Skip to main content
Vector Borne and Zoonotic Diseases logoLink to Vector Borne and Zoonotic Diseases
. 2016 Jun 1;16(6):363–367. doi: 10.1089/vbz.2015.1898

Detection of a Novel Ehrlichia Species in Haemaphysalis longicornis Tick from China

Limei Luo 1, Jimin Sun 2, Jianbo Yan 3, Chengwei Wang 4, Zhentang Zhang 5, Li Zhao 1, Huiju Han 1, Zhendong Tong 3, Miaomiao Liu 1, Yuyan Wu 2, Hongling Wen 1, Rong Zhang 2, Zaifeng Xue 5, Xifeng Sun 1, Kefeng Li 3, Dongqiang Ma 5, Jianwei Liu 1, Yuting Huang 1, Ling Ye 4, Wenqian Li 1, Jianmin Jiang 2,, Xue-jie Yu 1,,6,
PMCID: PMC4884337  PMID: 27135624

Abstract

We collected 2460 Haemaphysalis longicornis ticks from vegetation in Jiaonan County, Shandong Province, in June of 2013 and Daishan County, Zhejiang Province, China, in May of 2015. The tick DNA was subsequently amplified with nested polymerase chain reaction using Ehrlichia common 16S rRNA gene primers and Ehrlichia ewingii species-specific groEL and gltA primers. We found 0.4% (3/780) of the ticks from Zhejiang Province contained Ehrlichia DNA that was different from all known Ehrlichia species, but most closely related to E. ewingii. We concluded that a novel Ehrlichia species exists in H. longicornis ticks in China.

Key Words: : Ehrlichia, Haemaphysalis longicornis, Tick-borne diseases, China

Introduction

Ehrlichia are tick-borne obligatory intracellular bacteria, which infect humans and animals. The currently known Ehrlichia species include Ehrlichia chaffeensis, Ehrlichia canis, Ehrlichia ewingii, Ehrlichia muris, and Ehrlichia ruminantium. All species of Ehrlichia have been reported to cause human infection. E. chaffeensis and E. canis cause monocyte infection (Buller et al. 1999, Anderson et al. 1992, Dawson et al. 1991), E. ewingii causes neutrophil infection (Anderson et al. 1992, Dawson et al. 1991, Perez et al. 2006, Buller et al. 1999), and the target cell of E. muris in humans has not been identified. Symptoms of Ehrlichia infection might include fever, headache, myalgia, progressive leukopenia, thrombocytopenia, and anemia. The illness occurs during the spring and summer months when the ticks are active. Ehrlichia species were now recognized as significant agents of emerging human zoonoses worldwide. Ehrlichia infection has been reported in Europe, Asia, Africa, and the United States (Magnarelli and Anderson 1993, Brouqui et al. 1994, Heppner et al. 1997, Petrovec et al. 1997, Ndip et al. 2009). Ehrlichia species are transmitted through the bite of an infected nymphal or adult tick vector that had been previously infected in the larval or nymphal stage while feeding on Ehrlichia-infected animals (usually wildlife) known as a reservoir host (Nicholson et al. 2010). Disease distribution in humans and animals correlates with the distribution of those vector ticks. In China, the distribution and species of Ehrlichia are not clear across a massive land and different climates. A few studies reported that E. chaffeensis and E. canis exist in animals and ticks in China (Cao et al. 2000, Pan et al. 2000, Dong et al. 2013). In this study, we used ticks as sentinel species to detect the risk of Ehrlichia infection to humans in China.

Material and Method

Study sites

Ticks were collected from Jiaonan County of Shandong Province (119°30′-120°11′ E, 35°35′-36°8′N) and Daishan County of Zhejiang Province (121°31′-123°17′ E, 30°07′-30°38′N) (Fig. 1). Both sites are in East China with Jiaonan County in the north and Daishan County in the south, and the distance between the two areas is ∼1000 KM. Jiaonan County is located on the coast of the Yellow Sea, and Daishan County is located on islands in the East China Sea. The climate of the two sites is the maritime monsoon type with four distinct seasons. The annual average temperature is below12.1°C and 16.2°C, and the average rainfall is 798 mm and1400 mm, respectively, in the two sites.

FIG. 1.

FIG. 1.

Map of China. Stars indicate tick collection sites: Jiaonan County in Shandong Province and Daishan County in Zhejiang Province.

