Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Jun 5.
Published in final edited form as: J Mol Biol. 2016 Apr 2;428(11):2259–2264. doi: 10.1016/j.jmb.2016.03.027

Arginine patch predicts the RNA annealing activity of Hfq from Gram negative and Gram positive bacteria

Amy Zheng 1, Subrata Panja 1,*, Sarah A Woodson 1,*
PMCID: PMC4884477  NIHMSID: NIHMS774875  PMID: 27049793

Abstract

The Sm-protein Hfq facilitates interactions between small non-coding RNA (sRNA) and target mRNAs. In enteric Gram negative bacteria, Hfq is required for sRNA regulation, and hfq deletion results in stress intolerance and reduced virulence. By contrast, the role of Hfq in Gram positive is less established and varies among species. The RNA binding and RNA annealing activity of Hfq from Escherichia coli, Pseudomonas aeruginosa, Listeria monocytogenes, Bacillus subtilis and Staphylococcus aureus were compared using minimal RNAs fluorescence spectroscopy. The results show that RNA annealing activity increases with the number of arginines in a semi-conserved patch on the rim of the Hfq hexamer and correlates with the previously reported requirement for Hfq in sRNA regulation. Thus, the amino acid sequence of the arginine patch can predict the chaperone function of Hfq in sRNA regulation in different organisms.

Keywords: Hfq, RNA chaperone, bacterial sRNA, molecular beacon, fluorescence anisotropy, small non-coding RNA, Sm protein

Graphical Abstract

graphic file with name nihms774875f5.jpg

Hfq is an abundant bacterial member of the Sm-superfamily that was originally discovered as an essential host factor for replication of E. coli bacteriophage Qβ (1, 2). More recently, the role of Hfq in small RNA (sRNA) mediated gene regulation has received considerable attention (3). sRNAs regulate diverse physiological behaviors such as stationary phase, stress responses, sugar metabolism, iron utilization and quorum sensing (4, 5, 6).

The Sm core of Hfq forms a ring-shaped homohexamer that binds the U-rich terminator at the 3’ end of most sRNAs and stabilizes the sRNA against turnover (7, 8). In most Gram negative bacteria, the opposite (distal) face also binds single-stranded A-rich RNA sequences found in mRNA targets and some sRNAs (9, 10, 11, 12). Importantly, complementary sequences in the sRNA and mRNA target also interact with an arginine patch (R16, R17 and R19) on the rim of the E. coli Hfq hexamer (13, 14, 15, 16, 17) that is essential for Hfq’s RNA annealing activity (15). In vitro annealing assays showed that E. coli Hfq accelerates sRNA-mRNA base pairing 30 to 100 times by nucleating the double helix between two complementary RNA strands (18, 19). This annealing activity is eliminated when all three arginines are replaced with alanine, and even an arginine to lysine substitution reduces E. coli Hfq’s chaperone activity (15).

Although Hfq is needed for sRNA regulation in Gram negative bacteria such as Escherichia coli and Salmonella (20), the requirement for Hfq in post-transcriptional regulation by Gram positive bacteria remains ambiguous (21). Hfq contributes to stress tolerance and pathogenicity in Listeria monocytogenes (22), Clostridium difficile (23) and other Gram positive bacteria (24). By contrast, deletion of Hfq from Bacillus subtilis and Staphylococcus aureus has almost no detectable phenotype (25, 26).

We noticed that the reported role of Hfq in sRNA-mediated gene regulation correlates with variations in the amino acid sequence of the basic patch on the Hfq rim (15). Although the potent E. coli Hfq chaperone has three arginines between residues 16–19 (RRER), the B. subtilis protein has only one arginine (RKEN) and the S. aureus protein has none (KANQ) (Fig. 1). Here, we use a well-established fluorescent RNA annealing assay to measure the chaperone activity of Hfq homologs from two Gram negative bacteria (E. coli, Pseudomonas aeruginosa) and three Gram positive bacteria (L. monocytogenes, B. subtilis and S. aureus). We show that RNA annealing activity increases with the number of arginine residues on the rim, with Gram positive Hfq proteins having little or no activity in our assay. Thus, the amino acid sequence of the arginine patch predicts Hfq’s chaperone activity and the degree to which Hfq facilitates interactions between sRNA and mRNA pairs in different bacteria.

