Abstract
Objective
To investigate the expression pattern of a novel long non-coding ribonucleic acid activated by transforming growth factor β, long non-coding ribonucleic acid activated by transforming growth factor β, in renal cell carcinoma tissues among the patients with various clinicopathologic features and to detect the possible role of dysregulated long non-coding RNA-ATB in renal cell carcinoma.
Methods
The expression of long non-coding ribonucleic acid activated by transforming growth factor β in the renal cell carcinoma tissues and renal cancer cell lines was evaluated by quantitative real-time polymerase chain reaction. The association with clinicopathologic features was analyzed. The effects of long non-coding ribonucleic acid activated by transforming growth factor β on the renal cell carcinoma cell proliferation, apoptosis, migration, invasion and epithelial-to-mesenchymal transition were investigated by the loss-of-function approach.
Results
The expression of long non-coding ribonucleic acid activated by transforming growth factor β was higher in the renal cell carcinoma tissues and renal cancer cells than in the adjacent non-tumor tissues and normal human proximal tubule epithelial cells HK-2. In addition, the long non-coding ribonucleic acid activated by transforming growth factor β expression was significantly higher in the renal cell carcinoma patients with metastasis. The elevated expression of long non-coding ribonucleic acid activated by transforming growth factor β was associated with tumor stages, histological grade, vascular invasion, lymph node metastasis and distant metastasis. Notably, we found that long non-coding ribonucleic acid activated by transforming growth factor β knockdown could (i) inhibit cell proliferation; (ii) trigger apoptosis; (iii) reduce epithelial-to-mesenchymal transition program; (iv) suppress cell migration and invasion.
Conclusions
Our data have shown that long non-coding ribonucleic acid activated by transforming growth factor β actively functions as a regulator of epithelial-to-mesenchymal transition during renal cell carcinoma metastasis, which suggests that long non-coding ribonucleic acid activated by transforming growth factor β may be a potential prognostic biomarker and therapeutic target for renal cell carcinoma.
Keywords: long non-coding RNAs, lncRNA-ATB, renal cell carcinoma, prognosis, EMT
Introduction
Renal cell carcinoma (RCC) is one of the most lethal urologic cancers (1). Because of the lack of the early detection and prognostic markers in renal cancer, ∼20–30% of patients have found a distant metastasis at the time of diagnosis. Despite great improvement in the diagnosis and therapeutic treatment of RCC, the prognosis of patients with distant metastases remains unfavorable (2). The survival rate stays <10% in patients with distant metastases (3). Therefore, it is critical to identify effective biomarkers which not only predict the progression and prognosis of renal cancer but also help to develop the new targeted therapies for renal cancer.
Long non-coding RNAs (lncRNAs) are a class of RNA molecules arbitrarily defined as the non-coding RNAs longer than 200 nucleotides in length (4,5). A large number of studies have shown that the disorders of lncRNA are closely related to human diseases, including various kinds of cancer (6,7). For example, the HOTAIR which is known to regulate the expression of HOX gene clusters, is significantly up-regulated in non-small-cell lung cancer tissues, and regulate non-small cell lung cancer cell invasion and metastasis (8). The MALAT-1, which is highly expressed in prostate cancer, was found to be correlated with Gleason score, prostate specific antigen and tumor stage. The down-regulation of MALAT-1 leads to the inhibition of the prostate cancer cell growth, invasion and migration (9). Moreover, lncRNAs involved in RCC have also been identified (10,11).
Recently, Yuan et al. (12) revealed a novel lncRNA activated by TGF-β, induces EMT, promotes tumor cell invasion and plays a key role in distant metastasis of hepatocellular carcinoma. Iguchi et al. (13) showed that lncRNA-ATB may be involved in the progression of colorectal cancer and be a novel indicator of poor prognosis in patients with colorectal cancer. Saito et al. (14) demonstrated lncRNA-ATB plays an important role in EMT in promoting the invasion and metastasis through the TGF-b/miR-200s/ZEB axis, resulting in a poor prognosis in gastric cancer. However, the lncRNA-ATB expression in RCC and the underlying mechanism has not been reported yet.