Tick collection

We collected 2460 Haemaphysalis longicornis ticks by flagging from vegetation in Jiaonan County, Shandong Province, in June of 2013 and in Daishan County, Zhejiang Province, in May of 2015. The ticks were classified morphologically and molecularly as described previously (Luo et al. 2015). The ticks were frozen at −80°C until DNA extraction.

DNA preparation and polymerase chain reaction amplification of Ehrlichia DNA

Total tick nucleic acids were extracted simultaneously by using the AllPrep DNA/RNA Mini Kit (Qiagen) according to the manufacturer's instructions. Ticks were pooled with each pool consisting of 50 larvae, 20 nymphs, or 5 adult ticks and were homogenized using metal beads (Tissue Lyser; Qiagen) in the RLT buffer (Qiagen). Tick DNA was used as template for polymerase chain reaction (PCR) amplification of ehrlichial DNA. PCR primers for the 16S rRNA gene and amplification conditions were described previously (Rar et al. 2005, Kim et al. 2013). PCR primers for groEL and gltA gene were designed using E. ewingii groEL and gltA genes as templates in this study. The sequences of all primers are in Table 1. No Ehrlichia DNA was used as positive control, and distilled water was used as negative control. The amplification cycles of outer primers for each gene were DNA denaturation step at 95°C for 5 min, followed by 35 cycles of 1 min at 95°C, 1 min at 60°C, and 1 min at 72°C, and a final extension step of 7 min at 72°C. The PCR protocol for the inner primers was a DNA denaturation step at 95°C for 5 min, followed by 35 cycles for 1 min at 95°C, 1 min at 56°C, and 45 s at 72°C, and a final extension step of 7 min at 72°C.

Table 1.

Nested PCR Primers for Ehrlichia 16S rRNA Gene, gltA, and groEL

Name Target gene Sequence 5′→3′ Product size (bp)
EHR1-out 16S rRNA GAACGAACGCTGGCGGCAAGC 691
EHR2-out   AGTA[T/C]CG[A/G]ACCAGATAGCCGC  
EHR3-in   TGCATAGGAATCTACCTAGTAG 524
EHR4-in   CTAGGAATTCCGCTATCCTCT  
5GltA-out gltA GGCATTTTTCCTGATGTGCATGAT 897
3GltA-out   ATACCATTGAGCCGACCAGCC  
5GltA-in   AGCAGTGTCTCAAATTGCAGG 426
3GltA-in   ATCCTATGGCCAAAACCCATTA  
5GroEL-out groEL GTACGGCTGGACCTAAAGGA 701
3GroEL-out   AGTGCTGAGAGCTTCACCTTC  
5GroEL in   ATGGGGCACCAGAAGTTACA 422
3GroEL -in   CCACGATCAAATTGCATACCATCA  

in, inside primer; out, outside primer; PCR, polymerase chain reaction.

PCR was performed with the Taq DNA polymerase reagent kit (Promega). Negative control with sterilized distilled water was run simultaneously. The amplified DNA was separated by electrophoresis in a 1.5% agarose gel and visualized under UV light. The desired band was purified from the gel using a Gel Extraction Kit (Qiagen). The purified PCR product was ligated into the pMD 19-T vector (Takara Bio, Inc.) according to the manufacturer's instructions. Positive clones were sequenced on both strands.

Phylogenetic analysis

The sequences of the PCR products were aligned with sequences in GenBank using BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Phylogenetic trees were constructed with the neighbor-joining method in MEGA5 (Tamura et al. 2007, Tamura et al. 2011). The robustness of the trees was tested with 1000 bootstrap replications.

Result

Tick collection

A total of 2460 ticks collected in Jiaonan and Daishan counties were used in this study, and the number of ticks of each developmental stage at each site is listed in Table 2. All ticks were identified as H. longicornis.

Table 2.

Haemaphysalis longicornis Ticks from Jiaonan and Daishan Counties OF China

Study site Larvae Nymph Adult Total
Daishan 0 630 150 780
Jiaonan 120 1200 360 1680
Total 120 1830 510 2460

Detection of Ehrlichia DNA in ticks

With Ehrlichia species common 16S rRNA gene primers, Ehrlichia DNA was detected in three pools of nymphal ticks from Daishan County of Zhejiang Province, but none of the tick pools from Shandong Province was positive by PCR amplification. Assuming that a positive pool of ticks contained one infected tick, the minimal Ehrlichia infection rate of ticks from Zhejiang Province was 0.4% (3/780). DNA sequence analysis revealed that the sequence from the ticks was 98.3–99.8% homologous to the 16S rRNA genes of Ehrlichia species, with the highest homology to E. ewingii (99.8%).