Fig. 1. Basic patch on the rim of Hfq.

Fig. 1

Open in a new tab

(a) E. coli Hfq (1HK9) rendered as cyan surface, superimposed with the structure of RydC sRNA in complex with Hfq (4V2S). Red sticks, 3′ U6 in the proximal pore; yellow sticks, internal 5′ CUUC bound to the rim of Hfq. The remaining RydC residues are omitted for clarity. Blue surface, arginine patch with R16, R17 and R19 side chains shown for one subunit. The rim sequences of Hfq proteins used in this study are shown on the right. (b) Summary of Hfq activity from different organisms. The RNA annealing rates relative to no Hfq and sRNA binding are from this work; sRNA regulation is based on published work as described in the text.

RNA annealing activity of Hfq from different bacteria

An alignment of Hfq sequences from different bacteria revealed a partial conservation of amino acid residues that lie on the outer rim of the Hfq hexamer (15). Nearly all Hfq sequences contain an arginine at position 16 (E. coli numbering) on the proximal side of the rim. Position 17 is usually R or K, position 18 is neutral polar or acidic, and position 19, which lies closest to the distal face, is the most variable (15). In order to understand how this sequence variation alters the chaperone activity of Hfq, we over-expressed and purified five Hfq homologs (E. coli, P. aeruginosa, L. monocytogenes, B. subtilis and S. aureus) with different numbers of arginines in this motif (Fig. 1b).

The annealing activity was measured using a fluorescent molecular beacon that base pairs with target RNAs that end with 3′ U6 (target-U6) or 3′ A18 (target-A18) (Fig. 2a) (27). These target RNAs specifically bind the proximal face or distal face of E. coli Hfq, respectively, with Kd = 0.45 nM and 0.1 nM Hfq6 (27). The complementary region of the target and the beacon interacts with the rim of Hfq.

Fig. 2. RNA annealing activity depends on the rim sequence.

Fig. 2

Open in a new tab

E. coli, B. subtilis and S. aureus Hfqs were purified using a Ni-affinity column as described previously (29). P. aeruginosa and L. monocytogenes Hfqs were purified using the IMPACT-CN system (30). All proteins were further purified using a cation exchange column (GE) (29) and verified by SDS-PAGE. The ratio A260/A280 ~ 0.7 for all of the preparations. (a) Molecular beacon assay for RNA annealing. The loop of the molecular beacon (5′FAM-GGUCCCCCACUCGACUCACCACCGGACC-3′DABCYL) is complementary to target-U6 (5′ GUGGUCAGUCGAGUGGU6) and target-A18 (5′ GUGGUCAGUCGAGUGGA18). The increase in fluorescence intensity due to base pairing between molecular beacon and target RNAs was monitored by an Applied Photophysics SX 18MV stopped-flow spectrometer as described previously (27). 50 nM molecular beacon and 100 nM target RNAs were rapidly mixed in 0 – 250 nM Hfq in TNK buffer (10 mM Tris-HCl, pH 7.5; 50 mM NaCl and 50 mM KCl) at 30 °C. Individual kinetic traces were fitted to a double exponential rate equation (18). (b) Initial rate constants of annealing target-U6 at different concentrations of Hfq hexamer. The rate constants are the average of 5 technical replicates with standard deviations less than 5%. (c) Rate constants of annealing target-A18 versus Hfq concentration, as in (b).