In the present study, we aimed to detect the expression of lncRNA-ATB in RCC and to further explore the clinical relevance and biological functions of lncRNA-ATB in RCC.
Patients and methods
Patients
The tumor and matched adjacent non-tumor tissue were obtained with informed consent from the 74 RCC patients who underwent radical nephrectomy or nephron-sparing surgery in The First Affiliated Hospital of Chongqing Medical University (Chongqing, China). None of the patients had received chemotherapy or radiotherapy before the surgery. All samples were stored immediately in liquid nitrogen until use. All cases used in this study were reviewed by an experienced uropathologist. All of the tumor tissues were defined as the clear cell type renal carcinomas by applying the TNM classification (7th edition from 2009) and the nuclear grade was evaluated by Fuhrman criteria. This study was approved by medical ethics society of Chongqing Medical University.
Cell culture
Human renal cancer cell lines 786-O, A498, ACHN and immortalized normal human proximal tubule epithelial cell lines HK-2 were purchased from Cell Bank of Type Culture Collection of Chinese Academy of Sciences (CCCAS, China). The cell lines were cultured in RPMI 1640 medium, supplemented with 10% fetal bovine serum and antibiotics, and incubated in an atmosphere with 5% carbon dioxide at 37°C. The medium was replaced every 2 days.
RNA extraction
TRIzol reagent (Invitrogen, Carlsbad, CA, USA) was used to extract the total RNAs from 786-O, A498, ACHN and HK-2, as well as the 74 clinical samples. The concentration and purity of RNAs were determined by OD260/280 readings using spectrophotometer (NanoDrop ND-2000). RNA integrity was determined by capillary electrophoresis using the RNA 6000 Nano Lab-on-a-Chip kit and the Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). Only RNA extracts with RNA integrity number values >6 were used in further analysis.
Real-time qPCR
Total RNAs were then reversely transcribed using a PrimeScript™ RT reagent Kits with gDNA Eraser (TaKaRa, Dalian, China). The expressions of lncRNA-ATB were measured by quantitative PCR (qPCR) using SYBR Green assays (TaKaRa). lncRNA-ATB primer sequences were as follows: sense, 5′-TCTGGCTGAGGCTGGTTGAC-3′ and antisense, 5′-ATCTCTGGGTGCTGGTGAAGG-3′. 18S rRNA served as the internal housekeeping gene to normalize RNA concentrations between samples: sense 5′-ACACGGACAGGATTGACAGA-3′ and antisense 5′-GACATCTAAGGGCATCACA-3′. The relative expression was calculated using 2−ΔΔCt methods. Each experiment was performed in triplicate.
Western blot and antibodies
The total cellular proteins were lysed in RIPA buffer (Cell Signaling Technology) supplemented with protease inhibitors. The protein concentrations were determined using BCA Protein Assay Kit (Pierce). Equal amounts (30–40 μg) of proteins were separated by 10% SDS-PAGE and transferred to a PVDF Immobilon-P membrane (Millipore). The membrane was blocked with 5% non-fat milk in TBST and then probed with indicated primary antibodies at 4°C overnight with gentle shaking. The membranes were washed with TBST (3 × 5 min) and then incubated in secondary antibodies for 1 h at room temperature. Intensity of the bands was quantified by densitometry (Quantity One software; Bio-Rad), with β-actin used as a control. Antibodies against Vimentin, N-Cadherin and E-Cadherin were purchased from Cell Signaling Technology (MA, USA).