We designed primers from the groEL and gltA of E. ewingii to amplify these genes from the tick pools that contained the ehrlichial 16S rRNA gene by nested PCR. Fragments of the groEL and gltA genes were amplified from all three pools of ticks that contained ehrlichial 16S rRNA gene DNA sequences revealing that the homology of the Ehrlichia species from the Chinese ticks to the known Ehrlichia species was 89.6–93.8% for the groEL gene and 68.5–90.4% for the gltA gene. Again, E. ewingii is the closest species related to the Ehrlichia species from the ticks with both groEL and gltA genes.

The phylogenetic analysis based on 16S rRNA gene sequences showed that the Ehrlichia species from ticks were tightly clustered together with uncultured Ehrlichia species from Xinjiang Province, China, and E.ewingii, but were distantly related to other species of Ehrlichia (Fig. 2A). The sequences of gltA and groEL of Ehrlichia species from the ticks also clustered together with the uncultured Ehrlichia species from Xinjiang Province, China, and E. ewingii, and distantly clustered with other species of Ehrlichia (Fig. 2B, C). The phylogenetic analysis using concatenated sequences of 16S rRNA gene, groEL gene, and gltA gene was consistent with the results of phylogenetic analysis using each individual gene, which showed that Ehrlichia species from Daishan tick formed a monophyletic group with E. ewingii, but not other Ehrlichia species (Fig. 2D).

FIG. 2.

FIG. 2.

Phylogenetic analysis of Ehrlichia species. The trees were constructed using the 16S rRNA gene (A), groEL gene (B), gltA gene (C), and the concatenated sequences of the 16S rRNA gene, gltA, and groEL of each Ehrlichia species (D). The number in each line was GenBank accession number for each sequence in (A–C). The GenBank accession numbers (in the order of 16S rRNA gene, groEL, and gltA) for each Ehrlichia species in (D) are the following: Daishan Ehrlichia (KT886409, KT886408, KT886407),E. chaffeensis (AF416764, KJ907753, AF304142), Ehrlichia muris (GU358691, CP006917, CP006917), Ehrlichia canis (KJ513194, JN391408, AY647155), Candidatus E. khabarensis (KR063138, KR063139, KR063140), Ehrlichia ewingii (NR 044747, KJ907744, DQ365879), Ehrlichia ruminantium (NR 044831, CR925677, DQ513396), and Anaplasma phagocytophilum (HM366586, KC800986, AY464138). Numbers at nodes represented bootstrap values. Scale bar represented nucleotide substitutions per site. Dot represented the new Ehrlichia species from ticks collected in vegetation of Daishan County of Zhejiang Province. The trees were rooted with the sequences of the corresponding genes of A. phagocytophilum.

The sequence of each gene from all three pools of ticks from Daishan was identical, and only one sequence for each gene from the ticks was deposited in GenBank (Accession numbers: KT886407 9).

Discussion

In this study, we identified an Ehrlichia species in H. longicornis tick collected from southern China, most closely related to E. ewingii. However, despite the high homology of the 16S rRNA gene between the Ehrlichia organism in H. longicornis tick and E. ewingii, the groEL and gltA sequences of the Ehrlichia organism in H. longicornis tick were dramatically different from E. ewingii. The classification of the new species of Ehrlichia from this study needs to be further studied by isolation of the organism and comparison of complete genomes.

E. ewingii has been reported to infect humans, dogs, and deer and causes granulocytic ehrlichiosis in humans and dogs (Anderson et al. 1992, Breitschwerdt et al. 1998, Buller et al. 1999, Yabsley et al. 2002, Liddell et al. 2003). E. ewingii was reported only in the United States until recently when it was discovered to infect dogs in Cameroon (Ndip et al. 2005) and in Brazil (Oliveira et al. 2009). E. ewingii has been reported to be carried by Amblyomma americanum and Dermacentor variabilis ticks in the United States (Wolf et al. 2000, Steiert and Gilfoy 2002).

In China, E. chaffeensis has been detected from ticks, including Amblyomma testudinarium, H. yeni, D. silvarum ticks collected from cattle, dogs, wild rats, and wild mice (Cao et al. 2000, Dong et al. 2013); E. canis was detected in Rhipicephalus sanguineus and Rhipicephalus microplus (formerly Boophilus microplus), and canine ehrlichiosis was found in southern China (Pan et al. 2000). E. ewingii had not been found previously in China. A new species of Ehrlichia was detected in H. longicornis in this study, and H. longicornis is the major tick species in East China, which has attracted more attention in recent years because it carries a novel deadly bunyavirus—severe fever with thrombocytopenia virus (SFTSV) (Yu et al. 2011). H. longicornis has been reported to carry several human pathogens, including bunyavirus, SFTSV (Luo et al. 2015), Rickettsia japonica (Uchida et al. 1995), and Anaplasma capra (Sun, et al. 2015) and Anaplasma phagocytophilum (Kim et al. 2003). In China, farmers are encouraged by local governments to breed domestic animals, such as sheep, goats, and cattle, which have dramatically promoted tick population growth, especially H. longicornis because it primary feeds on domestic animals. Ehrlichia infection in humans has not been investigated in China. Infection with Ehrlichia generally results in mild-to-severe febrile disease in humans (Buller et al. 1999). Further investigation on human infection with Ehrlichia pathogens should be carried out in China.

We detected the novel species in ticks collected from Zhejiang Province in southern China, but not from ticks from Shandong Province in northern China. However, this does not suggest that this Ehrlichia does not exist in northern China. The minimal infection rate of the ticks was based on PCR targeting the 16S rRNA gene common primers for Ehrlichia, which is not optimized for sensitivity; therefore, we cannot guarantee to detect the novel species of Ehrlichia from all investigated ticks, which may underestimate the infection rate of ticks with the novel Ehrlichia species.

Acknowledgments

The authors are grateful to Dr. David H. Walker (Department of Pathology, University of Texas Medical Branch at Galveston) for reviewing the manuscript. This study was supported by the Shandong University, a grant from Shandong Province Science and Technology Development Program (2014GSF121004), a grant from the National Nature Science Foundation of China (31570167), a grant from Zhejiang Province Major Science and Technology Program (2012C13016-2), and a grant from the Medical Research Program of Zhejiang Province (2014RCA002).

Author Disclosure Statement

No competing financial interests exist.

References

  1. Anderson BE, Greene CE, Jones DC, Dawson JE. Ehrlichia ewingii sp. nov., the etiologic agent of canine granulocytic ehrlichiosis. Int J Syst Bacteriol 1992; 42:299–302 [DOI] [PubMed] [Google Scholar]
  2. Breitschwerdt EB, Hegarty BC, Hancock SI. Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii. J Clin Microbiol 1998; 36:2645–2651 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brouqui P, Le Cam C, Kelly PJ, Laurens R, et al. Serologic evidence for human ehrlichiosis in Africa. Eur J Epidemiol 1994; 10:695–698 [DOI] [PubMed] [Google Scholar]
  4. Buller RS, Arens M, Hmiel SP, Paddock CD, et al. Ehrlichia ewingii, a newly recognized agent of human ehrlichiosis. N Engl J Med 1999; 341:148–155 [DOI] [PubMed] [Google Scholar]
  5. Cao WC, Gao YM, Zhang PH, Zhang XT, et al. Identification of Ehrlichia chaffeensis by nested PCR in ticks from Southern China. J Clin Microbiol 2000; 38:2778–2780 [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Dawson JE, Anderson BE, Fishbein DB, Sanchez JL, et al. Isolation and characterization of an Ehrlichia sp. from a patient diagnosed with human ehrlichiosis. J Clin Microbiol 1991; 29:2741–2745 [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Dong T, Qu ZY, Zhang LJ. Detection of A. phagocytophilum and E. chaffeensis in patient and mouse blood and ticks by a duplex real-time PCR assay. PLoS One 2013; 8:e74796. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Heppner DG, Wongsrichanalai C, Walsh DS, McDaniel P, et al. Human ehrlichiosis in Thailand. Lancet 1997; 350:785–786 [DOI] [PubMed] [Google Scholar]
  9. Kim CM, Kim MS, Park MS, Park JH, et al. Identification of Ehrlichia chaffeensis, Anaplasma phagocytophilum, and A. bovis in Haemaphysalis longicornis and Ixodes persulcatus ticks from Korea. Vector Borne Zoonotic Dis 2003; 3:17–26 [DOI] [PubMed] [Google Scholar]
  10. Kim E-J, Bauer C, Grevelding CG, Quack T. Improved PCR/nested PCR approaches with increased sensitivity and specificity for the detection of pathogens in hard ticks. Ticks Tick Borne Dis 2013; 4:409–416 [DOI] [PubMed] [Google Scholar]
  11. Liddell AM, Stockham SL, Scott MA, Sumner JW, et al. Predominance of Ehrlichia ewingii in Missouri dogs. J Clin Microbiol 2003; 41:4617–4622 [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Luo LM, Zhao L, Wen HL, Zhang ZT, et al. Haemaphysalis longicornisticks as reservoir and vector ofseverefever with thrombocytopenia syndrome virus in China. Emerg Infect Dis 2015; 21:1770–1776 [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Magnarelli LA, Anderson JF. Serologic evidence of canine and equine ehrlichiosis in northeastern United States. J Clin Microbiol 1993; 31:2857–2860 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Ndip LM, Labruna M, Ndip RN, Walker DH, et al. Molecular and clinical evidence of Ehrlichia chaffeensis infection in Cameroonian patients with undifferentiated febrile illness. Ann Trop Med Parasitol 2009; 103:719–725 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Ndip LM, Ndip RN, Esemu SN, Dickmu VL, et al. Ehrlichial infection in Cameroonian canines by Ehrlichia canis and Ehrlichia ewingii. Vet Microbiol 2005; 111:59–66 [DOI] [PubMed] [Google Scholar]
  16. Nicholson WL, Allen KE, McQuiston JH, Breitschwerdt EB, et al. The increasing recognition of rickettsial pathogens in dogs and people. Trends Parasitol 2010; 26:205–212 [DOI] [PubMed] [Google Scholar]
  17. Oliveira LS, Oliveira KA, Mourao LC, Pescatore AM, et al. First report of Ehrlichia ewingii detected by molecular investigation in dogs from Brazil. Clin Microbiol Infect 2009; 15:55–56 [DOI] [PubMed] [Google Scholar]
  18. Pan H, Ma YH, Tong SD, Sun Y, et al. Canine ehrlichiosis caused simultaneously by Ehrlichia canis and Ehrlichia platys. Microbiol Immunol 2000; 44:737–739 [DOI] [PubMed] [Google Scholar]
  19. Perez M, Bodor M, Zhang C, Xiong Q, et al. Human infection with Ehrlichia canis accompanied by clinical signs in Venezuela. Ann N Y Acad Sci 2006; 1078:110–117 [DOI] [PubMed] [Google Scholar]
  20. Petrovec M, Lotric Furlan S, Zupanc TA, Strle F, et al. Human disease in Europe caused by a granulocytic Ehrlichia species. J Clin Microbiol 1997; 35:1556–1559 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Rar VA, Fomenko NV, Dobrotvorsky AK, Livanova NN, et al. Tickborne pathogen detection, western Siberia, Russia. Emerg Infect Dis 2005; 11:1708–1715 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Steiert JG, Gilfoy F. Infection rates of Amblyomma americanum and Dermacentor variabilis by Ehrlichia chaffeensis and Ehrlichia ewingii in southwest Missouri. Vector Borne Zoonotic Dis 2002; 2:53–60 [DOI] [PubMed] [Google Scholar]
  23. Sun XF, Zhao L, Wen HL, Luo LM, et al. Anaplasma species in China. Lancet Infect Dis 2015; 15:1263–1264 [DOI] [PubMed] [Google Scholar]
  24. Tamura K, Dudley J, Nei M, Kumar S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol Evol 2007; 24:1596–1599 [DOI] [PubMed] [Google Scholar]
  25. Tamura K, Peterson D, Peterson N, Stecher G, et al. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011; 28:2731–2739 [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Uchida T, Yan Y, Kitaoka S. Detection of Rickettsia japonica in Haemaphysalis longicornis ticks by restriction fragment length polymorphism of PCR product. J Clin Microbiol 1995; 33:824–828 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Wolf L, McPherson T, Harrison B, Engber B, et al. Prevalence of Ehrlichia ewingii in Amblyomma americanum in North Carolina. J Clin Microbiol 2000; 38:2795. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Yabsley MJ, Varela AS, Tate CM, Dugan VG, et al. Ehrlichia ewingii infection in white-tailed deer (Odocoileus virginianus). Emerg Infect Dis 2002; 8:668–671 [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Yu XJ, Liang MF, Zhang SY, Liu Y, et al. Fever with thrombocytopenia associated with a novel bunyavirus in China. N Engl J Med 2011; 364:1523–1532 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Vector Borne and Zoonotic Diseases are provided here courtesy of SAGE Publications

RESOURCES