The molecular beacon (50 nM) and target RNA (100 nM) were rapidly mixed in a stopped-flow spectrometer as described previously (28). The increase in beacon fluorescence over time was fit to a double exponential rate equation and the rate constants of the fast phase were plotted against Hfq6 concentration (Fig. 2b, c). As previously observed (19), the rate of RNA annealing increased with added E. coli Hfq, reaching a maximum value in 50 nM Hfq6, which equals the amount of molecular beacon. For target-U6 RNA, annealing was 15 times faster with 50 nM Hfq, compared to the no Hfq background (0.08 s−1 to 1.3 s−1; Fig. 2b). When the target RNA specifically binds to the distal face of Hfq (target-A18), 50 nM Hfq increased the annealing rate 100 times over the background (0.08 s−1 to 8 s−1; Fig. 2c).

We next compared the activity of E. coli Hfq, which has a rim motif of RRER, with that of P. aeruginosa Hfq (RKER). P. aeruginosa Hfq was noticeably less active in this assay than E. coli Hfq, increasing the maximum annealing rates only 4-fold and 10-fold for target-U6 and target-A18 RNAs, respectively, in saturating Hfq concentrations (Fig. 2b,c). This is presumably due to replacement of R17 by lysine in P. aeruginosa. L. monocytogenes Hfq, which has lysines at positions 17 and 19 (RKEK), was even less active, raising the maximum annealing rates only two- to three-fold (Fig. 2b,c). Hfq proteins from B. subtilis or S. aureus had no measurable activity in this assay above the no protein control (Fig. 2b,c). S. aureus Hfq is an extreme example in which even the highly conserved R16 is replaced by lysine (KANQ), and the other side chains on the rim are neutral.

sRNA binding to Hfq

Although the proximal face of Hfq is well conserved between different bacteria, differences in sRNA binding might also explain the range of observed annealing rates. We measured equilibrium binding between Hfq and a Cy3-labeled mini-sRNA using fluorescence anisotropy. The 3′ end of the mini-sRNA contains the important recognition elements of class I sRNAs (12), such as a 3′ U6 tail which binds to the proximal pore and a RydC sequence that binds to the rim of Hfq (Fig. 3a).

Fig. 3. Effects of rim arginines on sRNA binding.

Fig. 3

Open in a new tab

(a) Hfq binding to synthetic Cy3-labeled mini-sRNA (5’ Cy3 – GUGGUCAGUCGAGUGGCUUCCGUCCAUUUCGGACGUUUUUU; IDT) increases the fluorescence anisotropy of Cy3. The mini-sRNA contains 3′ U6 (red), a loop from RybB, and a CUUC motif from RydC (yellow). (b) Fractional binding from the relative change in anisotropy versus [Hfq6]. The anisotropy of 5 nM Cy3-sRNA in TNK buffer at 30 °C was measured using a Fluorolog-3 spectrofluorometer (Horiba) with single excitation and emission monochromators at 540 nm and 565 nm, respectively. Individual data sets were fitted to f = ΔA [Hfq]n/([Hfq]n + Kdn), in which ΔA is the difference in the anisotropy of the sRNA-Hfq complex and the free sRNA, and Kd is the dissociation constant. For titrations with E. coli Hfq, the data were iteratively fit by using the initial estimate of Kd to adjust the concentration of free Hfq, [Hfq] = [Hfq]total – 6fB[RNA]total, which was used to obtain a new estimate of Kd. The uncertainty in Kd was less than 25% based on the error in the fits and the difference between two independent trials.

E. coli Hfq formed a tight complex with Cy3-sRNA (2.7 ± 0.8 nM; Fig. 3), but the other bacterial Hfq proteins bound the Cy3-sRNA less tightly than E. coli Hfq (18 to 100 nM). This decrease in sRNA affinity may arise from the loss of arginine residues on the rim. Nevertheless, even S. aureus Hfq, which has no arginines on its rim, binds to Cy3-sRNA with Kd = 100 nM, well within the range of concentrations tested in our annealing assays. Because we were unable to recover RNA annealing activity at higher Hfq concentration, the lack of annealing activity cannot be explained by poor sRNA binding.

