accumulation of ROS in plant tissues,¹⁴ and homeostasis might be important for pathogen growth inhibition.¹⁵ Plants have various defense-related genes that are transcribed and expressed a variety of defense products in response to pathogen attack.¹⁶ Plant defense responses are typically triggered by the contact with phytopathogenic microorganisms, but they can also be stimulated by beneficial microbes.¹⁷ These induced systemic resistance (ISR) elicitors are perceived by plants to ultimately give rise to an active immune response by programming and mobilizing defense-related enzymes and induce accumulation of proline and phenols.^18,19 The increased production of enzymes and phenolic compounds may play an important role in the resistance process observed in plants.²⁰ PGPR help to elicit the defense response in plants against pathogen and ISR is associated with primed expression of defense genes.²¹ Defense gene transcripts generally accumulate within minutes to hours around infection sites, and from hours to days at distant sites throughout the plant.²²

Multifarious beneficial traits of Paenibacillus lentimorbus B-30488 (B-30488) as plant growth promotion, modulation of natural antioxidants in functional foods,^23,24 biological control against Fusarium oxysporum f. sp ciceri, Alternaria solanii^1,25 drought stress²⁶ bioremediation of chromium-contaminated soil²⁷ was reported earlier. Strain B-30488 has been deposited under the Budapest treaty into Agricultural Research Service (ARS) patent culture collection, United States Department of Agriculture, Illinois. The present study was performed with the aims to evaluate the mode of action and effectiveness of ACC deaminase-producing bacterium B-30488 to control southern blight disease.We have also correlated the ethyelene metabolism and ROS pathway of defense to elucidate the mechanism of S. Rolfsii biocontrol by B-30488. To the best of our knowledge this is the first study on southern blight disease biocontrol by ACC deaminase producing PGPR and deciphering the correlation with ROS pathway of defense.

Materials and methods

Bacterial, fungal Strains and inoculum preparation

Paenibacillus lentimorbus NRRL B-30488 (formerly known as Bacillus lentimorbus)1, was isolated from milk of Sahiwal cow.25 Monitoring of B-30488 in the rhizosphere, a stable spontaneous Rifr derivative of B-30488 (B-30488r) was used as described earlier.25 The enumeration of the B-30488r population in the tomato rhizosphere was carried out by serial dilutions method on NA medium containing Rifampicin (50 ?g/ml). After 48 h of incubation at 28°C, colonies were counted and the population of B-30488r was expressed as log10 CFU g-1.The pathogenic fungi S. rolfsii was collected from Plant Pathology group (CSIR-National Botanical Research Institute, Lucknow, India) and maintained on potato dextrose agar (PDA, HiMedia Pvt. Ltd. Mumbai) and sub-cultured biweekly, mycelial suspension for inoculation on plants was prepared according to methods described by Hennin et al.²⁸

Fungal growth inhibition

The interaction of S. rolfsii with B-30488 was elucidated in NB medium using dual culture test based on growing the bacterium in the presence or absence of the fungi as described by Nautiyal et al.²³ with little modifications. Agar disks (5-mm in diameter) of S. rolfsii were individually inoculated in 150 ml Erlenmeyer flasks, each containing 50 ml of NB. Inoculum of B-30488 containing 1 × 10 ⁹ CFU/ml was inoculated, 2 d before and same day of fungal inoculation and the flasks incubated at 28°C for 7 d in an incubator shaker under static conditions; the control cultures were grown without bacteria. Abiotic stress conditions were also evaluated by growing them at different temperature i.e. 25°C and 35°C, salt concentrations i.e., 50, 100, 150, 250, 500 and 1000 mm NaCl (w/v), pH i.e. Five and 9 and drought i.e., Fifteen%, 30% and 45% PEG6000 (w/v). The mycelial dry weights of the fungus grown in the presence and absence of B-30488, was determined by filtering out the spent media using a Whatman filter paper no.1 and drying the fungal biomass at 60°C for 3 d

Disease index

Number of symptomatic leaves and dead plants were recorded every week from 4 weeks after Pathogen inoculation and PGPR treated plants. Disease developments on each plants was rated using the following scale: 5 = plant dead; 4 = 76 to 100% of leaves with symptoms; 3 = 51 to 75% of leaves with symptoms; 26 to 50 % of leaves with symptoms; 2 = <25% of leaves with symptoms and 0 = no symptoms the disease index was calculated using the following rating by the formula.²⁹

$${\displaystyle \text{Disease index=}\frac{\pounds \text{ (Rating No}\text{. x No}\text{. of plants in the rating) x100}}{\left(\text{Total No}\text{.of plants x highest rating}\right)}}$$

