Prognostic potential of the MDM2 309T>G polymorphism in stage I lung adenocarcinoma

Abstract

The MDM2 protein plays an important role in the regulation of cell proliferation and apoptosis via ubiquitination and proteasome‐mediated degradation of p53. The genetic polymorphism rs2279744 (c.309T>G) of the MDM2 gene is reportedly associated with susceptibility and/or prognosis in various cancers. In this study, we investigated the risk factors for worse survival in patients with lung adenocarcinoma (AC). We examined the association between c.309T>G and the prognosis of lung cancer by retrospectively reviewing 453 lung cancer patients. We studied both, clinicopathological and genetic characteristics, including the c.309T>G, p53 Arg72Pro, EGFR,KRAS, and p53 mutations. Associations between these factors and survival outcome were analyzed using Cox proportional hazards models. The frequencies of MDM2 polymorphisms were T/T, 20.8%; T/G, 48.6%, and G/G, 30.7%. The overall survival (OS) of AC patients with pathological stage I disease and the MDM2 T/T genotype was significantly shorter than that of those with the T/G or G/G genotypes (P = 0.02). Multivariate analysis revealed that the MDM2 T/T genotype was an independent, significant prognostic factor (hazard ratio [HR] = 2.23; 95% confidence interval [CI]: 1.07–4.65; P = 0.03). The MDM2 T/T genotype was predictive of poorer survival in a Japanese population. Genotyping for this polymorphism might predict the clinical outcomes of stage I AC patients.

Introduction

Lung cancer is the leading cause of cancer‐related mortality worldwide 1. Although the overall incidence of lung cancer has been declining, particularly in Western countries, an increase in the proportion of lung adenocarcinoma (AC) is evident 2. The 5‐year survival rates for completely resected lung cancer were 86.8% (pathological [p‐] stage IA) and 73.9% (p‐stage IB) in Japan 3. A certain number of p‐stage I lung cancers paradoxically relapse even after surgical resection of the primary lesion and histopathological absence of any lymph node metastasis. This indicates that a small proportion of early‐stage lung cancers have highly metastatic characteristics. Therefore, screening possible high‐risk patients for disease recurrence is necessary to provide tailored medicine.

The p53 gene is a well‐known tumor suppressor that is frequently mutated in non‐small‐cell lung cancer (NSCLC) patients 4. p53 encodes a sequence‐specific DNA‐binding transcription factor targeting various genes that govern specific cellular processes 5. The MDM2 protein plays an important role in regulating cell proliferation and apoptosis by mediating ubiquitination and proteasome‐mediated degradation of p53 after binding directly to the latter protein; MDM2 has an E3 ubiquitin ligase activity 6, 7. A single‐nucleotide polymorphism (SNP) in the MDM2 promoter region, a T‐to‐G change at nucleotide c.309 (rs2279744) in the first intron (c.309T>G), increases the binding affinity toward stimulatory protein 1 (Sp1), causing higher‐level MDM2 expression 8. Also, cells harboring homozygous 309G alleles express higher levels of MDM2 protein, thereby reducing the tumor‐suppressing activity of p53 8. In humans, c.309T>G is associated with earlier onset of tumor formation in both hereditary and sporadic cancers 9. Recently, another antagonizing MDM2 polymorphism, SNP285, has been reported10 among Caucasians. SNP285 has been reported to nullify the effect of SNP309 and to reduced risk of breast, endometrial, and ovarian cancer. Molecular epidemiological studies of the c.309T>G polymorphisms in terms of lung cancer susceptibility11, 12, 13 have yielded contradictory findings. We recently reported that c.309T>G was not associated with lung cancer susceptibility in a Japanese population 14. The effects of c.309T>G on lung cancer survival have reported first in 200715 and remain controversial 12, 15, 16, 17, 18, 19, 20. So far, seven studies have analyzed the association between c.309T>G of the MDM2 gene and lung cancer prognosis. The G allele was reported to be a poor prognosis factor in Caucasians and Asians 15, 16. However, recently, some reports17, 20concluded that the T allele was a poor prognosis factor in Asians. Furthermore, three reports found no association between SNP309 and lung cancer survival in Asian 18, 19, Caucasian and African‐American 12.

In this study, we investigated whether c.309T>G of the MDM2 gene is closely associated with survival outcome of surgically resected NSCLC together with other clinicopathological and genetic characteristics.