RNA binding to the distal face

The distal face of E. coli Hfq preferentially interacts with a repeated (AAN) triplet motif (9, 31), but this protein surface varies among Hfq homologs, resulting in altered binding specificities (32). For example, the Bacillus protein is reported to bind an AG dinucleotide (33). Fluorescence anisotropy binding assays (Fig. 4a) showed that target-A18 RNA interacts strongly with E. coli Hfq (Kd = 2.8 ± 0.1 nM), but weakly or not at all with L. monocytogenes and S. aureus Hfq (≥ 2 μM; Fig. 4b). The inability of Gram positive Hfq proteins to recognize an A-rich RNA target may contribute to their poor chaperone function, but does not explain their inability to act on sRNAs.

Fig. 4. Gram-positive Hfq proteins do not recognize A-rich target RNA.

Fig. 4

Open in a new tab

(a) Binding of FAM-labeled rA18 RNA to the distal face of Hfq was measured by fluorescence anisotropy, as previously described (15). (b) Fractional binding versus [Hfq6] was measured and fitted to a two-state Hill equation as described in Fig. 3b.

Conclusion

Our results show that the ability of Hfq to facilitate RNA interactions increases with the number of arginines in the rim motif, and that the rim motif also correlates with the reported role of Hfq in sRNA-mediated regulation in the respective host organism (Fig. 1). Hfq from E. coli and other γ-proteobacteria have a strong arginine patch (RRER or RKER) and are highly active in our RNA annealing assay, while hfq variants with low arginine content (RKEN or KANQ) have no measurable activity.

The strong RNA annealing activity of E. coli and P. aeruginosa Hfq agrees with the integral role of Hfq in sRNA regulation in enteric γ-proteobacteria. For example, E. coli, Salmonella, Pseudomonas and Vibrio sRNAs are known to control stress response, pathogenicity, quorum sensing and biofilm formation (4, 34, 35, 36). In contrast, although many Gram positive bacteria encode sRNAs, the requirement for Hfq in these organisms varies considerably. For example, deletion of hfq has little effect on stress response and pathogenesis in B. subtilis and S. aureus, suggesting that Hfq is dispensable in these species. Other bacteria lack Hfq entirely (37). Yet others, such as Burkholderia cenocepacia and Bacillus anthracis, encode two or more hfq homologs that appear to have different functions (38, 39).

Jousselin et al. (21) proposed that the requirement for Hfq lessens as the free energy of sRNA-mRNA pairing becomes more favorable, suggesting that Hfq is needed to stabilize sRNA-mRNA interactions. This concept agrees with the observed correlation between RNA chaperone activity and genetic function (Fig. 1b). On the other hand, C. difficile hfq (40), B. subtilis Hfq (25), and B. anthracis hfq2 and hfq3 (39) partially complement an hfq null in E. coli, indicating that they have some ability to support sRNA regulation. These proteins retain the proximal face residues involved in sRNA recognition. Other sequence variations, such as the capacity to recognize A-rich sequence motifs in mRNA targets or the size of the C-terminal extension, likely contribute to the function of Hfq in different types of bacteria. For example, recognition of Arich RNA motifs is important for the function of E. coli Hfq (28), yet the distal face residues that form the A-specific binding site are missing in many Gram positive hfq sequences (24), eliminating this RNA interaction (Fig. 4). More work is needed to understand how each of these interactions contributes to the varied roles of Hfq and other Sm proteins. Nevertheless, our results show that the arginine content of the rim motif is useful for predicting the chaperone activity of Hfq in different organisms.

Highlights.

  • E. coli Hfq facilitates sRNA-mRNA base pairing via a semi-conserved arginine patch.

  • sRNA binding and RNA annealing by Hfq from different bacteria were compared.

  • The RNA annealing activity of Hfq correlates with the size of the arginine patch.

  • The arginine patch motif predicts the genetic requirement for Hfq in a bacterium.