Biocontrol efficacy of B-30488 under greenhouse conditions

Tomato seeds were surface sterilized by immersing in 70% ethanol for 1 min, followed by 3 rinses with sterile distilled water. The tomato seeds were sown in seedling trays containing garden soil and incubated in a growth chamber at 25°C. After germination, the seedlings were transferred to greenhouse (28°C/22°C day/night) and grown under natural illumination. Three weeks old tomato seedlings were transplanted into plastic pots containing mixture of soil:sand:vermiculite in 1:1:1 ratio and subjected to the following treatments: Uninoculated control (C); Treated with PGPR B-30488 (B); Treated with pathogenic fungi S. Rolfsii (F); Treated with PGPR B-30488 and pathogenic fungi S. rolfsii (B+F). Fungal treatment was given according to Khan et al.¹ In brief, mycelium fragments of 8 mm² were cut from the growing end of mycelium growth on plate, inoculated in PDB and grown for 7 d The liquid was then filtered through muslin cloth. The recovered mycelium was suspended in water and mixed thoroughly for 1 min. The density of the mycelial suspension was measured at OD₅₉₀ nm and suspension with 1.0 at OD₅₉₀ was sprayed on 3 weeks old transplanted pots whereas control pots were sprayed with distilled water only. Twenty four pots were maintained per treatment, each with a single plant and arranged in a completely randomized design with 3 replications with 6 plants per treatment.Measurements on morphologicalparameters were recorded after 1, 3 and 7 d of S. rolfsii infection, using methods as described earlier.¹ Leaf tissues were collected and immediately frozen in liquid nitrogen and stored at −80°C until use.

Ethylene emission analysis

Ethylene emissions from tomato seedlings were measured following the protocol of Madhaiyan et al.³⁰ with modification. Tomato leaves collected from plants grown in the greenhouse were placed in 120 ml vials and sealed with a rubber septum for 4 h. One ml of headspace air was sampled and injected into a Gas Chromatograph (Thermo scientific, USA) packed with Poropak-Q column at 70°C and equipped with a flame ionization detector. The amount of ethylene emission was expressed as nmol of ethylene h^{−1 g} dry weight⁻¹ and compared to a standard curve generated with pure ethylene.

Measurement of ACC level in plant tissue

ACC concentrations in plant tissue were measured as described by Siddikee et al.³¹ One gram of tomato leaf sample was immediately frozen in liquid nitrogen and ground. ACC from frozen ground tissue was extracted using 5 ml 80% methanol containing butylated hydroxyl toluene (BHT, 2 mg l⁻¹) as an antioxidant and incubated at room temperature for 45 min. Samples were centrifuged at 2,000 g at 20°C for 15 min and were resuspended in 4 ml methanol and again centrifuged. The combined supernatants were evaporated to dryness under vacuum in a rotatory evaporator. Residues were resuspended in 2 ml distilled water and then the upper aqueous phase (0.5 ml) obtained by extracting with dichloromethane was mixed with 0.1 ml HgCl₂ (80 mmol) in test tubes and sealed with rubber septa. Then 0.2 ml NaOCl solution (40 ml NaOH, 80 ml 12.5% NaOCl solution, and 30 ml distilled water) was injected into the tubes, shaken, and incubated for 8 min. One milliliter of the gaseous portion was removed and assayed for ethylene by gas chromatography (GC).

Assay of enzyme activity of the ethylene biosynthetic pathway

The protein extracts for measuring in vitro ACS and ACO activity were prepared according to Siddikee et al.³¹ Enzyme extracts for ACS activity were obtained by homogenizing a 1-g sample of pulverized tissues in 4 ml of 100 mmol Na-phosphate (pH 9.0) containing 5 µM pyridoxal phosphate (PLP), 4 mmol 2-mercaptoethanol (2-ME), 1 mmol EDTA, and 10% glycerol in the presence of 1 g polyvinylpolypyrrolidone (PVPP). Ammonium sulfate (35 and 75% saturation) was added to the enzyme extract to obtain precipitation and was resuspended in 2.5 ml of a solution containing 100 mmol Na-phosphate (pH 7.8), 5 µM Pyridoxal phosphate (PLP), 0.5 mmol 2-ME, and 10% glycerol. The preparations of the enzymes were carried out at 4. ACS activity was assayed by incubating a 100-ll enzyme solution (1.29 mg protein) with 100 mmol 2-[4-(2-hydroxyethyl)-1- piperazinyl] ethanesulfonic acid (HEPES)–KOH (pH 8.5), 5 µmol PLP, 100 µmol S-adenosyl-L-methionine (SAM), and test chemicals at given concentrations in a total volume of 400 µl. After incubation for 15 min at 30°C, the amount of ACC produced was determined as described above.