Patients and Methods

Study population

To carry out this clinical research, we obtained approval from the Institutional Review Board of the Ethical Committee for Human Genome Analysis at Gunma University, and written informed consent from all the patients who participated. We analyzed 453 consecutive lung cancer patients (stages I–III) surgically treated between January 2003 and December 2012 at the Department of Thoracic and Visceral Organ Surgery, Gunma University Graduate School of Medicine, Gunma, Japan. Patients who had undergone preoperative therapies (chemotherapy and/or radiation therapy) and had a history of lung cancer were excluded. History of cancer and smoking were documented using a chart review before surgery. Never smokers were defined as individuals with a lifetime exposure to fewer than 100 cigarettes. Other patients were defined as smokers these include both former and current smoker. Disease staging was used to divide the patients into two groups: those of stages I and II–III. All the pathological factors, including pleural, vascular, and lymphatic invasion, were documented from the pathologic analysis at Gunma University Hospital. Cases that were positive for vascular invasion or lymphatic invasion were defined as lymphovascular invasion (LVI) positive. All the patients were reclassified according to the 7th edition of the International Union against Cancer (UICC) tumor‐node‐metastasis (TNM) staging system 21. The type of treatment after cancer recurrence was chosen by each individual physician. Overall survival (OS) was determined as the time from tumor resection to death from any cause. Disease‐free survival (DFS) was defined as the time between tumor resection and the first disease progression or death. All research followed the principles of the Declaration of Helsinki.

SNP genotyping

Peripheral venous blood samples were collected, and DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. The DNA was used for SNP typing of c.309T>G and p53 Arg72Pro polymorphisms. Genotyping of c.309T>G was carried out using the Duplex SmartAmp method as described previously 22. p53 Arg72Pro was genotyped using polymerase chain reaction‐restriction fragment length polymorphism (PCR‐RFLP) based on a previous report 23. Subsequently, the samples representing each genotypic pattern were used as controls in each assay.

Gene mutation analysis

Tissue samples from patients were isolated from surgically resected lung tumors. Lung cancer tissues were immediately frozen after surgical removal and stored at −80°C until DNA extraction using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI). The genomic DNA was used as a template for mutation analysis of EGFR, KRAS, and p53. KRAS and EGFR mutations were analyzed by sequencing as described previously 24, 25. Mutations in exons 5–8 of p53 were detected by direct sequencing 26. Briefly, primers used in the reactions were E5‐6S (5′‐TGCCCTGACTTTCAACTCTG‐3′) and E5‐6AS (5′‐AGTTGCAAACCAGACCTCAGG‐3′) for exons 5 and 6, and E7‐8S (5′‐CTTGCCACAGGTCTCCCCAA‐3′) and E7‐8AS (5′‐TCTCCTCCACCGCTTCTTGT‐3′) for exons 7 and 8. All the p53 mutations were confirmed by sequencing of both DNA strands.

Statistical analyses

Probability values less than 0.05 indicated a statistically significant difference. Differences in the distributions between groups were examined by Pearson χ ² tests. Kaplan–Meier curve and the log‐rank test were used to estimate differences in survival. Hazard ratios (HRs) from univariate Cox regression analysis were used to determine the association between clinic‐pathological features and OS. Variables with statistically significant differences in univariate analysis were entered into multivariate analysis. Multivariate Cox proportional hazards regression was used to evaluate independent prognostic factors. All the statistical analyses were performed using SPSS Statistics version 20 (IBM Co., NY, USA).

Results

Demographics of patients according to MDM2 genotype

Table 1 depicts the characteristics of the entire study population. The study population was composed of 260 males and 193 females of a median age 68 years (range, 33–87 years). The genotype frequencies of MDM2 polymorphisms were as follows: T/T, 20.8%; T/G, 48.6%; and G/G, 30.7%. The frequency of the MDM2 309G allele was 0.55, consistent with previously described values for Asian lung AC patients 22.

Table 1.

