Abstract
Background
To examine the prevalence of the Paraoxonase1 (PON1) gene 192Q/R polymorphism amongst Singaporean Chinese with Alzheimer's disease (AD) and mixed dementia and possible clinical associations.
Methods
We examined the presence of the PON1 192Q/R polymorphism together with cognitive status, functional status and neuropsychiatric symptoms among 186 older Singaporean Chinese with AD (n = 109) and mixed dementia (n = 77).
Results
The R allele predominated in 67% of the AD patients and 63.1% of the patients with mixed dementia. Within the mixed dementia subgroup, the R allele was significantly associated with a higher BADLS score, NPI-Q scores and CDR scores.
Conclusion
Among older Singaporean Chinese with AD and mixed dementia, the R allele was predominant. In particular, within the mixed dementia subgroup, the R allele carrier status was associated with poorer functional status, greater presence of neuropsychiatric symptoms and a more severe stage of dementia. Further studies should be conducted.
Key Words: Paraoxonase 1, Alzheimer's disease, Mixed dementia, Singaporean Chinese elderly, Neuropsychiatric symptoms
Introduction
Singapore is a multiracial South-East Asian country with a rapidly ageing population. Together with the greying of the nation, the numbers of persons with dementia (PWD) is increasing from an estimated 53,000 by 2020 to 187,000 by 2050. Amongst the older population, late onset Alzheimer's disease (AD) and vascular dementia (VaD) are the predominant forms of dementia. In a community study of older Singaporeans (>70 years), the prevalence of possible AD was 60%; while in a younger age group (50-69 years), the prevalence of possible VaD was 65% [1]. Mixed dementia as a diagnostic entity consisting primarily of AD with the presence of stroke disease is also frequently observed in the local memory clinics [2]. Neuropsychiatric symptoms are frequently observed in about 60-75% of all PWD, most commonly apathy (27-36%), depression (24-32%) and agitation/aggression (24-30%) [3,4]. They pose enormous burdens of care, but remain less understood in terms of pathogenesis, risk factors and clinical course.
The Paraoxonase Family
The paraoxonase (PON) enzyme family comprises three members, PON1, PON2 and PON3, whose genes are located adjacent to each other on chromosome 7q21-22 [5]. In vivo, the PONs are involved in the reduction of oxidative stress and the prevention of atherosclerosis. PON polymorphisms with decreased levels of PON activity have thus been associated with vascular diseases including coronary artery disease and stroke [6,7,8,9,10,11,12]. PON2 is expressed in nearly all human tissues and exerts its anti-oxidative properties through the reduction of reactive oxygen species, low density lipoprotein (LDL) protection from oxidative stress and the enhanced anti-oxidant capacity of high density lipoprotein (HDL) [13]. PON3 is less studied but has been shown to reduce LDL oxidative stress with protection against atherosclerosis, although the specific natural substrates of PON3 have not been well characterized [13].
Paraoxonase 1
Of the 3 PONs, PON1 has been most intensely studied in relation to the risk of cardiovascular disease, stroke, oxidative stress and inflammation. Its encoding gene has also been identified as a longevity gene [14]. PON1 is synthesized in the liver and circulates on the surface of HDL particles, and it is a Ca2+-linked enzyme [15]. It was first studied for its organophosphatase activity which explained its ability to detoxify organophosphate through hydrolysis and thus provide neuroprotection against the effects of environmental neurotoxins and age-related neurodegeneration [16,17]. Subsequently, PON1 was ascribed to have significant anti-oxidative and anti-inflammatory properties through its enzymatic actions as a lactonase, peroxidase and esterase [13]. These properties account for the ability of HDL to prevent LDL oxidation.
The PON1 192Q/R Polymorphism and Dementia
PON1 also has cholinesterase-inhibitive properties. Human serum PON1 levels and activity display an up to 40-fold interindividual variability and are genetically associated with a single nucleotide polymorphism (SNP) in the PON1 gene. PON1 polymorphisms include those in the coding (L55M; rs854560 and R192Q; rs662) and promoter region (−107A/G; rs705379 and −161C/T; rs705381) of the gene [18]. Of these, the molecular basis of the PON1 192Q/R gene polymorphism is a glycine (Gln) → arginine (Arg) substitution at residue 192 (NCBI database dbSNP: rs662) that results in three possible genotypes: QQ, QR and RR. The PON1 192Q/R polymorphism is of particular interest in AD because of its possible effects on dementia pathophysiology and response to cholinesterase inhibition [19]. In terms of activity based on genotyping, individuals carrying Arg at residue 192 (R allele) reportedly have a higher PON1-hydrolyzing activity than those carrying Gln (Q allele) [20]. Pola et al. [21] (in 2005) demonstrated that subjects carrying the R allele were more likely to respond to cholinesterase inhibitor therapy. As an endogenous cholinesterase inhibitor, PON1 may thus augment the biological activity of cholinesterase inhibitor drugs, thus improving their efficacy.