For assaying the ACO activity, frozen tissues were pulverized in liquid nitrogen and homogenized in 2 ml g⁻¹ of extraction buffer consisting of 100 mmol Tris–HCl (pH 7.2), 10% (w/v) glycerol, and 30 mmol sodium ascorbate. The homogenate was centrifuged at 15,000 rpm for 15 min at 4 °C. The supernatant obtained was used for the in vitro ACO assay. Enzyme activity was assayed at 30 °C for 15 min in 10 ml screw-cap tubes fitted with a Teflon-coated septum containing 1.5 ml of supernatant, 50 µmol FeSO₄, 1 mmol ACC, and 5% (v/v) CO₂. After the incubation period, the quantity of ethylene released into the headspace was determined by GC.

Biochemical analyses

All biochemical analyses were performed in triplicate from leaves of all sets after 1, 3 and 7 d of fungal infection.

Chlorophyll pigment

Chlorophyll was extracted from tomato leaf using 80% acetone as solvent.0.3 g of fresh sample was homogenized in 3 ml of chilled acetone (80%v/v). The absorbance was read at 645 nm (chlorophyll a) and 663 nm (chlorophyll b) in a UV- 160 a spectrophotometer and chlorophyll contents were calculated using the equations suggested by Lichtenthaler.³²

$${\displaystyle \text{Total chlorophyll }\left({\text{mg g}}^{\text{−1}}\right)\text{ = 20}\text{.2 }\left(\text{A645}\right)\text{ + 8}\text{.02 }\left(\text{A663}\right)\text{ × V/}\left(\text{1000 × w}\right)}$$

Where A = optical density

V = final volume of 80% acetone (ml)

w = dry weight of sample taken (g)

Proline content

The proline content was quantified by the acid-ninhydrin procedure of Bates et al.³³ The leaf tissues (0.5 g) were ground with 3% sulfosalicylic acid (10mL) and clarified by centrifugation. Supernatant (2mL) was mixed with the same volume of acid-ninhydrin and acetic acid, the mixture was incubated at 100°C for 1 h, and the reaction was finished in an ice bath. The reaction mixture was extracted with 4 mL of toluene using a vortex mixer for 15–20s and absorbance was read at 520 nm.

Lipid peroxidation (MDA)

Lipid peroxidation was determined by estimation of MDA content following Heath and Pacter³⁴ with slight modification. Plant material 0.5 gm was homogenized in 5 ml of 0.1% trichloroacetic acid (TCA).The homogenate was centrifuged at 10000 X g for 5 min for every 1 ml of aliquote,4 ml of 20% TCA containing 0.5% thiobarbitaric acid (TBA) was added. Mixture was heated at 95°C for 30 min and then cooled quickly on ice-bath. After centrifugation of the mixture at 10000 X g for 15 min the absorbance of the supernatant was taken at 532 and 600 nm.

Antioxidant enzyme assays

A crude enzyme extract was prepared by homogenizing 0.5 g of frozen leaf tissues in an extraction buffer containing 1 mM EDTA, 0.05% Triton X-100 and 2% polyvinyl pyrrolidone (PVP), 1 mM ascorbate in 50 mM potassium phosphate buffer (pH 7.8) using a chilled mortar and pestle. The homogenate was centrifuged at 10,000 g for 20 min and the supernatant was stored at −20°C for further used for the following enzyme assays.

Superoxide dismutase activity

Total SOD activity was determined according to Beauchamp and Fridovich.³⁵ The reaction mixture contained 13 mM methionine, 2 mM riboflavin, 0.1 mM EDTA, and 75µM nitrobluetetrazolium (NBT) salt dissolved in 3 ml of 50 mM sodium phosphate buffer (pH 7.8). 3 ml of the reaction mixture was added to 100 µl of enzyme extract. The mixtures were illuminated in glass test tubes in triplicates of Philips 40-W fluorescent tubes. The absorbance was read at 560 nm in the spectrophotometer against the blank. SOD activity is expressed in U mg⁻¹ protein (U = change in 0.1 absorbance h⁻¹ mg⁻¹ protein under assay conditions).

Catalase activity

Total CT activity was assayed according to the method of Chandlee and Scandalios.³⁶ The assay mixture contained 2.6 mL of 50 mmol L⁻¹ potassium phosphate buffer (pH 7.0), 0.4 mL of 15 mmol L⁻¹ H₂O₂, and 0.04 mL of enzyme extract. Catalyze mediated changes in absorbance were read at 240 nm. The enzyme activity was expressed in U mg⁻¹ protein (U = 1 mM of H₂O₂ reduction min⁻¹ mg⁻¹ protein). The enzyme protein was estimated by the method of Bradford³⁷ for all the enzymes.

Guaiacol peroxidase (GPX) activity

GPX was assayed using the method of Zheng and Van Huystee³⁸ and Hemeda and klein³⁹ by recording an increase in the absorbance at 470 nm as a result of oxidation of guaiacol to tetra-guaiacol. A 100 ml of reaction mixture was prepared by adding 10 ml of 1% guaiacol (v/v), 10 ml of 0.3% H₂O₂ and 80 ml of 50 mM phosphate buffer (Ph-6.6), and 75 µl of enzyme mixture was added to 3 ml final volume of above reaction mixture. The linear portion of the activity curve was used to express enzyme activity (expressed asUmg⁻¹ protein). One unit of enzyme activity represented the amount of enzyme catalyzing the oxidation of 1 μmol of guaiacol min⁻¹.

Ascorbate peroxidase (APX) activity

APX activity was determined spectrophotometrically by recording a decrease in absorbance at 290 nm because of oxidation of ascorbate.⁴⁰ The 3 ml of reaction mixture contain 50 Mm phosphate buffer (pH 7),0.1 Mm H₂O₂, 0.5 mM sodium ascorbate,0.1 mM EDTA and a suitable amount of enzyme extract. One unit of APX activity was assumed as the amount of the enzyme which oxidised 1 μmol ascorbate per min at 30°C.

Real-time analysis of ACS, ACO and PR genes expression in response to Paenibacillus lentimorbus B-30488^r inoculation

In brief total RNA (1 mg) was extracted from tomato leaves using Trizol reagent (sigma, USA) according to the manufacturer's instructions and treated with RNase-free DNase to remove genomic DNA. cDNA was synthesized using the AccuScript High Fidelity 1st Strand cDNA Synthesis Kit (Agilent technologies, USA). Primers sets of ethylene metabolism and pathogenesis related 12 genes were used for expression analysis (Table 1). SYBR Green Master Mix (Agilent technologies, USA) was used. The data were analyzed using the delta-delta-Ct method.41 Tomato actin was used as an internal control. The following protocol was used for amplification: 940C for 5 min followed by 35 cycles at 940C for 30 s, 550C for 30 s and 720C for 60 s.The specificity of the individual PCR amplification was checked using a heat dissociation curve from 55 to 950C following the final cycle of the PCR

Table 1.

List of tomato primers used in real time PCR.

	Primer name	Sequence (5′-3′)
1	ACS- FOR: ACS -REV	CTACCGTATTCAATCCTCC AGTTTCCAAAGTGACATCTC
2	ACO-FOR ACO-REV	ATG TGA TCA TTG TAG TTG ACC ACA ATA GAG TGG CGC
3	PR1- FOR PR1 -Rev	TATAGCCGTTGGAAACGAAG GAACCTAAGCCACGATACCA
4	PR2A -FOR PR2A REV	TATAGCCGTTGGAAACGAAG TGATACTTTGGCCTCTGGTC
5	PR4 - FOR PR4 -REV	TATCTTGCGGTTCACAACGA AAGCCACGATACCATGAACA
6	PR7- FOR PR7- REV	AACTGCAGAACAAGTGAAGG AACGTGATTGTAGCAACAGG
7	CHI3 -FOR CHI3 -REV	CAATTCGTTTCCAGGTTTTG ACTTTCCGCTGCAGTATTTG
8	CHI9 –FOR CHI9 -REV:	AATTGTCAGAGCCAGTGTCC TCCAAAAGACCTCTGATTGC
9	CAL -FOR CAL -REV	GATGCTTGCCAAGTGATGA GTTTAAGGAGCCGCTTTAGG
10	Glu FOR Glu REV	AACGAGCAACCCTCAATCTG TGGAGAGTAGCGATCAACGA
11	CATALASE -FOR CATALASE -REV	GAAACAATGTCCCCGTGTTC ACCACAAGTTGGCTTCCAGT
12	PPO -FOR PPO -REV	CATGCTCTTGATGAGGCGTA CCATCTATGGAACGGGAAGA
13	Actin-FOR Actin-REV:	AGGCACACAGGTGTTATGGT AGCAACTCGAAGCTCATTGT

Results

Biological control activity of B-30488 against S. rolfsii

In vitro studies were carried out to evaluate the biocontrol effect of B-30488 against S. rolfsii under control and stressed conditions. Overall fungal dry biomass was reduced when subjected to drought, temperature and pH while equal or slight increase was observed under salt stress upto 250 mM NaCl concentration, while further increasing concentration of salt inhibit fungal growth. When we grew B-30488 and S. Rolfsii together at same time in NB medium for 7 d fungal dry biomass was inhibited by 75.31% under control condition and 23.14 to 87.04% indifferent stressed conditions. Minimum inhibition was observed under drought stress (15% PEG) followed by salt stress while maximum was observed at pH 5. Two days before inoculation of B-30488 prior to fungi has inhibited higher S. Rolfsii dry biomass by 30.70 to 87.69% which is marginally higher as compared to same day inoculation but trend for the biocontrol was similar to the same day inoculation (Table 2). Growth of S. Rolfsii mycelia was inhibited by 23.14%, 36.89% and 38.42% in presence of B-30488 in 15%, 30% and 45% PEG6000, respectively, similarly mycelia growth was inhibited in 50, 100, 150, 250, 500 and 1000 mM NaCl by 63.39%, 63.06, 64.38, 52.70, 22.73 and 13.48% respectively. B-30488 inhibited S. Rolfsii mycelia growth at 25°C, 35°C, pH5.0 and pH9.0 in the range of 77.11%, 80.21%, 87.04% and 81.55%, respectively (Table 2).

Table 2.

Effect of abiotic stresses on the biological control of B30488 against S. rolfsii under in vitro conditions.

	Control	BFa	% inhibition	2BFb	% inhibition
Control	890.5 ± 11.50	219.90 ± 17.61	75.31	166.35 ± 6.55	81.32
15% PEG	858.92 ± 58.55	660.20 ± 21.80	23.14	595.27 ± 31.14	30.70
30% PEG	564.65 ± 9.15	356.35 ± 31.25	36.89	309.30 ± 19.00	45.22
45% PEG	329.78 ± 35.61	203.08 ± 9.34	38.42	150.30 ± 12.40	54.42
50 MM	998.15 ± 5.45	365.45 ± 21.55	63.39	271.90 ± 35.60	72.76
100 mM	957.70 ± 11.90	353.75 ± 31.35	63.06	251.15 ± 18.77	73.78
150 mM	954.47 ± 50.68	340.00 ± 29.60	64.38	311.25 ± 19.18	65.46
250 mM	606.73 ± 27.05	286.97±18 .59	52.70	268.30 ±16 .72	55.78
500 mM	396.73 ± 24.22	306.57±23 .87	22.73	267.43 ± 23 .99	32.59
1000 mM	273.03 ± 27.53	236.23±16 .98	13.48	185.13 ± 21 .41	32.19
25°C	586.10 ± 7.90	134.10 ± 23.70	77.12	138.50 ± 21.00	76.37
35°C	357.80 ± 16.40	70.80 ± 5.00	80.21	101.50 ± 10.30	71.63
pH 5.0	707.70 ± 57.10	91.70 ± 20.60	87.04	87.10 ± 18.90	87.69
pH 9.0	448.25 ± 7.85	82.70 ± 20.15	81.55	97.60 ± 8.40	78.23

BF^a: Bacteria and Fungus inoculated at same day.

2BF^b: Bacteria inoculated 2 d prior to fungus inoculation.

Disease index

Average disease index of the 24 independent S. Rolfsii infected plants treated with B-30488 and only S. rolfsii treated plants were calculated for 4 week after pathogen infection (Fig. 1). The results clearly showed from 3 independent experiments with 24 plants that the numbers of dead plants were significantly lower in B-30488 treated plants as compared to alone S. rolfsii infected plants. Out of 24 plants mean number of dead plants from 3 experiments were 13.3 in alone S. rolfsii infected plants and it reduced to 8.0 with B-30488 treated plants. No symptoms were observed in control and B-30488 treated plants. Average disease index of the of 3 independent experiments for S. rolfsii treated plants were 87.22% after 4 week of infection while this was 63.06% for B-30488 inoculated plants with fungal infection (Fig. 2).

Figure 1.

Pictorial representation for Paenibacillus lentimorbus B-30488 inoculation enhances tomato growth promotion and biological control against Sclerotium rolfsii.

Figure 2.

Assessment of disease parameters for southern blight disease of tomato under greenhouse conditions.

Plant growth parameters

Plant growth parameters (root length, shoot length, fresh weight and dry weight) were recorded after 1, 3 and 7 d of S. rolfsii inoculation on 30 d old tomato seedlings (Fig. 3). The inoculation of B-30488 enhances root length by 6.90, 30.00, 20.37%, shoot length by 2.60, 1.16, 34.16%, fresh weight by 4.40, 3.55, 47.72% and dry weight by 11.09, 20.42 and 30.74% as compared to uninoculated control at 1, 3 and 7 days, respectively. Response on plant growth parameters observed due to S. rolfsii infection decreases by root length 6.90, 17.50 14.81% shoot length 1.95, 9.58, 14.36% fresh weight 3.19, 13.84, 42.90% and dry weight 14.97, 19.03 and 31.23% as compared to uninoculated control at 1, 3 and 7 d respectively. Whereas amelioration in tomato plants were recorded due to prior inoculation of B-30488 in S. rolfsii infected plants. Results clearly demonstrated that inoculation of B-30488 has ameliorated the biotic stress caused by S. rolfsii by enhancing plant biomass in terms of root length by 5.81, 6.06, 17.39% shoot length by 2.65, 4.81, 26.01% fresh weight by 6.09, 8.33, 40.94% and dry weight by 14.00, 26.94, 38.97% as compared to S. rolfsii control at 1, 3 and 7 d respectively (Fig. 3).

Figure 3.

Plant growth promoting attributes by Paenibacillus lentimorbus B-30488 inoculation on tomato growth and biological control against Sclerotium rolfsii.

Physiological parameters

Chlorophyll content

Data shown that B-30488 inoculation enhances total chlorophyll by 7.11, 12.30, and 18.13 % as compared to uninoculated control after 1, 3 and 7 d respectively (Fig. 4). Inoculation of S. rolfsii reduces total chlorophyll by 3.77, 49.87 and 54.86 % as compared to uninoculated control after 1, 3 and 7 d respectively, while inoculation of B-30488 ameliorated the in S. rolfsii treated plants total chlorophyll by 0.17, 51.12 and 61.77% as compared to alone S. rolfsii treated plants after 1, 3 and 7 d respectively.

Figure 4.

Effect of Paenibacillus lentimorbus B-30488 inoculation on tomato chlorophyll, proline and lipid peroxidation in presence and absence of Sclerotium rolfsii.

Proline content

Proline accumulation was recorded in the B-30488 inoculated plants and results revealed that at day 1 proline accumulation is reduced by15.18% but at day 3 and 7 significant increases by 31.09 and 45.72% were observed as compared to uninoculated control (Fig. 4). Infection caused by S. rolfsii has significantly enhanced the proline content by 23.69, 280.05 and 502.02 % at day 1, 3 and 7 as compared to uninoculated control (Fig. 4). Proline accumulation in B-30488 inoculated plants infected with S. Rolfsii was ameliorated by 24.50, 29.18, 15.67% at 1, 3 and 7th day respectively.Lipid peroxidation

MDA accumulation was observed in the B-30488 inoculated plants and results showed it is marginally increased by 14.88, 5.25 and 8.33% as compared to uninoculated control, while S. rolfsii infection caused significantly enhanced the MDA content by 86.76, 132.81 and 85.36% at day 1, 3 and 7 as compared to uninoculated control (Fig. 4). However, inoculation of B-30488 with S. rolfsii ameliorated the accumulated MDA by 14.49, 13.71 and 22.29% as compare to alone S. rolfsii inoculated plants.

SOD activity

The activity of SOD was increased in plants treated with B-30488 by 16.92, 41.33 and 16.60% and in fungus treated plant it increases by 59.92, 419.95 and 564.38% on 1st, 3rd and 7th day respectively as compared to uninoculated control (Fig. 5). A decrease in SOD activity was observed by 14.72, 39.33 and 43.15% on 1st, 3rd and 7th day on the treatment of B-30488 in fungal inoculated plants as compared to S. rolfsii inoculated plants as a sign of amelioration.

Figure 5.

Modulation of defense enzymes in tomato plants by Paenibacillus lentimorbus B-30488 inoculation due to Sclerotium rolfsii infection.

Guaiacol peroxidise activity

A marginal increase of 2.46, 9.01 and 18.17% was observed in activity of one major enzyme Guaiacol peroxidase in the glutathione cycle in B-30488 inoculated plants, while the S. rolfsii treated plant showed increase in GPX activity by 55.76, 152.38 and 307.53% on 1st, 3rd and 7th day respectively as compared to uninoculated control (Fig. 5). A decrease in GPX activity was recorded by 26.79, 14.47 and 30.31% on 1st, 3rd and 7th day on the treatment of B-30488 in S. rolfsii inoculated plants.

Catalase activity

Catalase activity in this study was increased at 1st, 3rd and 7th day by 17.97, 41.65 and 18.82% respectively in B-30488 inoculated plants as compared to uninoculated plants. The S. rolfsii treated plant also showed increase in catalase activity by 86.17, 170.57 and 280.31% on 1st, 3rd and 7th day respectively as compared to uninoculated control (Fig. 5). A decrease in catalase activity was recorded by 30.77, 35.25 and 39.04% on 1st, 3rd and 7th day on the treatment of B-30488 in fungal inoculated plants.

Ascorbate peroxidase (APX) activity

An increase in the APX activity was measured by 11.41, 7.42 and 7.82% higher than uninoculated plant on 1st, 3rd and 7th day. While the activity of APX was found to be increased in S. rolfsii treated plant by 51.17, 180.13 and 294.72% on 1st, 3rd and 7th day respectively (Fig. 5). While inoculation of B-30488 decreases the APX activity by 35.04, 34.35 and 39.14%, as compared to alone S. rolfsii treated plants after 1, 3 and 7 d respectively.

Ethylene production

Ethylene production was increased in tomato seedlings by 15.66, 5.64 and 3.02% in B-30488 inoculated tomato plants while it was much higher in case of S. rolfsii inoculated plants by 61.71, 47.24 and 44.36% respectively (Fig. 6). Inoculation of B-30488 with S. rolfsii ameliorated the ethylene emission by 24.28, 24.19 and 27.40% at day 1, 3 and 7 respectively as compared to alone S. rolfsii inoculated.

Figure 6.

Effect Sclerotium rolfsii infection and inoculation with Paenibacillus lentimorbus B-30488 on ethylene biosynthesis.

Concentration of ACC

The concentration of free ACC in the tissue extracts of tomato plants increased in B-30488 by 15.71, 11.36 and 9.57%, while S. rolfsii inoculation by 61.71, 47.24 and 44.36% as compared to uninoculated control at day 1, 3 and 7 respectively (Fig. 6). Amelioration of biotic stress in terms of S. rolfsii infection in tomato plants were demonstrated by significantly less ACC accumulation in B-30488 inoculation by 19.59, 18.06 and 17.67% as compared to alone S. rolfsii infected plants.

ACC synthase (ACS) activity

ACC synthase, the enzyme catalyzing the conversion of SAM to ACC were measured on GC by measuring the amount of ethylene. In tomato plants, ACS activity recorded with B-30488 and S. rolfsii alone and in combination of both (Fig. 6). Initially ACS activity was increase at day 1 and 3 by 12.06 and 1.94% while at day 7 reduces by 0.95% in B-30488 inoculated plants as compared to uninoculated control. S. rolfsii treated plants demonstrated 49.11, 15.99 and 26.35% increase as compared to uninoculated control at day 1, 3 and 7 respectively. Significant reduction of ACS activity was observed in B-30488 treated with S. rolfsii by 21.06, 21.27 and 24.73% as compared to alone S. rolfsii treated one.

ACC oxidase (ACO) activity

ACC oxidase enzyme, which converts ACC into ethylene, could be measured on GC by measuring the amount of ethylene produced. At day 1 reduction in ACO activity was observed in B-30488 inoculated tomato plants by 5.36% while at day 3 and 7 activity was enhanced by 16.69 and 12.65% as compared to uninoculated control (Fig. 6). Infection caused due to S. rolfsii inoculation in tomato plants significantly enhanced the ACO activity by 14.37, 38.63 and 65.48% as compared to uninoculated control at day 1, 3 and 7 respectively. Inoculation of B-30488 in S. rolfsii infected plants reduced the ACO activity by 30.32, 20.35 and 26.96% as compared to alone S. Rolfsii infected plants.

Real-time PCR analysis of ACS, ACO and PR protein expression

In general, B-30488 spp. significantly decreased the expression of defense related gene in tomato plants challenged with S.rolfsii. The expression of ethylene pathway related gene ACS and ACO was little high by1.32 and 1.24 fold in B-30488 inoculated plants as compared to uninoculated control plants. Similar to ACC oxidase activity, these both gene expressions also increased in tomato infested with S.rolfsii compared to control (Fig. 7). The S. rolfsii treated plants recorded increase in ACS and ACO gene expression (5.02 and 3.39 fold expression respectively). Conversely, inoculation of ACC deaminase producing B-30488 strains reduced the expression of these 2 genes even in the S.rolfsii treated plants. The expression of CHI3, CHI9, Glu, calmodulin and PPO gene was little high by 1.84, 1.42, 1.61 1.98 and 1.30 respectively in tomato plants inoculated with B-30488 only as compared to control (Fig. 7). However, these gene expressions were even high by 5.39, 6.01, 3.40, 2.08 and 5.84 fold in plants ameliorated by inoculation on B-30488 treatment prior to S.rolfsii infection. Further the expression of other pathogenesis related gene like PR1, PR2A, PR4 and PR7 also showed the similar pattern of expression which was highest in PGPR ameliorated fungal infected plants. Expression of these genes was higher by 4.73, 6.57, 7.24 and 4.79 fold respectively as compared to uninoculated plants (Fig. 7).