Patients characteristics

	n	%
Sex
Women	193	42.6
Men	260	57.4
Age
Mean ± SD	68.1 ± 9.5
Smoking status
Never smoker	179	59.5
Smoker	274	60.5
Surgical procedure
≥Lobectomy	388	85.7
≤Segmentectomy	65	14.3
Pathological stage
I	322	71.1
II	60	13.2
III	71	15.7
T factor
T1	218	48.1
T2	194	42.8
T3	39	8.6
T4	2	0.4
N factor
N0	348	76.8
N1	42	9.3
N2	63	13.9
Histology
AC	328	72.4
SQ	107	23.6
Others	18	4.0
MDM2 SNP309
TT	94	20.8
TG	220	48.6
GG	139	30.7
Adjuvant chemotherapy	123	27.2
Chemotherapy (postrecurrence)	69	15.2
Radiation therapy (postrecurrence)	51	11.3

Patients who had undergone preoperative therapies (chemotherapy and/or radiation therapy) and had a history of lung cancer were excluded. AC, adenocarcinoma; SQ, squamous cell carcinoma.

Survival analysis

The median follow‐up time was 56.5 months (range, 1.1–150 months). The 5‐year OS and DFS rates of the total study population were 73.7% (95% confidence interval [CI]: 69.2–78.2) and 66.1% (95% CI: 61.4–20.8), respectively. The percentages of patients treated via chemotherapy and/or radiotherapy after recurrence did not significantly differ (P = 0.156; Pearson χ ² test). Table 2 shows the results of HR adjusted for age, sex, stage, histology, treatment (chemotherapy after tumor recurrence), and smoking status. Although no association was observed between this polymorphism and the population as a whole, the MDM2 T/T genotype was significantly associated worse DFS and OS among AC patients and p‐stage I AC patients.

Table 2.

Hazard ratios for survival data according to MDM2 genotypes. T/G + G/G (Reference: HR = 1.0) vs. T/T

				DFS				OS
Histology	Pathological stage		N	Event	HR	95% CI	P	Event	HR	95% CI	P
All	Stage I‐III	a	453	153	1.15	078–1.69	0.48	118	1.01	0.64–1.58	0981
AC		b	328	99	1.93	1.21–3.07	0.01	73	2.05	1.19–3.51	0.01
SQ		b	107	54	0.71	0.32–1.53	0.38	45	0.50	0.20–1.28	0.15
AC	Stage I	b	246	47	2.11	1.13–3.95	0.02	35	3.00	1.44–6.24	0.003
	Stage II, III	b	82	52	1.78	0.87–3.67	0.12	38	1.33	0.54–3.30	0.54
SQ	Stage I	b	63	24	0.75	0.21–2.67	0.66	18	0.34	0.04–2.67	0.30
	Stage II, III	b	44	30	0.65	0.22–1.92	0.44	27	0.65	0.19–2.17	0.48

P < 0.05 are shown in bold. DFS, disease‐free survival; OS, overall survival; AC, adenocarcinoma; SQ, squamous cell carcinoma.

^aHazard ratio adjusted for age, sex, stage, histology, treatment (chemotherapy after tumor recurrence), and smoking status.

^bHazard ratio adjusted for age, sex, treatment (chemotherapy after tumor recurrence), and smoking status.

Subgroup analysis of stage I AC patients

Among stage I AC patients, a significant association was found between smoking status, pleural invasion, or LVI and c.309T>G (T/T vs. T/G + G/G).(Table 3). Figures 1 and 2. show Kaplan–Meier survival curves of AC p‐stage I patients according to MDM2 genotype for DFS and OS, respectively. The OS of patients with the T/T genotype was shorter than the OSs of patients with the G/G or T/G genotypes (P = 0.021; log‐rank test). The 5‐year OS and DFS rates of the total population were 86.4% (95% CI: 81.7–91.1) and 80.2% (95% CI: 74.5–85.9), respectively. Together with Kaplan–Meier analysis, we compared the T/T genotype with G allele carriers (T/G + G/G) using univariate and multivariate analyses. The results of univariate analysis for OS are summarized in Table 4. The HR for death in the T/T group relative to the T/G + G/G group was 2.20 (95% CI: 1.10–4.36; P = 0.025). Similarly, the clinicopathological factors (gender, age, smoking history, differentiation, LVI, pleural invasion, and EGFR mutation) significantly affected survival. Conversely, the status of the KRAS and p53 mutations and p53codon72 were not significant upon univariate analysis (Table 4). Multivariate analyses for OS revealed that MDM2 T/T genotype was a significant independent risk factor (HR = 2.23; 95% CI: 1.07–4.65; P = 0.033), together with male gender (HR = 5.69; 95% CI: 1.78–18.2; P = 0.003), older age (HR = 2.39; 95% CI: 1.12–5.09; P = 0.002) and LVI (HR = 1.58; 95% CI: 1.01–2.47; P = 0.044) (Table 4).