Acknowledgments

The authors thank R. Brennan, W. Winkler, P. Romby and A. Oglesby-Sherrouse for clones of L. monocytogenes, B. subtilis, S. aureus and P. aeruginosa Hfq, respectively. The authors also thank L. Djapgne for helping with protein purification, A. Santiago-Frangos for help with the mini-sRNA and for comments on the manuscript, and S. Gottesman and G. Storz for helpful discussion. This work was supported by a grant from the NIH (R01 GM46686).

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Franze de Fernandez MT, Eoyang L, August JT. Factor fraction required for the synthesis of bacteriophage Qbeta-RNA. Nature. 1968;219:588–590. doi: 10.1038/219588a0. [DOI] [PubMed] [Google Scholar]
  • 2.Brennan RG, Link TM. Hfq structure, function and ligand binding. Curr. Opin. Microbiol. 2007;10:125–133. doi: 10.1016/j.mib.2007.03.015. S1369-5274(07)00033-1 [pii] [DOI] [PubMed] [Google Scholar]
  • 3.Storz G, Vogel J, Wassarman KM. Regulation by small RNAs in bacteria: expanding frontiers. Mol. Cell. 2011;43:880–891. doi: 10.1016/j.molcel.2011.08.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Gottesman S, McCullen CA, Guillier M, Vanderpool CK, Majdalani N, Benhammou J, Thompson KM, FitzGerald PC, Sowa NA, FitzGerald DJ. Small RNA regulators and the bacterial response to stress. Cold Spring Harb. Symp. Quant. Biol. 2006;71:1–11. doi: 10.1101/sqb.2006.71.016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Harris JF, Micheva-Viteva S, Li N, Hong-Geller E. Small RNA-mediated regulation of host-pathogen interactions. Virulence. 2013;4:785–795. doi: 10.4161/viru.26119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Kaberdin VR, Blasi U. Translation initiation and the fate of bacterial mRNAs. FEMS Microbiol. Rev. 2006;30:967–979. doi: 10.1111/j.1574-6976.2006.00043.x. FMR043 [pii] [DOI] [PubMed] [Google Scholar]
  • 7.Schumacher MA, Pearson RF, Moller T, Valentin-Hansen P, Brennan RG. Structures of the pleiotropic translational regulator Hfq and an Hfq-RNA complex: a bacterial Sm-like protein. EMBO J. 2002;21:3546–3556. doi: 10.1093/emboj/cdf322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Aiba H. Mechanism of RNA silencing by Hfq-binding small RNAs. Curr. Opin. Microbiol. 2007;10:134–139. doi: 10.1016/j.mib.2007.03.010. S1369-5274(07)00027-6 [pii] [DOI] [PubMed] [Google Scholar]
  • 9.Link TM, Valentin-Hansen P, Brennan RG. Structure of Escherichia coli Hfq bound to polyriboadenylate RNA. Proc. Natl. Acad. Sci. U. S. A. 2009;106:19292–19297. doi: 10.1073/pnas.0908744106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mikulecky PJ, Kaw MK, Brescia CC, Takach JC, Sledjeski DD, Feig AL. Escherichia coli Hfq has distinct interaction surfaces for DsrA, rpoS and poly(A) RNAs. Nat. Struct. Mol. Biol. 2004;11:1206–1214. doi: 10.1038/nsmb858. nsmb858 [pii] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Soper T, Mandin P, Majdalani N, Gottesman S, Woodson SA. Positive regulation by small RNAs and the role of Hfq. Proc. Natl. Acad. Sci. U. S. A. 2010;107:9602–9607. doi: 10.1073/pnas.1004435107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Schu DJ, Zhang A, Gottesman S, Storz G. Alternative Hfq-sRNA interaction modes dictate alternative mRNA recognition. EMBO J. 2015;34:2557–2573. doi: 10.15252/embj.201591569. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Sauer E, Schmidt S, Weichenrieder O. Small RNA binding to the lateral surface of Hfq hexamers and structural rearrangements upon mRNA target recognition. Proc. Natl. Acad. Sci. U. S. A. 2012;109:9396–9401. doi: 10.1073/pnas.1202521109. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Zhang A, Schu DJ, Tjaden BC, Storz G, Gottesman S. Mutations in interaction surfaces differentially impact E. coli Hfq association with small RNAs and their mRNA targets. J. Mol. Biol. 2013;425:3678–3697. doi: 10.1016/j.jmb.2013.01.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Panja S, Schu DJ, Woodson SA. Conserved arginines on the rim of Hfq catalyze base pair formation and exchange. Nucleic Acids Res. 2013;41:7536–7546. doi: 10.1093/nar/gkt521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Peng Y, Curtis JE, Fang X, Woodson SA. Structural model of an mRNA in complex with the bacterial chaperone Hfq. Proc. Natl. Acad. Sci. U. S. A. 2014;111:17134–17139. doi: 10.1073/pnas.1410114111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Dimastrogiovanni D, Frohlich KS, Bandyra KJ, Bruce HA, Hohensee S, Vogel J, Luisi BF. Recognition of the small regulatory RNA RydC by the bacterial Hfq protein. Elife. 2014;3 doi: 10.7554/eLife.05375. 10.7554/eLife.05375. 10.7554/eLife.05375 [doi] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hopkins JF, Panja S, Woodson SA. Rapid binding and release of Hfq from ternary complexes during RNA annealing. Nucleic Acids Res. 2011;39:5193–5202. doi: 10.1093/nar/gkr062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Panja S, Santiago-Frangos A, Schu DJ, Gottesman S, Woodson SA. Acidic Residues in the Hfq Chaperone Increase the Selectivity of sRNA Binding and Annealing. J. Mol. Biol. 2015 doi: 10.1016/j.jmb.2015.07.010. S0022-2836(15)00391-5 [pii] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Wagner EG, Romby P. Small RNAs in bacteria and archaea: who they are, what they do, how they do it. Adv. Genet. 2015;90:133–208. doi: 10.1016/bs.adgen.2015.05.001. [DOI] [PubMed] [Google Scholar]
  • 21.Jousselin A, Metzinger L, Felden B. On the facultative requirement of the bacterial RNA chaperone, Hfq. Trends Microbiol. 2009;17:399–405. doi: 10.1016/j.tim.2009.06.003. [DOI] [PubMed] [Google Scholar]
  • 22.Christiansen JK, Larsen MH, Ingmer H, Sogaard-Andersen L, Kallipolitis BH. The RNA-binding protein Hfq of Listeria monocytogenes: role in stress tolerance and virulence. J. Bacteriol. 2004;186:3355–3362. doi: 10.1128/JB.186.11.3355-3362.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Boudry P, Gracia C, Monot M, Caillet J, Saujet L, Hajnsdorf E, Dupuy B, Martin-Verstraete I, Soutourina O. Pleiotropic role of the RNA chaperone protein Hfq in the human pathogen Clostridium difficile. J. Bacteriol. 2014;196:3234–3248. doi: 10.1128/JB.01923-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hajnsdorf E, Boni IV. Multiple activities of RNA-binding proteins S1 and Hfq. Biochimie. 2012;94:1544–1553. doi: 10.1016/j.biochi.2012.02.010. [DOI] [PubMed] [Google Scholar]
  • 25.Rochat T, Delumeau O, Figueroa-Bossi N, Noirot P, Bossi L, Dervyn E, Bouloc P. Tracking the Elusive Function of Bacillus subtilis Hfq. PLoS One. 2015;10:e0124977. doi: 10.1371/journal.pone.0124977. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Benito MB, Gorricho BP. Acute mastoiditis: increase in the incidence and complications. Int. J. Pediatr. Otorhinolaryngol. 2007;71:1007–1011. doi: 10.1016/j.ijporl.2007.02.014. S0165-5876(07)00098-5 [pii] [DOI] [PubMed] [Google Scholar]