Figure 7.

Expression analysis of ACS, ACO and PR genes expression in response to Paenibacillus lentimorbus B-30488 inoculation.

Discussion

The presented study was conducted to address the role of ACC deaminase containing PGPR P.lentimorbus B-30488 in ameliorating the biotic stress caused by S. rolfsii infection in tomato. Overall results from presented study clearly demonstrated that inoculation of B-30488 has significantly enhanced the plant growth under controlled conditions.Visual observation along with disease index data clearly demonstrated that southern blight disease caused by S. rolfsii were significantly controlled by B-30488 inoculation (Figs. 1 and 2). To decipher the mechanism of B-30488 mediated alteration in the morphology and physiology of host plants array of tests were evaluated and results clearly demonstrated that inoculation of B-30488 not only enhance the growth of tomato plants but also protect them from disease caused by S. rolfsii by maintaining the homeostasis in plant defense mechanisms. Earlier studies were also revealed that ACC deaminase producing PGPR are responsible toward minimizing the deleterious level of ethylene during biotic and abiotic stress and facilitate the growth of their host plants and enhance resistance in tomato plant during biotic stress.⁶

In general, pathogen infection strongly correlated with the time of ethylene production increase and the development wilt symptoms has also been reported similar to our study.^42-44 PGPR with ability to produce ACC deaminase activity breaks the immediate precursor i.e. ACC of the ethylene biosynthesis, to produce α-ketobutyrate and ammonia can regulate ethylene level, an important signaling molecule in plants under stressed condition resulted in plant growth promotion.^43,44 Similarly, decrease in photosynthesis efficiency and chlorophyll content of pathogen treated plant demonstrated that biotic stress limited the photosynthesis and respiration rate which leads to increase in ethylene level and ROS species formation. It has been also reported earlier that biotic stress resulted in increase on proline accumulation and activity of H₂O₂ scavenging enzymes in tomato plants.^10-12 In agreement to the earlier studies, our results demonstrated that the proline accumulation, APX and GPX and SOD, activities were significantly increased in S. rolfsii treated plants as compared to control while decreased in B-30488 treated infected plants with S. rolfsii.

Further, gene expression of ACO and ACS remained low in tomato plants treated with B-30488 compared to S. rolfssi treatment. Since ACC is the substrate for ACO, reduction in the substrate quantity would lead to reduced activities of ACO, subsequently reducing the amount of ethylene, the product of ACC oxidation. As the enzyme ACC deaminase produced by B-30488 hydrolyzes the ACC into ammonia and a-ketobutyrate, reduced levels of ACC, the substrate for ACO, consequently result in lower amount of ethylene in stressed plants. The same has already been demonstrated in canola and tomato seedlings treated with ACC deaminase producing Methylobacterium spp^42-44 Pathogenesis- related protein (PRs) can be induced by different stress stimuli and plays an important role in plant defense against pathogenic constraints, and in general adaptation to stressful environments.^43-45

Many PR proteins like PR1, PR2A, PR4, PR7, Catalase, CHI3, CHI9, GLU, calmodulin and PPO were higher in expression. The expression of these genes was high upon fungal infection as compared to tomato plants inoculated with B-30488 alone. Interestingly, expression of all these gene have gone very high when plants were treated with PGPR prior to S. rolfsii infection which showed a established mechanism of defense against fungal infection under greenhouse conditions. These results were very similar to previous studies done in tomato on bacterial and fungal infection.^43,44 Increased PR proteins activity parallel to ethylene reduction reflects the role of ACC deaminase containing B-30488 in the induction of plant defense responses. From the above results, probable reason for reduced disease symptoms in S. rolfssi challenged tomato plants could be attributed to the reduced ethylene levels and ACC deaminase activity due to the inoculation of B-30488. The enhanced accumulation of PR proteins/defense enzymes coupled with reduced ethylene levels substantiates the role of the inoculated B-30488 in development of disease resistance in tomato plants. Similar results were obtained by Chen et al.⁴⁶ that defense enzymes were induced in cucumber roots by PGPR and Pythium aphanidermatum inoculation. In addition to the known plant growth promotion effects, the B-30488 strains may prevent the pathogenesis in the challenged plants. We therefore suggest the possible use of B-30488 as a potential biocontrol means, for controlling bacterial diseases in tomato plants after a complete field evaluation, which will be helpful in further understanding of the molecular mechanism of B-30488 mediated defense system in plants.

Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.

Acknowledgments

The study was supported by the network project Plant Microbe and soil interactions (PMSI) (BSC-0117) funded by Council of Scientific and Industrial Research, New Delhi, India