RNA interference experiments
Small interfering RNA that targeted lncRNA-ATB RNA and a scrambled negative control (si-NC) were synthesized by Genepharma Co., Ltd. (Shanghai, China). Human renal cancer cells 796-O and A498 were transfected with either 75 nM si-lncRNA-ATB or si-NC controls using Lipofectamine 2000 reagents (Life Technologies) according to the manufacture's instruction. After 48 h, the cells transfected with siRNA were harvested for qRT-PCR to determine the transfection efficiency. The following sequences were targeted for lncRNA-ATB. siRNA1: forward TATGGCCTAGATTACCTTTCCATT, reverse TGGAAAGGTAATCTAGGCCATATT; siRNA2: forward GTCTGTATTTGCGAATACCTTT, reverse AAAGGTATTCGCAAATACAGAC.
Cell proliferation assay
About 2000 cells per well were seeded into 96-well plates after the lncRNA-ATB siRNAs and negative control (NC) transfection. At the indicated times (0, 24, 48, 72 and 96 h after culture), 10 μl of cell counting kit-8 (CCK-8, Dojindo, Japan) solution was added to each well and incubated for another 80 min at 37°C, and then the absorbance at 490 nm was measured to calculate cell growth rates. The experiments were performed in triplicate.
Cell apoptosis assay
Renal cancer cells were seeded into 6-well plates (1 × 106 cells per well) in antibiotic-free medium, after being transfected with si-lncRNA-ATB or si-NC for 48 h. The cells were collected and washed twice and stained with FITC-Annexin V and PI using the FITC-Annexin V Apoptosis Detection Kit (BD Biosciences) according to the manufacturer's manual. The apoptotic cells were analyzed by FACS Caliber (BD Bioscience). The experiments were performed in triplicate.
Wound-healing assay
The migration of the RCC cells was analyzed using the wound-healing assay in vitro. Forty-eight hours after the RNA interference, the cells were seeded into 6-well plates and allowed to grow to 90–95% confluence. Subsequently, the wounds were made by scraping with a 200 μl plastic tip. At 0 and 48 h after the wounding, images were taken every 24 h to monitor the wound healing process with an inverted research microscope eclipse TS100/100-F (Nikon, Japan).
Transwell invasion assay
Invasion of 786-O and A498 cells were evaluated by Matrigel invasion assays. At 48 h after the RNA interference, the RCC cells were collected and resuspended in serum-free medium at a concentration of 5 × 104 cells/ml, respectively. Of note, 200 μl cell suspensions were then added into the upper chamber whereas the bottom chamber was filled with 500 μl culture medium containing 10% FBS. After the incubation for 48 h at 37°C and 5% CO2, the non-invaded cells on the upper membrane surface were removed with a cotton tip whereas the cells that passed through the filter were fixed in 4% paraformaldehyde and stained with 0.5% crystal violet. The numbers of invaded cells were counted in five randomly selected high power fields under a microscope (Olympus).
Statistical analysis
All statistical analyses were performed using SPSS software from IBM (version 19.0). Each experiment was performed in triplicate. Statistical analysis was performed by Student's t-test. The χ2 test was used to compare the associations between lncRNA-ATB overexpression and clinicopathologic variables of the RCC samples. Data were presented as mean ± standard deviation. The statistical significance was defined as a P value <0.05.
Results
Over expression of lncRNA-ATB in the RCC tissues and RCC cell lines
The lncRNA-ATB expression was significantly increased in the RCC tumor tissues when compared with that in the adjacent normal kidney tissues (*P < 0.05; Fig. 1A). In addition, the lncRNA-ATB expression was higher in the metastatic RCC patients (*P < 0.05, Fig. 1B). The expression was also examined by qPCR in vitro experiment. The result showed that the lncRNA-ATB expression was greater in the renal cancer cell lines than in HK-2 (*P < 0.05, Fig. 1C).
Figure 1.
(A) Relative expression of long non-coding RNA (lncRNA)-ATB in renal cell carcinoma (RCC) tissues and adjacent tissues. (B) lncRNA-ATB expression between localized and metastatic RCC patients. (C) The relative expression of lncRNA-ATB mRNA in renal cancer and normal cell line.
Correlation between the lncRNA-ATB expression and clinicopathologic features in the patients with RCC
The patients with RCC were classified into two groups based on the median lncRNA-ATB expression. As shown in Table 1, the higher expression of lncRNA-ATB in the RCC patients had greater positive correlation with tumor stages, histological grade, vascular invasion, lymph node metastasis and distant metastasis than those in the lower expression group (*P < 0.05). However, no obvious correlation was found between the expression of lncRNA-ATB and patient's age and gender (P > 0.05). In summary, these observations suggested that the overexpression of lncRNA-ATB in the RCC patients was associated with the progression and development of RCC.
Table 1.
Correlation between lncRNA-ATB levels and the 74 RCC patients’ clinicapathological parameters
| Clinicopathological parameters | Case no. | lncRNA-ATB expression |
P | |
|---|---|---|---|---|
| High no. (%) | Low no. (%) | |||
| Age (years) | 0.363 | |||
| ≤60 | 33 | 15 (45.5%) | 18 (54.5%) | |
| >60 | 41 | 23 (56.1%) | 18 (43.9%) | |
| Gender | 0.450 | |||
| Male | 44 | 21 (47.7%) | 23 (52.2%) | |
| Female | 30 | 17 (56.7%) | 13 (43.3%) | |
| Histological grade | 0.011 | |||
| Well | 49 | 20 (40.8%) | 29 (59.2%) | |
| Moderate and poor | 25 | 18 (72.0%) | 7 (28.0%) | |
| Tumor stage | 0.030 | |||
| I and II | 44 | 18 (40.9%) | 26 (59.1%) | |
| III and IV | 30 | 20 (66.7%) | 10 (33.3%) | |
| Lymph node metastasis | 0.013 | |||
| Positive | 15 | 12 (80.0%) | 3 (20.0%) | |
| Negative | 59 | 26 (44.1%) | 33 (55.9%) | |
| Distant metastasis | 0.015 | |||
| Positive | 12 | 10 (83.3%) | 2 (16.7%) | |
| Negative | 62 | 28 (45.2%) | 34 (54.8%) | |
lncRNA-ATB suppression by siRNA
The mRNA expression of lncRNA-ATB suppressed significantly after the cancer cells were transfected with si-lncRNA-ATB-1. Therefore, si-lncRNA-ATB-1 was used for the gene silencing in further experiments. Non-specific siRNA was used as a negative control (*P < 0.05, Fig. 2A).
Figure 2.
(A) Relative expression of lncRNA-ATB in 786-O and A498 cells after transfecting with siRNAs compared with si-NC control group. Silencing of lncRNA-ATB reduced A498 (B) and 786-O (C) cells proliferation.
Knockdown of lncRNA-ATB inhibited cellular proliferation
Our data demonstrated that the cellular proliferation was evidently downregulated in renal cancer 786-O and A498 cells after the transfection of si-lncRNA-ATB-1 when compared with the si-NC group (*P < 0.05, Fig. 2B and C).
Knockdown of lncRNA-ATB promoted the cellular apoptosis
An increase in apoptosis compared with the si-NC control group was observed 48 h after transfection of the RCC cells with si-lncRNA-ATB-1 (*P < 0.05, Fig. 3), which indicates that lncRNA-ATB also plays an important role in renal cancer cell apoptosis.
Figure 3.
Compared with negative control group, significant increase in cell apoptosis was inducted by si-lncRNA-ATB-1 in 786-O and A498 cells.
Knockdown of lncRNA-ATB suppressed cellular migration and invasion
It was observed via wound healing assay that the renal cancer cells transfected with si-lncRNA-ATB-1 displayed lower migration ability than the si-NC group (*P < 0.05, Fig. 4A and B). It was demonstrated by transwell invasion assay that the invasion capacity of 786-O and A498 cells was significantly suppressed when lncRNA-ATB was silenced by siRNA (*P < 0.05, Fig. 4C and D)
Figure 4.