Table 3.

Patient characteristics of stage I AC patients according to MDM2 genotypes

		MDM2 genotypes						T/T vs. T/G vs. G/G	T/T vs. T/G + G/G
	Total	T/T		T/G		G/G		P a	P a
All cases	246	58	23.6	115	46.7	73	29.7	–	–
Sex
Women	134	27	20.3	65	48.9	41	20.8	0.42	0.23
Men	113	31	27.4	50	44.2	32	28.3
Age in years
<70	135	33	24.4	63	46.7	39	28.9	0.92	0.76
≥70	111	25	23.6	52	46.8	34	30.6
Smoking status
Never smoker	140	24	17.1	73	52.1	43	30.7	0.02	0.01
Smoker	106	34	32.1	42	39.6	30	28.3
p53 Arg72Pro
Arg/Arg	90	20	22.2	42	46.7	28	31.1	0.90	0.93
Arg/Pro	115	28	24.3	56	48.7	31	27.0
Pro/Pro	41	10	24.4	17	41.5	14	34.1
Performance statusb
0	208	49	23.6	101	48.6	58	27.9	0.30	1.00
1–2	21	5	23.8	7	33.3	9	42.9
Surgical procedure
Lobectomy	201	49	24.4	91	45.3	61	30.3	0.61	0.70
Segmentectomy	45	9	20.0	24	53.3	12	26.7
Differentiation
Well	137	30	21.9	69	50.4	38	27.7	0.44	0.55
Moderate or poorly	109	28	25.7	46	42.2	35	32.1
T factor
T1	158	35	21.5	71	44.9	53	33.5	0.19	0.35
T2	88	24	27.3	44	50.0	20	22.7
Pleural invasion
Absent	202	42	20.8	96	47.5	64	31.7	0.07	0.03
Present	44	16	36.4	19	43.2	9	20.5
Lymphovascular invasion
Absent	177	34	19.2	92	52.0	51	28.8	0.01	0.01
Present	69	24	34.8	23	33.3	22	31.9
p53 status
Wild type	207	48	23.2	98	47.3	61	29.5	0.90	0.83
Mutant	39	10	25.6	17	43.6	12	30.8
EGFR statusb
Wild type	133	30	22.6	62	46.6	41	30.8	0.92	0.76
Mutant	111	27	24.3	52	46.8	32	28.8
KRAS status
Wild type	214	54	25.2	99	46.3	61	28.5	0.25	0.13
Mutant	32	4	12.5	16	50.0	12	37.5
Adjuvant chemotherapy
Received	47	14	29.8	27	57.4	6	12.8	0.02	0.26
Not received	199	44	22.1	88	44.2	67	33.7
Chemotherapy
Received	16	3	18.8	9	56.2	4	5.5	0.80	0.55
Not received	11	4	36.4	4	36.4	3	27.31

NA, not available; AC, adenocarcinoma.

^a P values were calculated by chi‐square test. P < 0.05 are shown in bold.

^bPerformance status at surgery and EGFR mutation status remains unknown in some cases.

Figure 1.

Kaplan–Meier estimates of disease‐free survival in patients with stage I lung adenocarcinoma. MDM2 c.309T>G (T/T, blue; T/G + G/G, green). The P value was calculated using the log‐rank test.

Figure 2.

Kaplan–Meier estimates of overall survival in patients with stage I lung adenocarcinoma. MDM2 c.309T>G (T/T, blue; T/G + G/G, green). The P value was calculated using the log‐rank test.

Table 4.

Univariate and multivariate analysis in disease‐free survival and overall survival of stage I AC patients