  • 27.Panja S, Woodson SA. Hfq proximity and orientation controls RNA annealing. Nucleic Acids Res. 2012;40:8690–8697. doi: 10.1093/nar/gks618. gks618 [pii] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Panja S, Woodson SA. Fluorescence reporters for hfq oligomerization and RNA annealing. Methods Mol. Biol. 2015;1259:369–383. doi: 10.1007/978-1-4939-2214-7_22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Peng Y, Soper TJ, Woodson SA. Positional effects of AAN motifs in rpoS regulation by sRNAs and Hfq. J. Mol. Biol. 2014;426:275–285. doi: 10.1016/j.jmb.2013.08.026. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Kovach AR, Hoff KE, Canty JT, Orans J, Brennan RG. Recognition of Urich RNA by Hfq from the Gram-positive pathogen Listeria monocytogenes. RNA. 2014;20:1548–1559. doi: 10.1261/rna.044032.113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Lorenz C, Gesell T, Zimmermann B, Schoeberl U, Bilusic I, Rajkowitsch L, Waldsich C, von Haeseler A, Schroeder R. Genomic SELEX for Hfq-binding RNAs identifies genomic aptamers predominantly in antisense transcripts. Nucleic Acids Res. 2010;38:3794–3808. doi: 10.1093/nar/gkq032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Weichenrieder O. RNA binding by Hfq and ring-forming (L)Sm proteins: a tradeoff between optimal sequence readout and RNA backbone conformation. RNA Biol. 2014;11:537–549. doi: 10.4161/rna.29144. 29144 [pii] [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Someya T, Baba S, Fujimoto M, Kawai G, Kumasaka T, Nakamura K. Crystal structure of Hfq from Bacillus subtilis in complex with SELEX-derived RNA aptamer: insight into RNA-binding properties of bacterial Hfq. Nucleic Acids Res. 2012;40:1856–1867. doi: 10.1093/nar/gkr892. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Oglesby-Sherrouse AG, Vasil ML. Characterization of a heme-regulated noncoding RNA encoded by the prrF locus of Pseudomonas aeruginosa. PLoS One. 2010;5:e9930. doi: 10.1371/journal.pone.0009930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Feng L, Rutherford ST, Papenfort K, Bagert JD, van Kessel JC, Tirrell DA, Wingreen NS, Bassler BL. A qrr noncoding RNA deploys four different regulatory mechanisms to optimize quorum-sensing dynamics. Cell. 2015;160:228–240. doi: 10.1016/j.cell.2014.11.051. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Vogel J. A rough guide to the non-coding RNA world of Salmonella. Mol. Microbiol. 2009;71:1–11. doi: 10.1111/j.1365-2958.2008.06505.x. [DOI] [PubMed] [Google Scholar]
  • 37.Chao Y, Vogel J. The role of Hfq in bacterial pathogens. Curr. Opin. Microbiol. 2010;13:24–33. doi: 10.1016/j.mib.2010.01.001. [DOI] [PubMed] [Google Scholar]
  • 38.Ramos CG, Sousa SA, Grilo AM, Feliciano JR, Leitao JH. The second RNA chaperone, Hfq2, is also required for survival under stress and full virulence of Burkholderia cenocepacia J2315. J. Bacteriol. 2011;193:1515–1526. doi: 10.1128/JB.01375-10. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 39.Vrentas C, Ghirlando R, Keefer A, Hu Z, Tomczak A, Gittis AG, Murthi A, Garboczi DN, Gottesman S, Leppla SH. Hfqs in Bacillus anthracis: Role of protein sequence variation in the structure and function of proteins in the Hfq family. Protein Sci. 2015;24:1808–1819. doi: 10.1002/pro.2773. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Caillet J, Gracia C, Fontaine F, Hajnsdorf E. Clostridium difficile Hfq can replace Escherichia coli Hfq for most of its function. RNA. 2014;20:1567–1578. doi: 10.1261/rna.043372.113. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES