Skip to main content
The Journal of Physiology logoLink to The Journal of Physiology
. 2016 Jan 18;594(11):2971–2983. doi: 10.1113/JP271752

Angiopoietin‐like 4 promotes angiogenesis in the tendon and is increased in cyclically loaded tendon fibroblasts

Rouhollah Mousavizadeh 1,2, Alex Scott 2, Alex Lu 2, Gholamreza S Ardekani 1, Hayedeh Behzad 2, Kirsten Lundgreen 4, Mazyar Ghaffari 1, Robert G McCormack 3, Vincent Duronio 1,✉
PMCID: PMC4887665  PMID: 26670924

Abstract

Key points

  • Angiopoietin‐like 4 (ANGPTL4) modulates tendon neovascularization.

  • Cyclic loading stimulates the activity of transforming growth factor‐β and hypoxia‐inducible factor 1α and thereby increases the expression and release of ANGPTL4 from human tendon cells.

  • Targeting ANGPTL4 and its regulatory pathways is a potential avenue for regulating tendon vascularization to improve tendon healing or adaptation.

Abstract

The mechanisms that regulate angiogenic activity in injured or mechanically loaded tendons are poorly understood. The present study examined the potential role of angiopoietin‐like 4 (ANGPTL4) in the angiogenic response of tendons subjected to repetitive mechanical loading or injury. Cyclic stretching of human tendon fibroblasts stimulated the expression and release of ANGPTL4 protein via transforming growth factor‐β (TGF‐β) and hypoxia‐inducible factor 1α (HIF‐1α) signalling, and the released ANGPTL4 was pro‐angiogenic. Angiogenic activity was increased following ANGPTL4 injection into mouse patellar tendons, whereas the patellar tendons of ANGPTL4 knockout mice displayed reduced angiogenesis following injury. In human rotator cuff tendons, the expression of ANGPTL4 was correlated with the density of tendon endothelial cells. To our knowledge, this is the first study characterizing a role of ANGPTL4 in the tendon. ANGPTL4 may assist in the regulation of vascularity in the injured or mechanically loaded tendon. TGF‐β and HIF‐1α comprise two signalling pathways that modulate the expression of ANGPTL4 by mechanically stimulated tendon fibroblasts and, in the future, these could be manipulated to influence tendon healing or adaptation.

Key points

  • Angiopoietin‐like 4 (ANGPTL4) modulates tendon neovascularization.

  • Cyclic loading stimulates the activity of transforming growth factor‐β and hypoxia‐inducible factor 1α and thereby increases the expression and release of ANGPTL4 from human tendon cells.

  • Targeting ANGPTL4 and its regulatory pathways is a potential avenue for regulating tendon vascularization to improve tendon healing or adaptation.


Abbreviations

ANGPTL4

angiopoietin‐like 4

DAB

3,3′‐diaminobenzidine

DMOG

dimethyloxalylglycine

HIF‐1α

hypoxia‐inducible factor‐1α

HUVEC

human umbilical vein endothelial cell

PT

patellar tendon

qPCR

quantitative PCR

TGF‐β

transforming growth factor β

VE

vascular endothelial

VEGF

vascular endothelial growth factor

Introduction

Neovascularization in tendon tissue occurs under various circumstances. Acute tendon injuries stimulate the production of angiogenic factors that promote healing, whereas tendinopathic lesions are associated with increased neovascularization and degenerative abnormalities (Sharma & Maffulli, 2005). Neovascularization is an essential part of tendon healing during the proliferative phase; however, hypervascularity in chronic tendinopathy is associated with tendon pain (Ohberg et al. 2001; Pufe et al. 2005). Several growth factors, including vascular endothelial growth factor (VEGF), basic fibroblast growth factor and transforming growth factor‐β (TGF‐β), promote vascularization in tendon tissue, although the factors in painful tendon lesions that lead either to ongoing angiogenesis or a failure to retract new blood vessels are unknown (Fenwick et al. 2002; Molloy et al. 2003).

Mechanical stimuli induce tendon cells to release a number of biochemical factors such as VEGF, tumour necrosis factor‐α, interleukin‐6, prostaglandin E2, substance P and platelet‐derived growth factor, which may promote angiogenesis in tendon tissue (Skutek et al. 2001 a,b; Petersen et al. 2004 a; Fong et al. 2005; Yang et al. 2005; Backman et al. 2011; Gao et al. 2013; Legerlotz et al. 2013). We previously reported that the expression of angiopoietin‐like 4 (ANGPTL4), basic fibroblast growth factor, cyclooxygenase 2, TGF‐α and VEGF in tendon cells is increased in response to cyclic loading. The present study focused on ANGPTL4, whose role in the tendon has not previously been examined in detail (Mousavizadeh et al. 2014).

ANGPTL4 belongs to a superfamily of secreted proteins that regulate angiogenesis. Although there is a structural similarity with angiopoietins, ANGPTL proteins are orphan ligands and they do not bind to the receptor tyrosine kinases Tie 1 or Tie 2. Shortly after the discovery of ANGPTL4 as a factor involved in lipid metabolism (known as fasting‐induced adipose factor), the function of this protein was investigated in other metabolic and non‐metabolic pathways that modulate energy homeostasis, wound healing, oncogenesis, metastasis, inflammation, lymphangiogenesis and angiogenesis. Recent studies showed that ANGPTL4 provokes the disruption of vascular junction integrity via integrin α5β1‐mediated Rac/PAK signalling and the de‐clustering and internalization of vascular endothelial (VE)‐cadherin and claudin‐5, which are events that induce vascular leakiness and permeability (Le Jan et al. 2003; Morisada et al. 2006; Gealekman et al. 2008; Hato et al. 2008; Huang et al. 2011). In ischaemic and diabetic retinopathies, hypoxia and high glucose lead to elevated levels of ANGPTL4, which increases vascular permeability and angiogenesis (Xin et al. 2013; Yokouchi et al. 2013; Kwon et al. 2015).

In the present study, we characterized the function of the ANGPTL4 protein in the tendon and its regulation by hypoxia‐inducible factor 1α (HIF‐1α) and TGF‐β. Our in vitro and in vivo models provide insights about the angiogenic activity of ANGPTL4, which may play a role in tendon neovascularization during the course of chronic and acute tendon injuries, or in the physiological response to cyclic mechanical stretch.

Methods

Cell culture

Human tendon cells were isolated, cultured and subjected to cyclic loading using a Flexcell apparatus (Flexcell International Corp., Hillsborough, NJ, USA) as described previously (Mousavizadeh et al. 2014). The use of orthopaedic autograft material (semitendinosus tendon) for isolating tendon cells was approved by the UBC Clinical Research Ethics Board (certificate number H10‐00220) and each patient provided their written, informed consent. The human tendon cell culture was used to study the effects of the mechanical stimulation and regulatory pathways on ANGPTL4 expression. To study the role of HIF‐1α in the regulation of ANGPTL4, the isolated tendon cells were incubated with dimethyloxalylglycine (DMOG) (#400091; EMD Millipore, Billericia, MA, USA) and chetomin (#4705; Tocris Bioscience, St Louis, MO, USA), which increase the accumulation of HIF‐1α protein and inhibit its activity, respectively (Staab et al. 2007; Barrett et al. 2011). The cells were also treated with recombinant human TGF‐β1 (240‐B‐002; R&D Systems, Minneapolis, MN, USA) and A‐83‐01 as the inhibitor of TGF‐ β signalling (#2939; Tocris Bioscience) to investigate the effect of the TGF‐β pathway on ANGPTL4 expression. To examine the impact of hypoxic conditions that could potentially occur in injured tendons or during intense exercise, the tendon cells were placed in a hypoxic chamber (Coy Labs, Grass Lake, MI, USA) containing 1% O2, 5% CO2 and 95% nitrogen. The cells were pre‐treated with or without 100 nm chetomin for 2 h and then placed in the hypoxic chamber for 6 h.

Human tendon tissue

Samples of rotator cuff tendon tissue were obtained from 18 patients during the period from August 2007 to June 2010. To be included, subjects had to be undergoing arthroscopic management for complete or partial supraspinatus rupture. The exclusion criteria were subscapularis tendon pathology or fatty infiltration of the supraspinatus muscle on magnetic resonance imaging, diabetes and systemic inflammatory (rheumatological) disorders. Samples were collected arthroscopically from the edge of the tear and the adjacent subscapularis tendon with a 3 mm biopsy punch. The samples were fixed in fresh 10% buffered formalin for 16–24 h at 4°C and then subsequently dehydrated and paraffin embedded for immunohistochemistry analysis. Thirty‐six samples were analysed (two per patient: one supraspinatus and one subscapularis). The study was approved by the regional committee for research ethics in Norway (Helse Sør‐Øst, 1.2007.728) and by the institution where the analysis was carried out (UBC, H12‐01483). Written informed consent was obtained from all subjects.

Animal studies

We used an acute patellar tendon (PT) injury model to compare the influence of ANGPTL4 among ANGPTL4 knockout (−/−) and heterozygous (+/−) mice, and in wild‐type (control) mice (ANGPTL4 +/+). ANGPTL4 –/–, +/– and +/+ mice were generated by inbreeding ANGPTL4 +/– mice (B6;129S5‐Angptl4Gt(OST352973)Lex /Mmucd), obtained from the Mutant Mouse Regional Resource Centre (MMRRC, University of California Davis, CA, USA; 032147‐UCD). Mice were genotyped at UBC in accordance with the MMRC protocol. The acute PT injury was performed using a 0.30 mm True‐Cut Disposable Biopsy Punch (#RBP‐030; Robbins Instruments, Chatham, NJ, USA) as described previously (Scott et al. 2011) and the skin wound was sutured. The left uninjured PT was used as control. PTs were harvested after 3 days, 3 weeks and 12 weeks post injury to target inflammatory, reparative and remodelling phases of tendon healing (Sharma & Maffulli, 2005), respectively.

In a separate study, the effect of exogenous ANGPTL4 was tested by injecting recombinant protein into uninjured mouse PTs. Based on a previous study that injected 5 μg of VEGF into rat Achilles tendon to determine the effect of exogenous VEGF on tendon healing (Zhang et al. 2003), we injected 5 μg of recombinant mouse ANGPTL4 protein (4880‐AN; R&D Systems) reconstituted in 10 μl of PBS into the right PTs of adult female CD‐1 mice (Charles River, St Constant, Canada), and the left PTs were injected with 10 μl of PBS as control. PTs were harvested 3 days after the injection.

All animals were aged between 8 and 16 weeks and weighed 25–37 g at the beginning of the experiments. The UBC Animal Care Committee approved the protocols for breeding (certificate number A14‐0053) and for the experimental use of animals (certificate number A12‐0092). At least four mice were used in each experimental group.

Tube formation assay

The angiogenic activity of recombinant human ANGPTL4 (4487‐AN; R&D Systems) was measured using a tube formation assay as described previously (Mousavizadeh et al. 2014). The recombinant protein was added to matrigel and to the media of human umbilical vein endothelial cells (HUVECs) at a concentration of 10 μg ml−1. The primary HUVEC cells were isolated from normal umbilical cords under a UBC approved human ethics certificate (certificate number H03‐50102). After 6 h of incubation, the tubular networks of endothelial cells were stained with Calcein AM (#4892‐010‐K; Trevigen, Gaithersburg, MD, USA) for visualization by fluorescence microscopy using standardized exposure times. Total tube length in micrographs was measured with AngioTool software (https://ccrod.cancer.gov/confluence/display/ROB2/Home) and data were reported as pixels per field.

Gene expression and protein quantification

After incubating human tendon cells with DMOG and TGF‐β, the mRNA expression was analysed using relative quantitative PCR (qPCR). RNA extraction, cDNA synthesis, real time qPCR and the Angiogenesis RT² Profiler™ PCR Array (#PAHS‐024Z; Qiagen, Santa Clarita, CA, USA) were performed on the cultured cells as described previously (Mousavizadeh et al. 2014). Gene expression analysis also performed on harvested mouse tendon tissues. The qPCR primers used in the present study for detecting mouse genes are listed in Table 1. To extract RNA from mouse tendon tissue, mouse PTs were harvested and placed in liquid nitrogen. The frozen tissues were homogenized in a Mikrodismembrator (Sartorius, Gottingen, Germany) and immediately incubated with Trizol followed by chloroform to form a biphasic solution for harvesting the RNA fraction. Total RNA was purified using a High Pure RNA Isolation Kit (#11828665001; Roche, Mannheim, Germany) and used as template for cDNA synthesis with a High Capacity cDNA Reverse Transcription Kit (#4368814; Applied Biosystems, Foster City, CA, USA).

Table 1.

Oligonucleotide sequence of primers and amplicon sizes of selected mouse genes

Target gene Forward primer sequence Reverse primer sequence Amplicon size (bp)
CD31 CAAGCAAAGCAGTGAAGCTG CTAACTTCGGCTTGGGAAAC 146
CD34 ATCCGAGAAGTGAGGTTGGC CAGGGAGCAGACACTAGCAC 156
FLK‐1 CTGTGGCGAAGATGTTTTTG TTCATCCCACTACCGAAAGC 163
MMP‐3 GGAAATCAGTTCTGGGCTATACGAGG CCAACTGCGAAGATCCACTGAAGAAG 301*
MMP‐13 TCTTTATGGTCCAGGCGATGA ATCAAGGGATAGGGCTGGGT 82
VEGF‐A TTACTGCTGTACCTCCACC ACAGGACGGCTTGAAGATG 189
GAPDH TCACCACCATGGAGAAGGC GCTAAGCAGTTGGTGGTGCA 169

*Ogawa et al. (2005).

To quantify ANGPTL4 protein released by human tendon cells in response to cyclic loading, DMOG, chetomin, hypoxia, TGF‐β or A83.01, a commercial enzyme‐linked immunosorbent assay kit was used, as described previously (Mousavizadeh et al. 2014).

TGFβ luciferase assay

TGF‐β activity in the conditioned media of tendon cells was measured using a modified cell‐based luciferase assay (Jones et al. 2013). HeLa cells were transfected with CAGA and Renilla plasmids using Metafecten® Pro (#T040; Biontex, München, Germany). The harvested conditioned media of tendon cells subjected to cyclic loading were incubated with the transfected cells for 6 h, and the media of non‐stretched cells were used as control. The luciferase activity was measured by Dual‐Luciferease® Reporter Assay System (#E1910; Promega, Madison, WI, USA) in accordance with the manufacturer's instructions and the luminescence was recorded using an Infinite 200 PRO microplate reader (Tecan, Männedorf, Switzerland). The luminescence of CAGA was normalized to Renilla as a control for transfection efficiency.

Immunohistochemistry

Mouse tendon tissue was fixed in 10% formalin overnight followed by three washes with PBS and storage in PBS at 4°C. The tissues were dehydrated and embedded in paraffin. Paraffin‐embedded tissue sections were deparaffinized in three changes of xylene and then hydrated through two changes each of 100%, 90% and 70% alcohol followed by two changes of distilled water. Slides were blocked for endogenous peroxidase activity with two incubations of 20 min each in 3% hydrogen peroxide solution at room temperature. Antigen retrieval was performed using 2% pepsin in 0.1 m HCl solution at 37°C for 15 min. Slides were blocked with 1% BSA + 0.1% Tween in PBS for 1 h and then incubated with anti‐CD‐31 rabbit primary antibody (ab28634; dilution 1:100; Abcam, Cambridge, MA, USA) for 1 h. A goat anti‐rabbit Alexa 594 fluorescent secondary antibody (A11037; dilution 1:500; Invitrogen, Carlsbad, CA, USA) was then applied for 30 min at room temperature. Finally, slides were incubated with Hoescht (dilution 1:10,000) for 2 min to visualize nuclei. All staining procedures were conducted at room temperature in a darkened humidified chamber.

Paraffin‐embedded tissue of human rotator cuff tendons was processed at Provincial Health Services Authority (PHSA) Laboratories, Histology Services (Vancouver, BC, Canada), and immunostained with antibodies against CD31 (ab28634; dilution 1:100; Abcam), ANGPTL4 (A00309‐02; dilution 1:20; Aviscera Bioscinece, Santa Clara, CA, USA) and HIF‐1α (#NB100‐105; dilution 1:50; Novus Biologicals, Littleton, CO, USA), followed by 3,3′‐diaminobenzidine (DAB) staining.

Image processing

Fluorescence micrographs were taken using an Axio Observer A.1 (Carl Zeiss, Oberkochen, Germany) with a 10× objective. Images from five representative fields of view were taken for each tissue section. For each field of view, images were taken from the fluorescent channels representing CD31 and nuclei. CellProfiler software (http://www.cellprofiler.org) was used to colour and overlay separate channels within a field of view.

To quantitate expression of CD31, a positivity score representing the ratio of stained tissue to total tissue was taken for each CD31 channel image. Staining artefacts and overlapping tissue segments were cropped, and the surface area of stained tissue was determined via thresholding using the Otsu method in ImageJ (NIH, Bethesda, MD, USA) (Schindelin et al. 2012). The total tissue surface area was then determined by outlining tissue in ImageJ.

For human tendon tissue, the tissue slides were scanned using an Aperio Scanscope XT system (Leica Biosystems, Buffalo Grove, IL, USA) and full sections were scored for positivity of DAB chromogen staining using ImageScope software (Leica Biosystems). Sections were outlined, excluding any areas of folded tissue, and the built‐in Positive Pixel Count algorithm was used to count the number of positive‐to‐negative pixels. The percentage of positively stained pixels in each section was calculated, and used to compare expression of ANGPTL4 and that of CD31 or HIF‐1α within the same tissue sample.

Statistical analysis

The qPCR data of the in vitro and in vivo experiments were examined by one‐way ANOVA followed by Tukey's multiple comparison and paired t tests, respectively. A paired t test was also applied to the enzyme‐linked immunosorbent assay data, tube formation assay and dual luciferase assay. Pearson's correlation coefficients were used to identify the association between target proteins/genes. Descriptive results from the Angiogenesis RT² Profiler™ PCR Array were analysed with Student's t test using SABiosciences Web‐Based PCR Array Data Analysis (http://pcrdataanalysis.sabiosciences.com/pcr/arrayanalysis.php). Other statistical analyses were carried out using Prism (GraphPad Software, La Jolla, CA, USA).

Results

ANGPTL4 promotes angiogenesis and tendon vascularization

To investigate the angiogenic activity of ANGPTL4, several in vitro and in vivo approaches were used. ANGPTL4 protein induced primary HUVECs to form longer tubes in matrigel compared to controls (P < 0.0001) (Fig. 1 A). This pro‐angiogenic effect was also apparent in tendon tissue; when ANGPTL4 protein was directly injected into the mouse PT, the expression of well‐characterized angiogenesis markers (including CD31, CD34, KDR/FLK‐1 and VEGFA) was increased (Fig. 1 B). The recombinant protein also dramatically induced the expression of matrix metalloproteinase (MMP)‐3 in tendon, whose activity may facilitate tendon remodelling and vascularization (Sahin et al. 2012) (Fig. 1 C). As expected, ANGPTL4 and CD31 were both upregulated 3 weeks after acute tendon injury (during the repair phase) (Fig. 2). However, in ANGPLT4 –/– mice, the expression of CD31 was lower than in control mice, indicating an impairment in post‐injury angiogenesis. Intriguingly, PT injury also significantly induced the expression of MMP‐3 in wild‐type and heterozygous mice but not in ANGPLT4 –/– mice (Fig. 2). We also found a moderate to strong correlation between the expression of ANGPTL4 and angiogenesis markers in ANGPLT4 +/+ and +/– mice (data not shown). Immunostaining of human rotator cuff tendons (subscapularis and supraspinatus) (Fig. 3 A) also showed a moderate correlation between the expression of CD31 and ANGPLT4 (Fig. 3 B), lending further support to the association between ANGPTL4 expression and tendon vascularization.

Figure 1. In vitro and in vivo angiogenic activity of recombinant ANGPTL4 protein .

Figure 1

A, recombinant ANGPTL4 protein (10 μg ml−1) induces tubular formation by HUVECs in matrigel. The micrographs (5×) of fluorescent microscopy are showing the tubular network stained with Calcein AM. The graph shows the total tube length per micrograph measured using AngioTool. Scale bars = 100 μm. B, 3 days after injecting 5 μg recombinant ANGPTL4 protein into the PT of CD‐1 mouse, the expression of CD31 protein was increased compared to control, which was injected with the same volume of PBS. The micrographs represent IHC of the PT tissue immunolabelled for CD31 and the graph shows the positive pixels for CD31 staining measured by imageScope. Scale bars = 100 μm. C, injection of recombinant protein also significantly induced the mRNA expression of endothelia cell markers (CD31, CD34 and FLK), MMP‐3 and VEGFA. Student's t test; mean ± SE; *P < 0.1; ****P < 0.0001.

Figure 2. Lack of ANGPTL4 decreases tendon vascularization following tendon injury in an ANGPTL4‐deficient mouse model .

Figure 2

The induced expression of ANGPTL4 in PTs of +/+ mice in response to acute injury was associated with the increased expression of CD31 and MMP‐3 compared to uninjured PTs (A). The florescent micrograph of PTs showed significantly higher expression of CD31 (green colour) in +/+ mice compared to –/– mice by counting positively stained pixels (B). Student's t test; mean ± SE; ***P < 0.001. Scale bars = 100 μm.

Figure 3. Correlation of ANGPTL4, CD31 and HIF‐1α expression in human rotator cuff tendons .

Figure 3

The scanned images of immunostained human rotator cuff tendons with anti‐ANGPTL4, ‐CD31 and ‐HIF‐1α antibodies (A) showed that the percentage of positive pixels with ANGPTL4 (x‐axis) staining has a moderate correlation with CD31 staining (B) (Pearson's r = 0.5723; P < 0.01) and a strong correlation with HIF‐1α staining (y‐axis) (C) (Pearson r = 0.8285; P < 0.0001). Scale bars = 300 μm. The images represent the selected area of a full section of human rotator cuff tendon with 8× magnification. Each data point in (B) and (C) represents the percentage of positive staining in individual tendon samples, measured in adjacent sections.

HIF‐1α modulates the expression of ANGPTL4

Immunostaining of human rotator cuff tendon also showed a strong correlation between the expression of HIF‐1α and ANGPTL4 (Fig. 3 C), which suggested the potential role of HIF‐1α in modulating ANGPTL4. To further investigate the mechanism by which HIF‐1α activity may be regulating ANGPTL4, we treated human tendon cells with factors and conditions that modify the activity and accumulation of HIF‐1α protein. DMOG is a cell permeant prolyl‐4‐hydroxylase inhibitor that increases the accumulation of HIF‐1α protein (Barrett et al. 2011). DMOG‐treated human tendon cells demonstrated a dose‐responsive increase in the expression of ANGPTL4 mRNA and protein (Fig. 4 A and B). Hypoxic conditions also enhanced the release of ANGPTL4 protein from human tendon cells (Fig. 4 C). Inhibition of HIF‐1α by chetomin (Staab et al. 2007) blocked the ability of cyclic loading to induce the release of ANGPTL4 (Fig. 4 D). Taken together, these data suggest that the expression and release of ANGPTL4 is regulated by the HIF‐1α pathway, and that the induction of ANGPTL4 by mechanical loading is influenced by this pathway.

Figure 4. HIF‐1α modulates the expression of ANGPTL4 in human tendon cells .

Figure 4

DMOG treatment induced ANGPTL4 mRNA (A) and protein (B) in human tendon cells in a dose (μm) and time (h) response manner. Hypoxic conditions (1% oxygen) also increased the release of ANGPTL4 protein from cultures of human tendon cells (C). Induced release of ANGPTL4 from strained (ST) human tendon cells was diminished by chetomin (100 nm) (D). Student's t test (C) and one way ANOVA (B and D); mean ± SE; *P < 0.1; **P < 0.01; ***P < 0.001.

ANGPTL4 induced by cyclic loading is mediated by TGF‐β activity

Similar to ANGPTL4, the activity of TGF‐β (Fig. 5 D) is upregulated in the conditioned media of cyclically stretched tendon cells. We hypothesized that this increase in TGF‐β activity may be responsible for an autocrine induction of ANGPTL4. In support of this hypothesis, the expression and release of ANGPTL4 by human tendon cells was blocked by A‐83‐01 (Fig. 5 A and B), an inhibitor of Smad2/3 phosphorylation and the TGF‐β cascade (Tojo et al. 2005). Furthermore, blocking the TGF‐β pathway with A‐83‐01 prevented the induced release of ANGPTL4 from tendon cells during cyclic loading (Fig. 5 C).

Figure 5. TGF‐β regulates ANGPTL4 expression in human tendon cells .

Figure 5

Inhibition of TGF‐β receptor by A83.01 blocked the induced expression of ANGPLT4 mRNA (A) and the release of ANGPTL4 protein (B) in response to TGF‐β. A83.01 prevented the induction of ANGPTL4 in response to cyclic strain (C). TGF‐β activity was increased in conditioned media of strained (ST) tendon compared to non‐strained (NS) cells (D). Student's t test and one way ANOVA; mean ± SE; *P < 0.1; **P < 0.01; ***P < 0.001.

ANGPTL4 is induced by both HIF‐1α and TGF‐β

Given the above findings regarding the potential regulatory roles of both HIF‐1α and TGF‐β on ANGPTL4 expression, we aimed to determine whether these two pathways also exert a dual influence on other angiogenic genes. Therefore, we exposed human tendon cells to either recombinant TGF‐β or DMOG (a stabilizer of HIF‐1α) and evaluated the expression of 84 genes related to angiogenesis. Of this set, the only gene that was induced by both TGF‐β and DMOG was ANGPTL4 (Fig. 6). This finding accentuates the uniquely complementary roles of TGF‐β and HIF‐1α in the regulation of tendon vascularization through ANGPTL4.

Figure 6. An array of angiogenesis related genes in response to TGF‐β and DMOG .

Figure 6

A volcano graph of the expression of angiogenesis‐related genes (log2‐fold changes) and the table of upregulated genes following the incubation of human tendon cells with DMOG (100 μm) (A) and recombinant TGF‐β protein (2.5 ng ml−1) (B) for 6 h show that ANGPTL4 is the only overlapping gene in this array induced with DMOG and TGF‐β.

Discussion

The mechanisms and regulatory pathways that promote vascular changes in tendons are an ongoing topic of study. In these experiments, we found that ANGPTL4 regulates tendon vascularity following injury, and that cyclic loading induces the expression and release of ANGPTL4 through the activities of HIF‐1α and TGF‐β. ANGPTL4 has multiple physiological functions and is involved in lipid metabolism and angiogenesis (Hato et al. 2008). Although the role of ANGPTL4 in lipid metabolism and its inhibitory effect on lipoprotein lipase have been well studied, the angiogenic activity of this protein has remained controversial. In some studies, ANGPTL4 protein reportedly inhibits adhesion, migration and sprouting of endothelial cells and suppresses vascular leakiness, angiogenesis and metastasis (Ito et al. 2003; Cazes et al. 2006; Galaup et al. 2006). On the other hand, several studies have described the angiogenic activity of ANGPTL4 in promoting vascular permeability and inducing angiogenesis in numerous disorders, including ischaemic retinopathies, obesity, arthritis and some tumours (Le Jan et al. 2003; Hermann et al. 2005; Gealekman et al. 2008; Ma et al. 2010; Nakayama et al. 2010; Nakayama et al. 2011; Zhang et al. 2012; Xin et al. 2013). The angiogenic activity of ANGPTL4 is reportedly independent of VEGF, and able to stimulate angiogenesis even in the presence of factors that inhibit VEGF activity (Le Jan et al. 2003; Gealekman et al. 2008). Although no specific receptor has been identified for ANGPTL4 to convey its angiogenic activity, it has been shown that the protein interacts with integrin 5α1, VE‐cadherin and claudin‐5, which disrupt cell contact between endothelial cells and promote blood vessel leakiness (Huang et al. 2011).

Neovascularization in chronic and acute injuries has apparently paradoxical effects on the recovery from tendon injury. Angiogenesis is part of the normal healing process after acute injury, although the proliferation of blood vessels in chronic tendon injuries has been proposed to contribute to pain (Alfredson et al. 2003). Although the molecular mechanisms of tendon vascularization in chronically injured tendon are poorly understood, the factors and pathways that regulate angiogenesis in various settings (e.g. acute or chronic injuries and tendon development) may overlap. For example, VEGF expression is increased not only in degenerative tendons, but also in fetal tendons and in spontaneously ruptured Achilles tendons (Petersen et al. 2003; Pufe et al. 2005). Lack of an overuse model in the present study limits any conclusions about the role of ANGPTL4 in the pathophysiology of overuse tendinopathy. However, several animal models have demonstrated the role of mechanical stress in altered expression of angiogenic factors and tendon vascularization. In a rabbit tendinopathy model, the number of blood vessels and the expression of VEGF were increased in response to exercise (Andersson et al. 2011). This model could be used in the future to study the association of ANGPTL4 with the development of tendinopathy.

In murine and human tendon tissue, a blood–tendon barrier composed of occludin and claudin proteins in the vascular wall of tendon vessels protects human and murine tendon tissue from the circulatory system. Factors such as trauma and injury may disturb this barrier and affect the normal composition of the tendon niche (Lehner et al. 2014). Given that ANGPTL4 can alter the integrity of the blood vessel barrier through disruption of intercellular VE‐cadherin and claudin‐5 clusters (Huang et al. 2011), this mechanism needs to be determined in tendon tissue. In ischaemic stroke, ANGPTL4 increases the stability of endothelial cell junctions and cell barrier integrity of the cerebral microvessels by antagonizing VEGF/src signalling (Bouleti et al. 2013).

Kersten et al. (2009) showed that endurance exercise enhances ANGPTL4 protein levels in the plasma through metabolic changes and the increased release of free fatty acids. Although, in the present study, we have not investigated the effects of free fatty acids and metabolic factors on the regulation of ANGPTL4 in tendon cells, our results suggest that the HIF‐1α pathway and TGF‐β activity both mediate the expression and release of ANGPTL4 in response to mechanical stress, which are phenomena that could be highly relevant during exercise. Several other studies have reported the increased expression and activity of HIF‐1α in response to mechanical stress (Kim et al. 2002; Pufe et al. 2004; Petersen et al. 2004 b; Beckmann et al. 2014). TGF‐β isoforms and their receptors have broad biological functions and are involved in different processes in tendon tissue, including development, growth, healing, adaptation and tissue homeostasis (Fenwick et al. 2001; Klein et al. 2002; Heinemeier et al. 2003; Pryce et al. 2009; Maeda et al. 2011).

In the present study, the reduction of MMP‐3 levels in the tendons of ANGPTL4 –/– mice was very striking. Murata et al. (2009) reported that MMP‐3 is regulated by ANGPTL4 in chondrocytes. The enzymatic activity of MMP‐3 promotes the degradation of extracellular matrices and collagen fibres, and induces the activity of other MMPs by protein cleavage. The cleavage of VEGF by MMP‐3 and MMP‐9 increases the bioavailability of this growth factor and further promotes blood vessel formation (Lee et al. 2005). MMP‐3 also induces the proliferation and migration of endothelial cells, thereby accelerating wound healing after dental pulp injury (Zheng et al. 2009). The altered expression of MMP‐3 in acute rotator cuff injuries and tendon healing suggests that it functions in tissue remodelling (Del Buono et al. 2012). Mathieu et al. (2014) showed that matrix remodelling during chondrogenesis is governed by ANGPTL4, which upregulates the expression of several MMPs including MMP‐3. Emerging work has also shown that ANGPTL4 interacts with extracellular matrix proteins such as vitronectin and fibronectin, thereby delaying their proteolytic degradation by MMPs (Goh et al. 2010). Therefore, the role of ANGPTL4 in tendon matrix degradation and remodelling is probably important, and further studies are needed.

In conclusion, our studies have provided evidence to support the hypothesis that ANGPTL4 induces neovascularization in tendon tissue. We have also highlighted the potential roles of TGF‐β and HIF‐1α in the induction of ANGPTL4 expression by cyclic loading. Cyclic loading of human tendon cells stimulates the activities of TGF‐β and HIF‐1α, both of which increase the expression and release of ANGPTL4. Understanding the factors and pathways that modulate neovascularization in overuse tendinopathy may lead to the development of new methods for managing and detecting overuse tendon injuries. Further research could also aim to evaluate whether ANGPTL4 protein is a potential biomarker for the early detection of chronic tendon injuries.

Additional information

Competing interests

The authors declare that they have no competing interests.

Author contributions

RM, VD and AS designed the study. RM conducted the experiments, analysed data and wrote the paper. AL conducted the image processing and assisted with the immunohistochemistry. GSA assisted with the animal dissection and preparation of figures. MG assisted with the dual luciferase assay. HB assisted with the experimental design. All authors have approved the final version of the manuscript and agree to be accountable for all aspects of the work. All persons designated as authors qualify for authorship, and all those who qualify for authorship are listed.

Funding

This study was funded by the Canadian Institutes of Health Research (CIHR). RM was the recipient of a research training award from WorkSafe BC.

Acknowledgements

We thank Dr Eleanor Jones for donating CAGA and Renilla plasmids, Peng Zhang for providing GAPDH primer and Alexandra Kobza for her assistance.

References

  1. Alfredson H, Ohberg L & Forsgren S (2003). Is vasculo‐neural ingrowth the cause of pain in chronic Achilles tendinosis? An investigation using ultrasonography and colour Doppler, immunohistochemistry, and diagnostic injections. Knee Surg Sports Traumatol Arthrosc 11, 334–338. [DOI] [PubMed] [Google Scholar]
  2. Andersson G, Forsgren S, Scott A, Gaida JE, Stjernfeldt JE, Lorentzon R, Alfredson H, Backman C & Danielson P (2011). Tenocyte hypercellularity and vascular proliferation in a rabbit model of tendinopathy: contralateral effects suggest the involvement of central neuronal mechanisms. Br J Sports Med 45, 399–406. [DOI] [PubMed] [Google Scholar]
  3. Backman LJ, Fong G, Andersson G, Scott A & Danielson P (2011). Substance P is a mechanoresponsive, autocrine regulator of human tenocyte proliferation. PLoS ONE 6, e27209. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Barrett TD, Palomino HL, Brondstetter TI, Kanelakis KC, Wu X, Haug PV, Yan W, Young A, Hua H, Hart JC, Tran DT, Venkatesan H, Rosen MD, Peltier HM, Sepassi K, Rizzolio MC, Bembenek SD, Mirzadegan T, Rabinowitz MH & Shankley NP (2011). Pharmacological characterization of 1‐(5‐chloro‐6‐(trifluoromethoxy)‐1H‐benzoimidazol‐2‐yl)‐1H‐pyrazole‐4‐carboxylic acid (JNJ‐42041935), a potent and selective hypoxia‐inducible factor prolyl hydroxylase inhibitor. Mol Pharmacol 79, 910–920. [DOI] [PubMed] [Google Scholar]
  5. Beckmann R, Houben A, Tohidnezhad M, Kweider N, Fragoulis A, Wruck CJ, Brandenburg LO, Hermanns‐Sachweh B, Goldring MB, Pufe T & Jahr H (2014). Mechanical forces induce changes in VEGF and VEGFR‐1/sFlt‐1 expression in human chondrocytes. Int J Mol Sci 15, 15456–15474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Bouleti C, Mathivet T, Coqueran B, Serfaty JM, Lesage M, Berland E, Ardidie‐Robouant C, Kauffenstein G, Henrion D, Lapergue B, Mazighi M, Duyckaerts C, Thurston G, Valenzuela DM, Murphy AJ, Yancopoulos GD, Monnot C, Margaill I & Germain S (2013). Protective effects of angiopoietin‐like 4 on cerebrovascular and functional damages in ischaemic stroke. Eur Heart J 34, 3657–3668. [DOI] [PubMed] [Google Scholar]
  7. Cazes A, Galaup A, Chomel C, Bignon M, Brechot N, Le Jan S, Weber H, Corvol P, Muller L, Germain S & Monnot C (2006). Extracellular matrix‐bound angiopoietin‐like 4 inhibits endothelial cell adhesion, migration, and sprouting and alters actin cytoskeleton. Circ Res 99, 1207–1215. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Del Buono A, Oliva F, Longo UG, Rodeo SA, Orchard J, Denaro V & Maffulli N (2012). Metalloproteases and rotator cuff disease. J Shoulder Elbow Surg 21, 200–208. [DOI] [PubMed] [Google Scholar]
  9. Fenwick SA, Curry V, Harrall RL, Hazleman BL, Hackney R & Riley GP (2001). Expression of transforming growth factor‐beta isoforms and their receptors in chronic tendinosis. J Anat 199, 231–240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Fenwick SA, Hazleman BL & Riley GP (2002). The vasculature and its role in the damaged and healing tendon. Arthritis Res 4, 252–260. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Fong KD, Trindade MC, Wang Z, Nacamuli RP, Pham H, Fang TD, Song HM, Smith RL, Longaker MT & Chang J (2005). Microarray analysis of mechanical shear effects on flexor tendon cells. Plast Reconstr Surg 116, 1393–1404. [DOI] [PubMed] [Google Scholar]
  12. Galaup A, Cazes A, Le Jan S, Philippe J, Connault E, Le Coz E, Mekid H, Mir LM, Opolon P, Corvol P, Monnot C & Germain S (2006). Angiopoietin‐like 4 prevents metastasis through inhibition of vascular permeability and tumor cell motility and invasiveness. Proc Natl Acad Sci USA 103, 18721–18726. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Gao HG, Fisher PW, Lambi AG, Wade CK, Barr‐Gillespie AE, Popoff SN & Barbe MF (2013). Increased serum and musculotendinous fibrogenic proteins following persistent low‐grade inflammation in a rat model of long‐term upper extremity overuse. PLoS ONE 8, e71875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Gealekman O, Burkart A, Chouinard M, Nicoloro SM, Straubhaar J & Corvera S (2008). Enhanced angiogenesis in obesity and in response to PPARgamma activators through adipocyte VEGF and ANGPTL4 production. Am J Physiol Endocrinol Metab 295, E1056–E1064. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Goh YY, Pal M, Chong HC, Zhu P, Tan MJ, Punugu L, Tan CK, Huang RL, Sze SK, Tang MB, Ding JL, Kersten S & Tan NS (2010). Angiopoietin‐like 4 interacts with matrix proteins to modulate wound healing. J Biol Chem 285, 32999–33009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hato T, Tabata M & Oike Y (2008). The role of angiopoietin‐like proteins in angiogenesis and metabolism. Trends Cardiovasc Med 18, 6–14. [DOI] [PubMed] [Google Scholar]
  17. Heinemeier K, Langberg H, Olesen JL & Kjaer M (2003). Role of TGF‐beta1 in relation to exercise‐induced type I collagen synthesis in human tendinous tissue. J Appl Physiol 95, 2390–2397. [DOI] [PubMed] [Google Scholar]
  18. Hermann LM, Pinkerton M, Jennings K, Yang L, Grom A, Sowders D, Kersten S, Witte DP, Hirsch R & Thornton S (2005). Angiopoietin‐like‐4 is a potential angiogenic mediator in arthritis. Clin Immunol 115, 93–101. [DOI] [PubMed] [Google Scholar]
  19. Huang RL, Teo Z, Chong HC, Zhu P, Tan MJ, Tan CK, Lam CR, Sng MK, Leong DT, Tan SM, Kersten S, Ding JL, Li HY & Tan NS (2011). ANGPTL4 modulates vascular junction integrity by integrin signaling and disruption of intercellular VE‐cadherin and claudin‐5 clusters. Blood 118, 3990–4002. [DOI] [PubMed] [Google Scholar]
  20. Ito Y, Oike Y, Yasunaga K, Hamada K, Miyata K, Matsumoto S, Sugano S, Tanihara H, Masuho Y & Suda T (2003). Inhibition of angiogenesis and vascular leakiness by angiopoietin‐related protein 4. Cancer Res 63, 6651–6657. [PubMed] [Google Scholar]
  21. Jones ER, Jones GC, Legerlotz K & Riley GP (2013). Cyclical strain modulates metalloprotease and matrix gene expression in human tenocytes via activation of TGFbeta. Biochim Biophys Acta 1833, 2596–2607. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Kersten S, Lichtenstein L, Steenbergen E, Mudde K, Hendriks HF, Hesselink MK, Schrauwen P & Muller M (2009). Caloric restriction and exercise increase plasma ANGPTL4 levels in humans via elevated free fatty acids. Arterioscler Thromb Vasc Biol 29, 969–974. [DOI] [PubMed] [Google Scholar]
  23. Kim CH, Cho YS, Chun YS, Park JW & Kim MS (2002). Early expression of myocardial HIF‐1alpha in response to mechanical stresses: regulation by stretch‐activated channels and the phosphatidylinositol 3‐kinase signaling pathway. Circ Res 90, E25–E33. [DOI] [PubMed] [Google Scholar]
  24. Klein MB, Yalamanchi N, Pham H, Longaker MT & Chang J (2002). Flexor tendon healing in vitro: effects of TGF‐beta on tendon cell collagen production. J Hand Surg Am 27, 615–620. [DOI] [PubMed] [Google Scholar]
  25. Kwon SH, Shin JP, Kim IT & Park DH (2015). Aqueous levels of angiopoietin‐like 4 and semaphorin 3E correlate with nonperfusion area and macular volume in diabetic retinopathy. Ophthalmology 122, 968–975. [DOI] [PubMed] [Google Scholar]
  26. Le Jan S, Amy C, Cazes A, Monnot C, Lamande N, Favier J, Philippe J, Sibony M, Gasc JM, Corvol P & Germain S (2003). Angiopoietin‐like 4 is a proangiogenic factor produced during ischemia and in conventional renal cell carcinoma. Am J Pathol 162, 1521–1528. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Lee S, Jilani SM, Nikolova GV, Carpizo D & Iruela‐Arispe ML (2005). Processing of VEGF‐A by matrix metalloproteinases regulates bioavailability and vascular patterning in tumors. J Cell Biol 169, 681–691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Legerlotz K, Jones GC, Screen HR & Riley GP (2013). Cyclic loading of tendon fascicles using a novel fatigue loading system increases interleukin‐6 expression by tenocytes. Scand J Med Sci Sports 23, 31–37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Lehner C, Gehwolf R, Ek J, Traweger A, Bauer H, Bauer H‐C & Tempfer H (2014). Identification and characterisation of a novel tissue barrier: the blood–tendon barrier. Br J Sports Med 48, A36. [DOI] [PubMed] [Google Scholar]
  30. Ma T, Jham BC, Hu J, Friedman ER, Basile JR, Molinolo A, Sodhi A & Montaner S (2010). Viral G protein‐coupled receptor up‐regulates angiopoietin‐like 4 promoting angiogenesis and vascular permeability in Kaposi's sarcoma. Proc Natl Acad Sci USA 107, 14363–14368. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Maeda T, Sakabe T, Sunaga A, Sakai K, Rivera AL, Keene DR, Sasaki T, Stavnezer E, Iannotti J, Schweitzer R, Ilic D, Baskaran H & Sakai T (2011). Conversion of mechanical force into TGF‐beta‐mediated biochemical signals. Curr Biol 21, 933–941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Mathieu M, Iampietro M, Chuchana P, Guerit D, Djouad F, Noel D & Jorgensen C (2014). Involvement of angiopoietin‐like 4 in matrix remodeling during chondrogenic differentiation of mesenchymal stem cells. J Biol Chem 289, 8402–8412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Molloy T, Wang Y & Murrell G (2003). The roles of growth factors in tendon and ligament healing. Sports Med 33, 381–394. [DOI] [PubMed] [Google Scholar]
  34. Morisada T, Kubota Y, Urano T, Suda T & Oike Y (2006). Angiopoietins and angiopoietin‐like proteins in angiogenesis. Endothelium 13, 71–79. [DOI] [PubMed] [Google Scholar]
  35. Mousavizadeh R, Khosravi S, Behzad H, McCormack RG, Duronio V & Scott A (2014). Cyclic strain alters the expression and release of angiogenic factors by human tendon cells. PLoS ONE 9, e97356. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Murata M, Yudo K, Nakamura H, Chiha J, Okamoto K, Suematsu N, Nishioka K, Beppu M, Inoue K, Kato T & Masuko K (2009). Hypoxia upregulates the expression of angiopoietin‐like‐4 in human articular chondrocytes: role of angiopoietin‐like‐4 in the expression of matrix metalloproteinases and cartilage degradation. J Orthop Res 27, 50–57. [DOI] [PubMed] [Google Scholar]
  37. Nakayama T, Hirakawa H, Shibata K, Abe K, Nagayasu T & Taguchi T (2010). Expression of angiopoietin‐like 4 in human gastric cancer: ANGPTL4 promotes venous invasion. Oncol Rep 24, 599–606. [DOI] [PubMed] [Google Scholar]
  38. Nakayama T, Hirakawa H, Shibata K, Nazneen A, Abe K, Nagayasu T & Taguchi T (2011). Expression of angiopoietin‐like 4 (ANGPTL4) in human colorectal cancer: ANGPTL4 promotes venous invasion and distant metastasis. Oncol Rep 25, 929–935. [DOI] [PubMed] [Google Scholar]
  39. Ogawa T, Nikawa T, Furochi H, Kosyoji M, Hirasaka K, Suzue N, Sairyo K, Nakano S, Yamaoka T, Itakura M, Kishi K & Yasui N (2005). Osteoactivin upregulates expression of MMP‐3 and MMP‐9 in fibroblasts infiltrated into denervated skeletal muscle in mice. Am J Physiol Cell Physiol 289, C697–C707. [DOI] [PubMed] [Google Scholar]
  40. Ohberg L, Lorentzon R & Alfredson H (2001). Neovascularisation in Achilles tendons with painful tendinosis but not in normal tendons: an ultrasonographic investigation. Knee Surg Sports Traumatol Arthrosc 9, 233–238. [DOI] [PubMed] [Google Scholar]
  41. Petersen W, Unterhauser F, Pufe T, Zantop T, Sudkamp NP & Weiler A (2003). The angiogenic peptide vascular endothelial growth factor (VEGF) is expressed during the remodeling of free tendon grafts in sheep. Arch Orthop Trauma Surg 123, 168–174. [DOI] [PubMed] [Google Scholar]
  42. Petersen W, Varoga D, Zantop T, Hassenpflug J, Mentlein R & Pufe T (2004. a). Cyclic strain influences the expression of the vascular endothelial growth factor (VEGF) and the hypoxia inducible factor 1 alpha (HIF‐1alpha) in tendon fibroblasts. J Orthop Res 22, 847–853. [DOI] [PubMed] [Google Scholar]
  43. Petersen W, Varoga D, Zantop T, Hassenpflug J, Mentlein R & Pufe T (2004. b). Cyclic strain influences the expression of the vascular endothelial growth factor (VEGF) and the hypoxia inducible factor 1 alpha (HIF‐1alpha) in tendon fibroblasts. J Orthop Res 22, 847–853. [DOI] [PubMed] [Google Scholar]
  44. Pryce BA, Watson SS, Murchison ND, Staverosky JA, Dunker N & Schweitzer R (2009). Recruitment and maintenance of tendon progenitors by TGFbeta signaling are essential for tendon formation. Development 136, 1351–1361. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Pufe T, Lemke A, Kurz B, Petersen W, Tillmann B, Grodzinsky AJ & Mentlein R (2004). Mechanical overload induces VEGF in cartilage discs via hypoxia‐inducible factor. Am J Pathol 164, 185–192. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Pufe T, Petersen WJ, Mentlein R & Tillmann BN (2005). The role of vasculature and angiogenesis for the pathogenesis of degenerative tendons disease. Scand J Med Sci Sports 15, 211–222. [DOI] [PubMed] [Google Scholar]
  47. Sahin H, Tholema N, Petersen W, Raschke MJ & Stange R (2012). Impaired biomechanical properties correlate with neoangiogenesis as well as VEGF and MMP‐3 expression during rat patellar tendon healing. J Orthop Res 30, 1952–1957. [DOI] [PubMed] [Google Scholar]
  48. Schindelin J, Arganda‐Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ, Hartenstein V, Eliceiri K, Tomancak P & Cardona A (2012). Fiji: an open‐source platform for biological‐image analysis. Nat Methods 9, 676–682. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Scott A, Sampaio A, Abraham T, Duronio C & Underhill TM (2011). Scleraxis expression is coordinately regulated in a murine model of patellar tendon injury. J Orthop Res 29, 289–296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Sharma P & Maffulli N (2005). Tendon injury and tendinopathy: healing and repair. J Bone Joint Surg Am 87, 187–202. [DOI] [PubMed] [Google Scholar]
  51. Skutek M, van Griensven M, Zeichen J, Brauer N & Bosch U (2001. a). Cyclic mechanical stretching enhances secretion of interleukin 6 in human tendon fibroblasts. Knee Surg Sports Traumatol Arthrosc 9, 322–326. [DOI] [PubMed] [Google Scholar]
  52. Skutek M, van Griensven M, Zeichen J, Brauer N & Bosch U (2001. b). Cyclic mechanical stretching modulates secretion pattern of growth factors in human tendon fibroblasts. Eur J Appl Physiol 86, 48–52. [DOI] [PubMed] [Google Scholar]
  53. Staab A, Loeffler J, Said HM, Diehlmann D, Katzer A, Beyer M, Fleischer M, Schwab F, Baier K, Einsele H, Flentje M & Vordermark D (2007). Effects of HIF‐1 inhibition by chetomin on hypoxia‐related transcription and radiosensitivity in HT 1080 human fibrosarcoma cells. BMC Cancer 7, 213. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Tojo M, Hamashima Y, Hanyu A, Kajimoto T, Saitoh M, Miyazono K, Node M & Imamura T (2005). The ALK‐5 inhibitor A‐83‐01 inhibits Smad signaling and epithelial‐to‐mesenchymal transition by transforming growth factor‐beta. Cancer Sci 96, 791–800. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Xin X, Rodrigues M, Umapathi M, Kashiwabuchi F, Ma T, Babapoor‐Farrokhran S, Wang S, Hu J, Bhutto I, Welsbie DS, Duh EJ, Handa JT, Eberhart CG, Lutty G, Semenza GL, Montaner S & Sodhi A (2013). Hypoxic retinal Muller cells promote vascular permeability by HIF‐1‐dependent up‐regulation of angiopoietin‐like 4. Proc Natl Acad Sci USA 110, E3425–E3434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Yang G, Im HJ & Wang JH (2005). Repetitive mechanical stretching modulates IL‐1beta induced COX‐2, MMP‐1 expression, and PGE2 production in human patellar tendon fibroblasts. Gene 363, 166–172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Yokouchi H, Eto K, Nishimura W, Takeda N, Kaburagi Y, Yamamoto S & Yasuda K (2013). Angiopoietin‐like protein 4 (ANGPTL4) is induced by high glucose in retinal pigment epithelial cells and exhibits potent angiogenic activity on retinal endothelial cells. Acta Ophthalmol 91, E289–E297. [DOI] [PubMed] [Google Scholar]
  58. Zhang F, Liu H, Stile F, Lei MP, Pang Y, Oswald TM, Beck J, Dorsett‐Martin W & Lineaweaver WC (2003). Effect of vascular endothelial growth factor on rat Achilles tendon healing. Plast Reconstr Surg 112, 1613–1619. [DOI] [PubMed] [Google Scholar]
  59. Zhang H, Wong CC, Wei H, Gilkes DM, Korangath P, Chaturvedi P, Schito L, Chen J, Krishnamachary B, Winnard PT, Jr. , Raman V, Zhen L, Mitzner WA, Sukumar S & Semenza GL (2012). HIF‐1‐dependent expression of angiopoietin‐like 4 and L1CAM mediates vascular metastasis of hypoxic breast cancer cells to the lungs. Oncogene 31, 1757–1770. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  60. Zheng L, Amano K, Iohara K, Ito M, Imabayashi K, Into T, Matsushita K, Nakamura H & Nakashima M (2009). Matrix metalloproteinase‐3 accelerates wound healing following dental pulp injury. Am J Pathol 175, 1905–1914. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Physiology are provided here courtesy of The Physiological Society

RESOURCES