	DFS						OS
	Univariate analysis			Multivariate analysis			Univariate analysis			Multivariate analysis
Variables	HR	95% CI	P a	HR	95% CI	P a	HR	95% CI	P a	HR	95% CI	P a
Sex
Women	1.0			1.0			1.0			1.0
Men	3.32	1.77–6.21	<0.0001	2.11	0.90–4.98	0.087	7.39	3.05–17.9	<0.0001	5.69	1.78–18.2	0.003
Age
<70	1.0			1.0			1.0			1.0
≥70	2.75	1.50–5.03	0.001	1.95	1.04–3.66	0.039	3.07	1.50–6.27	0.002	2.39	1.12–5.09	0.024
Smoking history
Never smoker	1.0			1.0			1.0			1.0
Smoker	3.4	1.84–6.29	<0.0001	0.919	0.60–1.42	0.22	4.73	2.21–10.1	<0.0001	1.14	0.69–1.91	0.089
p53 Arg72Pro
Arg/Arg + Arg/Pro	1.0						1.0
Pro/Pro	0.82	0.37–1.83	0.62				0.80	0.31–2.07	0.65
MDM2 c.309T>G
T/G + G/G	1.0			1.0			1.0			1.0
T/T	1.71	0.92–3.15	0.09	1.45	0.76–2.76	0.254	2.20	1.10–4.36	0.025	2.23	1.07–4.65	0.033
Performance status
0	1.0						1.0
1,2	0.94	0.29–3.05	0.92				1.34	0.41–4.43	0.63
Differentiation
Well	1.0			1.0			1.0			1.0
Moderate and poorly	3.94	2.08–7.48	<0.0001	0.79	0.54–1.16	0.22	4.76	2.16–10.5	<0.0001	0.79	0.49–3.31	0.34
T factor
T1	1.0						1.0			1.0
T2	2.93	1.64–5.23	<0.0001	1.76	0.84–3.72	0.14	2.62	1.34–5.11	0.005	1.27	0.49–3.31	0.62
Lymphovascular invasion
Negative	1.0						1.0			1.0
Positive	4.36	2.43–7.82	<0.0001	1.48	1.04–2.10	0.03	6.10	3.00–12.4	<0.0001	2.50	1.03–6.11	0.044
Pleural invasion
Negative	1.0			1.0			1.0			1.0
Positive	2.49	1.35–4.60	0.004	1.19	0.542–2.61	0.66	3.00	1.51–5.96	0.002	1.13	0.44–2.90	0.80
EGFR gene mutation
Mutant	1.0						1.0			1.0
Wild type	2.02	1.08–3.78	0.027				2.94	1.34–6.48	0.007	1.46	0.60–3.56	0.41
KRAS gene mutation
Wild type	1.0						1.0
Mutant	1.13	0.51–2.53	0.76				1.31	0.54–3.16	0.55
p53 gene mutation
Wild type	1.0						1.0
Mutant	1.43	0.69–2.97	0.33				1.75	0.79–3.84	0.17
Adjuvant chemotherapy
Not received	1.0						1.0
Received	1.56	0.79–3.07	0.2				1.25	0.54–2.89	0.6

HR and 95% CI are shown as the values of the latter compared to the former (HR = 1.0). P < 0.05 are shown in bold. DFS, disease‐free survival; OS, overall survival; HR, hazard ratio; CI, confidence interval.

^a P values were calculated by Cox regression analysis.

Stratified analyses of the prognostic effects of the MDM2 genotypes

We further evaluated the associations between the prognostic effects of c.309T>G of the MDM2 gene and p53 status using stratified analyses (Fig. 3). Stronger relationships were observed among p53 wild‐type group (HR = 3.69) and p53 Arg72Pro Arg/Arg + Arg/Pro group (HR = 2.99). Further stratified analyses of patients with a p53 wild‐type tumor and Arg/Arg + Arg/Pro genotype of p53 Arg72Pro showed a higher (HR = 4.39), but these results are underpowered due to small sample size.

Figure 3.

Subset analysis of overall survival in stage I lung adenocarcinoma. The forest plot shows the multivariate Cox regression for each subgroup. P values correspond to hazard ratios adjusted by multivariate regression. The P values <0.05 are shown in bold.

Discussion

Because disruption of p53 tumor suppressor function is important in cancer development, we hypothesized that the 309G allele of the MDM2 gene would be associated with worse survival outcomes among surgically treated lung cancer patients. Unexpectedly, our study demonstrated that the T/T genotype of c.309T>G was a significant independent unfavorable prognostic factor, and the associated tumors tended to show pleural invasion or LVI among stage I lung AC patients.

So far, seven studies have analyzed the association between c.309T>G of the MDM2 gene and lung cancer prognosis, but the results were contradictory (Table 5). Our present results are consistent with the two reports from Taiwan and China 17, 20. Heist et al. 15. investigated the impact of MDM2 gene polymorphism in early‐stage (stage I or II) NSCLC patients in the United States and reported that the G/G genotype was associated with worse OS. These findings might seem contrary to our results. However, when analyzed in detail, Heist's subgroup analyses (Table 5) and ours had similar results. First, Heist showed that the G/G genotype was associated with worse OS only in patients with stage IB/II NSCLC and squamous cell carcinoma (SQ) histology 15. Similarly, we showed that the T/T genotype was associated with better OS in patients with SQ histology (although it did not reach statistical significance). Next, Heist showed that, the G/G genotype was associated with better OS in patients with stage IA NSCLC or those with AC histology (although not significant) 15. This is consistent with our results (Table 2), since we showed that the T/T genotype was associated with worse OS in patients with stage I NSCLC or those with AC histology. We believe that the difference in statistical power between the two studies may be due to the difference of study population. Recently, SNP285 has been reported to act as an antagonist to SNP309 only observed in Caucasians 10, furthermore, Ryan et al. 12. showed that neither SNP309 nor SNP285 were associated with lung survival. Therefore, this point is still a matter of debate. SNP285 per se could not explain the discrepancies between Heist's study and ours. Han et al.^[ 16 and Liu et al. 19. investigated stage III or IV NSCLC patients and reported disparate findings. Survival outcome of advanced lung cancer depends strongly on tumor size, lymph node metastasis, or therapeutic regimen. Therefore, known genetic factors might have less influence on cancer prognoses if study subjects have only advanced‐stage NSCLC. Our results support the previous study from Asia (Taiwan) focusing on stage I NSCLC17 and which reported a tendency for the T/T group to be a poor prognostic factor compared to the G/G group (P = 0.05).

Table 5.

Comparison of previous reports concerning c.309T>G and lung cancer prognosis

Author	Year	Country	Ethnic group	Smoker (%)	Stage	Histology	Subgroup	N	MDM2 c.309T>G SNP309	HR	95% CI	P	Correlation	Ref.
Heist	2007	States	Caucasian	93%	Stage I, II	NSCLC		383	T//T vs. G/G	1.57	1.03–2.40	0.04	G/G risk	15
							AC	186	T/T vs. G/G	0.93	0.48–1.80	0.82	NS
							SQ	110	T/T vs. G/G	3.77	1.88–7.57	0.0002	G/G risk
							Stage IA	200	T/T vs. G/G	0.65	0.33–1.27	0.2	NS
							Stage IB or II	183	T/T vs. G/G	3.19	1.80–5.65	<0.0001	G/G risk
							Noncurrent smoker	233	T/T vs. G/G	1.17	0.66–2.08	0.58	NS
							Current smoker	150	T/T vs. G/G	2.93	1.52–5.67	0.001	G/G risk
Han	2008	Korea	Asian	75%	Stage IIIB or IV	NSCLC		148	T/T vs. T/G + G/G	1.74	1.05–2.89	0.032	T/G + G/G risk	16
Chua	2010	Singapore	Asian	0%		Lung cancer		123	T/T vs. T/G vs. G/G	NA		0.27(log‐rank)	N.S.	18
Chien	2010	Taiwan	Asian	51%	Stage I‐III	NSCLC		198	T/T vs. G/G	0.62	0.41–0.95	0.003	T/T risk	17
							Stage I	127	T/T vs. G/G	0.47	0.22–1.01	0.05	NS
							Stage I with wild‐type p53	99	T/T vs. G/G	0.34	0.15–0.80	0.01	T/T risk
							Stage I with p53 mutation	28	T/T vs. G/G	5.02	0.31–28.20	0.35	NS
							Stage II, III	179	T/T vs. G/G	0.82	0.48–1.39	0.45	NS
Liu	2011	China	Asian	59%	Stage III or IV	NSCLC		199	T/T vs. G/G	1.05	0.66–1.67	0.91(log‐rank)	NS	19
Dong	2011	China	Asian	72%	Stage I‐IV	NSCLC		561	G/G vs. T/T + T/G	1.37	1.06–1.78	0.017	T/T + T/G risk	20
Ryan	2012	States	Caucasian and African‐American	92%	Stage I‐IV	NSCLC		197	T/T vs. G/G	0.8	0.51–1.24	0.31	NS	12
This study	2015	Japan	Asian	45%	Stage I	AC		179	T/G + G/G vs. T/T	2.23	1.07–4.65	0.033	T/T risk

HR, hazard ratio; CI, confidence interval; Ref., Reference; NSCLC, non‐small‐cell lung cancer; NS, not significant; NA, not available; AC, adenocarcinoma; SQ, squamous cell carcinoma.

The T/T genotype was associated with poor survival in patients with aggressive bladder cancer 27, in line with our observations. The cited authors concluded that p53 mutational status was of prognostic value, but, in this study, the p53 mutation levels did not differ significantly by MDM2 genotype (Table 3). Any prognostic utility of the SNP309 marker in gastric cancer, renal cell carcinoma, and breast cancer, remains controversial 28, 29, 30. Furthermore, of early‐stage cancers, only lung cancer has been analyzed 15, 17.

Regarding the p53 Arg72Pro, it has been reported that the Arg/Arg variant encodes a highly proapoptotic protein, whereas the Pro/Pro variant has the opposite effect 31. We analyzed the associations between p53 status (p53 mutation and p53 Arg72Pro) and c.309T>G of the MDM2 gene, and consequently found that the T/T genotype was associated with worse OS among p53 wild‐type group (HR = 3.69) and the p53 Arg72Pro31 Arg/Arg + Arg/Pro group (HR = 2.99) (Fig. 3), although these results are underpowered due to small sample size. Our findings are consistent with those of Chien et al. about p53 mutation status 17. p53 function is considered normal (not inactivated) in patients with the T/T genotype, Arg/Arg + Arg/Pro, or p53 wild‐type group compared to the 309G allele carrier, Pro/Pro, or p53 mutant group. Furthermore, among patients in the abovementioned groups, the T/T genotype was associated with worse OS (HR = 4.39). These results suggest a positive interaction between the T/T genotype, p53Arg72Pro RR + RP, and p53 wild type in increasing the risk of death.

The tumorigenic functions of MDM2 in both p53‐dependent and ‐independent pathways are complicated, and analysis of one polymorphic variant may not address all the MDM2 functions. The precise mechanism underlying the worse OS with the T/T genotype being associated with p53 status remains unknown 32. However, tumors of MDM2 T/T patients tended to be positive in LVI and pleural invasion (Table 3), which have been reported to be worse prognostic factors associated with tumor proliferation and aggressiveness 33, 34. These results indicate that the tumors of T/T patients in the stage I period might have overall malignant potential, although p53 tumor suppressor function is normal. Based on our results, tumors that develop under normal p53 might have a malignant potential rather than tumors that develop under abnormal p53, and genotyping of c.309T>G might simply be a selection tool for malignant potential for stage I lung AC.

Throughout this study, we found that c.309T>G was a predictive factor of postoperative survival among p‐stage I lung AC patients in a Japanese population. Analysis of MDM2 polymorphism has several advantages over somatic cell mutations analysis. First, the MDM2 309T>G polymorphism can be used to predict which individuals are at an increased risk of death after surgery. Second, the assessment of an individual's polymorphism status does not require an extraction of tumor‐specific DNA. In this study, the EGFR, KRAS, and p53 mutations were not independently associated with prognosis as previously reported 35. Although our findings need to be validated in prospective studies, c.309T>G would be a useful prognostic marker that is detectable at any stage of diagnosis or treatment and influences the therapeutic strategies. Furthermore, we had already established the Duplex SmartAmp method22 to detect c.309T>G with a single drop (5 μL) of blood within 40 min from sample collection. If we can make this method more practical, we will detect this SNP more easily and quickly in any clinical situation.

This study possesses several limitations. First, we could gather data on OS but not on cancer‐specific survival because the sources of survival data did not indicate the cause of death, although it would be useful to know the cause of death especially for early‐stage cancer patients. Another limitation of our study is its retrospective nature, although blood sample collection was performed preoperatively, and the database was run prospectively. Therefore, patient populations might be biased. Finally, the sample size and number of events in this study might be too small to draw meaningful conclusions associated with p53 status. Further prospective studies with a larger, more homogeneous study population would be desirable to abrogate these limitations.

In conclusion, to the best of our knowledge, this is the first study to analyze the effects of c.309T>G in the MDM2 gene together with p53 Arg72Pro as well as mutations in the EGFR. KRAS and p53 genes on the prognoses of lung cancer patients. We conclude that the T/T genotype of c.309T>G affects OS in surgically resected stage I lung AC patients and represents an independent prognostic factor in a Japanese population. Further studies are warranted to clarify the biological importance of these findings and the usefulness of the MDM2 309T>G polymorphism as a predictive marker for therapy selection and outcome prediction in NSCLC.

Conflicts of Interest

None declared.

Cancer Medicine 2016; 5(8):1791–1801