The migration (A and B) and invasion (C and D) capacity of 786-O and A498 cells was decreased by silncRNA-ATB-1.
lncRNA-ATB depletion represses EMT program of the RCC cell lines
To explore the molecular mechanism through which lncRNA-ATB contributes to the metastasis of RCC, the effect of lncRNA-ATB knockdown on EMT was analyzed. As shown in Fig. 5, the depletion of lncRNA-ATB led to the upregulation of epithelial cell-related protein E-cadherin and the downregulation of mesenchymal markers N-cadherin, Vimentin, which indicates that lncRNA-ATB may induce EMT in the RCC cells.
Figure 5.
Western blot analyzed the expression of EMT related protein factors with lncRNA-ATB knockdown in A498 and 786-O cells.
Discussion
Although great achievements have been made in the diagnostic and therapeutic approaches in recent years, the prognosis of the RCC patients with distant metastases remains unfavorable. Therefore, it is urgent to make clear the metastasis, progress mechanism of RCC and establish novel early diagnosis, prognosis and therapeutic biological moleculars of the RCC patients with distant metastases.
It is now recognized that only 2% of the human genome encodes for protein-coding RNAs and the overwhelming majority of the transcriptional outputs of the mammalian genome were confirmed to be protein non-coding genes (15). Those abundant transcriptomes were regarded as the ‘transcriptional noise’. However, over the past decade, many studies have reported that those non-coding RNAs have comprehensive function in biological processes through several mechanisms (16). lncRNAs as a newly discovered class of non-coding genes, are defined as non-coding RNAs longer than 200 nucleotides in length (17). In recent years, lncRNA has become a new candidate in diagnosing cancer disease, explaining the pathogenesis and development mechanism of malignant tumors, and in predicting the prognosis and the treatment of the disease as the biological markers. Recently, it has been reported that lncRNA-ATB, a novel lncRNA activated by TGF-β, promotes the invasion of hepatoma cells through induction of EMT (12–14). However, the role of lncRNA-ATB in RCC remains unknown. In this study, we seek to further elucidate the functional role of lncRNA-ATB in RCC.
In the current study, it was discovered that the expression of lncRNA-ATB was statistically higher in the RCCs tissues and renal cancer cell lines than in the tumor-adjacent benign kidney tissues and normal human proximal tubule epithelial cell line HK-2. Moreover, the expression of lncRNA-ATB was significantly higher in patients with metastases. Elevated expression of lncRNA-ATB was associated with tumor stage, histological grade, lymph node metastasis, vascular invasion and distant metastasis.
To further explore the function of lncRNA-ATB in RCC cell process, in vitro experiments were completed where the siRNA-mediated knockdown of lncRNA-ATB was shown to significantly suppress the proliferation and invasion as well as the migration capability of renal cancer cell lines.
EMT was originally recognized as a critical step in metazoan embryogenesis and in defining the organ structures during the organ development (18). During the last decade, emerging evidence has shown that cancer progression is tightly involved with EMT, which enables the cancer cells to acquire mesenchymal phenotype and metastasize toward distant sites (19). Remarkably, we observed that after the lncRNA-ATB knockdown, some hallmarks of the mesenchymal cells such as N-cadherin and Vimentin were reduced, whereas the epithelial protein E-cadherin was increased. In summary, it is proposed that lncRNA-ATB promotes the RCC migration and invasion partly via the induction of EMT. However, further investigations are needed to clarify the exact regulatory mechanism underlying this process.
In conclusion, we have described, for the first time, the clinicopathologic features as well as the critical function of lncRNA-ATB in RCC cell migration, invasion and EMT. Our findings suggest that lncRNA-ATB may serve as a novel therapeutic target for the advanced RCC treatment. In the future studies, the correlation between lncRNA-ATB and the 5-year survival rate of the RCC patients’ needs to be established with more samples and longer follow-up time.
Funding
This work was supported by the Chongqing Science and Technology Program Foundation (No. 2013yykfA110004).
Conflict of interest statement
None declared.
Acknowledgements
The authors would like to thank Ying Liu, Department of Preventive Medicine, Hubei University of Medicine, for her statistical analysis.
References
- 1.Rini BI, Rathmell WK, Godley P. Renal cell carcinoma. Curr Opin Oncol 2008;20:300–6. [DOI] [PubMed] [Google Scholar]
- 2.Pantuck AJ, Zisman A, Belldegrun AS. The changing natural history of renal cell carcinoma. J Urol 2001;166:1611–23. [PubMed] [Google Scholar]
- 3.Motzer RJ, Russo P. Systemic therapy for renal cell carcinoma. J Urol 2000;163:408–17. [PubMed] [Google Scholar]
- 4.Guttman M, Rinn JL. Modular regulatory principles of large non-coding RNAs. Nature 2012;482:339–46. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Gutschner T, Diederichs S. The hallmarks of cancer: a long non-coding RNA point of view. RNA Biol 2012;9:703–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Zhang X, Gejman R, Mahta A et al. Maternally expressed gene 3, an imprinted noncoding RNA gene, is associated with meningioma pathogenesis and progression. Cancer Res 2010;70:2350–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Takahashi Y, Sawada G, Kurashige J et al. Amplification of PVT-1 is involved in poor prognosis via apoptosis inhibition in colorectal cancers. Br J Cancer 2014;110:164–71. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Liu XH, Liu ZL, Sun M et al. The long non-coding RNA HOTAIR indicates a poor prognosis and promotes metastasis in non-small cell lung cancer. BMC Cancer 2013;13:464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Ren S, Liu Y, Xu W et al. Long noncoding RNA MALAT-1 is a new potential therapeutic target for castration resistant prostate cancer. J Urol 2013;190:2278–87. [DOI] [PubMed] [Google Scholar]
- 10.Zhou S, Wang J, Zhang Z. An emerging understanding of long noncoding RNAs in kidney cancer. J Cancer Res Clin Oncol 2014;140:1989–95. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Martens-Uzunova ES, Bottcher R, Croce CM, Jenster G, Visakorpi T, Calin GA. Long noncoding RNA in prostate, bladder, and kidney cancer. Eur Urol 2014;65:1140–51. [DOI] [PubMed] [Google Scholar]
- 12.Yuan JH, Yang F, Wang F et al. A long noncoding RNA activated by TGF-beta promotes the invasion-metastasis cascade in hepatocellular carcinoma. Cancer Cell 2014;25:666–81. [DOI] [PubMed] [Google Scholar]
- 13.Iguchi T, Uchi R, Nambara S et al. A Long Noncoding RNA, lncRNA-ATB, is involved in the progression and prognosis of colorectal cancer. Anticancer Res 2015;35:1385–8. [PubMed] [Google Scholar]
- 14.Saito T, Kurashige J, Nambara S et al. A Long non-coding RNA activated by transforming growth factor-beta is an independent prognostic marker of gastric cancer. Ann Surg Oncol 2015;3:915–22. [DOI] [PubMed] [Google Scholar]
- 15.Esteller M. Non-coding RNAs in human disease. Nat Rev Genet 2011;12:861–74. [DOI] [PubMed] [Google Scholar]
- 16.Wang KC, Chang HY. Molecular mechanisms of long noncoding RNAs. Mol Cell 2011;43:904–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Batista PJ, Chang HY. Long noncoding RNAs: cellular address codes in development and disease. Cell 2013;152:1298–307. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Greenburg G, Hay ED. Epithelia suspended in collagen gels can lose polarity and express characteristics of migrating mesenchymal cells. J Cell Biol 1982;95:333–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Acloque H, Thiery JP, Nieto MA. The physiology and pathology of the EMT. Meeting on the epithelial–mesenchymal transition. EMBO Rep 2008;9:322–6. [DOI] [PMC free article] [PubMed] [Google Scholar]