Regarding the association between dementia and PON1 192Q/R, clinical research has produced mixed results. A recent meta-analysis of 10 studies on AD patients showed no significant association of the PON1 192Q/R polymorphism on AD susceptibility [22]. To date, 11 case-control studies have observed the relationship between the PON1 polymorphism at 192Q/R and the risk of developing AD or dementia with inconsistent results. Only 2 of 8 studies in which AD patients were selected as cases reported a protective effect of the PON1 192Q/R polymorphism on the risk of developing AD [23,24], and the other 6 studies showed a lack of association [19,25,26,27,28,29]. For AD and VaD, an earlier study reported low serum levels of PON1 in AD compared to VaD patients [30]. In three other studies which looked into both AD and VaD patients, one showed that PON 192Q/R was not significantly associated with AD or VaD, one found no significant difference, and one suggested that the R allele was an independent risk factor for VaD and mixed dementia [31,32,33]. Furthermore, no previous studies of patients with AD and VaD have examined the effect of the PON1 genetic polymorphism on the clinical manifestations and severity of dementia.
Aims of the Study
The primary aim of our study was to examine the profile of the PON1 gene and its 192Q/R polymorphism amongst PWD attending a Memory disorders clinic in Singapore. The secondary aim was to examine the possible associations of the 192Q/R polymorphism with cognition, physical function and neuropsychiatric symptoms. At the time of the study conception, due to limited resources, the 192Q/R polymorphism was chosen to be studied as there was no local data on its profile among PWD.
Methods
Subjects
A cross-sectional study using convenience sampling among patients attending the outpatient Memory Clinic of a Geriatric Medicine Department in a regional hospital of Singapore was conducted from 2006 till 2009. The inclusion criteria were PWD including AD, VaD, mixed dementia, dementia with Lewy bodies and frontotemporal dementia. Exclusion criteria were: (1) patients with mild cognitive impairment and (2) patients with no caregivers.
Diagnosis of Dementia
The diagnosis of dementia based on DSM-IV (TR) was established by a multidisciplinary consensus approach on the basis of medical history, clinical examination, relevant blood investigations and brain imaging with either CT scan or MRI. The National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association (NINCDS-ADRDA) [34] and NINDS-AIREN [35] criteria were used to classify the dementias into AD, VaD and AD with CVD (mixed dementia), respectively. The diagnosis of dementia with Lewy bodies was based on the criteria by McKeith et al. [36]. The clinical diagnosis of frontotemporal dementia was based on the criteria by McKhann et al. [37].
Ethics Approval
All patients who fulfilled the inclusion criteria gave written informed consent for participation. The research was approved by the Hospital's Ethics Committee and the domain-specific Review Board of the National Healthcare Group.
Data Collection
Data was collected from reviews of case notes, physical and functional assessments and questionnaire interviews upon first diagnosis by the clinicians and a nurse clinician trained in administering the questionnaires.
Cognitive Status, Neuropsychiatric Symptoms and Functional Status
Cognitive status was assessed using the Mini-Mental State Examination (MMSE), a validated and widely used measure to determine global cognitive functioning on domains of memory, attention, language, praxis and visual-spatial ability, with summed scores ranging from 0 to 30, higher values denoting better cognitive performance [38]. Global rating scales utilized in the assessment of patients included the Clinical Dementia Rating Scale (CDR) and the Global Deterioration Scale (GDS). The CDR clinically stages the severity of dementia by assessing domains of memory, orientation, judgment and problem-solving, community affairs, home & hobbies and personal care, with global scores ranging from 0 to 3 [39,40]. The GDS provides caregivers and clinicians with an overview of the stages of cognitive function for those suffering from a primary degenerative dementia such AD [41]. It has 7 stages of which 1-3 are pre-dementia stages and 4-7 are dementia stages. In this study, the patients had a minimum CDR (global) of ≥0.5 and GDS of ≥4.
Neuropsychiatric symptoms were evaluated using the Neuropsychiatric Inventory Questionnaire (NPI-Q), a brief clinical form of the Neuropsychiatric Inventory (NPI) [42], which had previously been validated and highly correlated with NPI and found to be useful in general clinical practice. The NPI-Q is made up of 12 symptom domains derived from the original NPI [43]. Neuropsychiatric symptoms are assessed on a 3-point scale for each symptom domain, and the total NPI severity score represents the sum of the individual symptom scores, it ranges from 0 to 36. Caregiver distress is anchored on a 0- to 5-point scale with the total NPI-Q distress score of 0-60.
Physical functional status was defined by the Bristol Activities of Daily Living Scale (BADLS), a 20-item carer-rating instrument specifically designed for dementia patients, giving a total score range of 0 to 60, a lower score indicating better daily function [44]. Functional assessment staging (FAST) was also utilized in evaluating the functional deterioration of AD and mixed dementia patients during the course of their illness. It is a functional ordinal scale ranging from 1 (no disability) to 7 (highest level of disability) with information based on caregiver input.
Other Biodata
Other demographic and clinical variables included ethnicity, gender, age, birthplace, education, housing type and a history of diabetes mellitus, hypertension, hyperlipidemia and stroke.
Genotyping
Whole-blood DNA was extracted using a commercial column (Qiagen-QIAamp DNA Blood mini kit). Real-time polymerase chain reaction was used for genotyping of SNP rs662 (chromosome 7; Applied Biosystems, TaqMan Pre-Designed SNP Genotyping Assay). Multiplex polymerase chain reaction (more than one primer/probe pair per reaction), which allows genotyping of the two possible variants at the single SNP site in a target template sequence, was performed. In each assay, there were two fluorescent dye detectors (one for the wild type, and the other for the mutation). The allelic discrimination assay classified samples as homozygotes (samples with only allele 1 or 2) and heterozygotes (samples with both alleles). TaqMan® MGB probe for SNP rs662 (labeled with VIC® dye) was used: (20X)TAAACCCAAATACATCTCCCAGGAT[C/T]GTAAGTAGGGGTCAAGAAAATAGTG
Based on the Gln (for the Q allozyme) → Arg (for the R allozyme) substitution at residue 192, three genotypes are derived: QQ, QR and RR.
Statistical Analysis
Data were analyzed with the independent t test for continuous variables and the χ2 test for categorical variables. The Hardy-Weinberg equilibrium was confirmed for all patients. Allelic frequencies were estimated by the allele counting method. The χ2 test was used (1) to compare genotype and allele frequencies and (2) to compare the differences in prevalence of neuropsychiatric symptoms by the PON1 192Q/R genotypes: RR versus QR, RR versus QQ and QR versus QQ. Further on, the χ2 test was applied to evaluate the differences in prevalence of neuropsychiatric symptoms in PWD by the PON1 192Q/R allele status (QR or RR, QQ) and among dementia subtypes (AD and mixed dementia). All analyses were conducted using SPSS statistical software version 15.0 (SPSS, Inc., Chicago, Ill., USA). A two-sided p value of <0.05 was considered significant.
Results
Predominant Dementia Subtypes
AD and mixed dementia were the predominant dementia subtypes. There were a total of 186 Chinese patients with AD and mixed dementia who had genotyping done. For the other dementia subtypes, there were 7 VaD patients, 1 Parkinson's disease with dementia and 2 dementia with Lewy bodies. As their numbers were too small, these were excluded from the analysis.
Within the AD and mixed dementia group, 109 were AD patients and 77 were mixed dementia patients (mean age 77.3 years, 67.7% women). More than half had hypertension (65.1%) and 47.3% had hyperlipidemia (table 1). By stage of dementia, 85 patients were at a mild, 90 at a moderate and 11 at a severe stage of dementia.
Table 1.
Demographic characteristics of the study population (n = 186)
| Mean age ± SD, years | 77.3 ± 7.1 |
| Female gender | 126 (67.7%) |
| AD | 109 (58.6%) |
| Mixed dementia | 77 (41.4%) |
| Diabetes | 52 (28.0%) |
| Hypertension | 121 (65.1%) |
| Hyperlipidemia | 88 (47.3%) |
| Stroke | 20 (10.8%) |
Distribution of Allele Genotypes
The distribution of PON1 polymorphisms in the study population is presented in table 2. The genotypes were in Hardy-Weinberg equilibrium and their distribution was not significantly different between the AD patients and the mixed dementia patients (9 QQ, 54 QR, 46 RR; 9 QQ, 39 QR, 29 RR, respectively, p = 0.673). In addition, the presence of at least one R allele (QR or RR) and the presence of at least one Q allele (QR or QQ) were not significantly different between the AD patients and the mixed dementia patients (91.7 and 88.3%, p = 0.436; 57.8 and 62.3%, p = 0.534, respectively). Likewise, the allele distribution was not significantly different between the two groups: the Q allele frequency was 33.0% in the AD patients and 37.9% in the mixed dementia patients, while the R allele frequency was 67.0% in the AD patients and 63.1% in the mixed dementia patients (p = 0.426). The ratio between Q and R allele frequencies was 0.493 in the AD patients and 0.588 in the mixed dementia patients.
Table 2.
PON1 genotype distribution and allele frequencies in the study population
| Group | n | Genotype, n (%) |
p1 | p2 | p3 | Allele, n (%) |
P4 | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| QR | RR | Q | R | Q/R | |||||||
| AD | 109 | 9 (8.3) | 54 (49.5) | 46 (42.2) | 0.673 | 0.436 | 0.534 | 72 (33.0) | 146 (67.0) | 0.493 | 0.426 |
| Mixed dementia | 77 | 9 (11.7) | 39 (50.6) | 29 (37.7) | 57 (37.9) | 97 (63.1) | 0.588 | ||||
| Total | 186 | 18 (9.7) | 93 (50.0) | 75 (40.3) | 129 (34.7) | 243 (65.3) | 0.531 | ||||
p1 value for χ2 test of differences in PON1 genotype frequencies between AD and mixed dementia patients.
p2 value for χ2 test of differences in (QR + RR) and QQ genotype between AD and mixed dementia patients.
p3 value for χ2 test of differences in (QR + QQ) and RR genotype between AD and mixed dementia patients.
p4 value for χ2 test of differences in PON1 allele frequencies between AD and mixed dementia patients.
Allele Associations with Cognitive Status, Neuropsychiatric Symptoms and Function
In the total group, R allele carriers, compared with non-R allele carriers, showed higher mean NPI-Q (S) scores and NPI-Q (CD) scores (8.80 vs. 4.89, p = 0.004; 8.92 vs. 3.94, p = 0.002, respectively; tables 3, 4). There were no significantly differences in MMSE score (p = 0.426), global CDR score (p = 0.928), total CDR score (p = 0.407), GDS/FAST score (p = 0.283) and BADLS score (p = 0.303). The same relationships were examined in patients by AD and mixed dementia subtypes. In the mixed dementia group, the presence of the R allele was significantly associated with pronouncedly higher mean NPI-Q (S) scores (9.01 vs. 3.11, p = 0.039) and NPI-Q (CD) scores (9.09 vs. 2.33, p = 0.006), as well as with total CDR scores (8.57 vs. 5.89, p = 0.042), GDS/FAST scores (4.84 vs. 4.11, p = 0.007) and BADLS scores (6.99 vs. 1.00, p < 0.001). In contrast, among patients in the AD subgroup, no significant differences in any of these measures between R allele carriers and non-carriers were found.
Table 3.
Clinical manifestations and severity of dementia in PWD by PON1 allele status
| RR (n = 75) | QR (n = 93) | QQ (n = 18) | p values (from c2 test) |
|||
|---|---|---|---|---|---|---|
| RR vs. QR | RR vs. QQ | QR vs. QQ | ||||
| MMSE score | 15.8 ± 6.30 | 15.6 ± 5.81 | 16.9 ± 5.06 | 0.829 | 0.508 | 0.390 |
| Global CDR score | 1.52 ± 0.67 | 1.41 ± 0.59 | 1.47 ± 0.56 | 0.254 | 0.780 | 0.673 |
| Total CDR score | 8.47 ± 3.86 | 8.07 ± 3.49 | 7.50 ± 3.15 | 0.480 | 0.327 | 0.526 |
| GDS/FAST score | 4.71 ± 0.90 | 4.74 ± 0.85 | 4.50 ± 0.62 | 0.794 | 0.358 | 0.251 |
| NPI-Q (S) score | 8.85 ± 8.20 | 8.76 ± 8.42 | 4.89 ± 4.51 | 0.945 | 0.008 | 0.007 |
| NPI-Q (CD) score | 8.65 ± 9.89 | 9.13 ± 9.36 | 3.94 ± 5.22 | 0.750 | 0.007 | 0.002 |
| BADLS score | 7.29 ± 10.2 | 6.24 ± 7.56 | 4.50 ± 6.70 | 0.455 | 0.271 | 0.366 |
Data are expressed as mean ± SD.
Table 4.
Clinical manifestations and severity of patients with dementia by PON1 polymorphism status and among dementia subtypes
| Whole sample |
AD |
Mixed Dementia |
|||||||
|---|---|---|---|---|---|---|---|---|---|
| QR or RR (n = 168) | QQ (n = 18) | p value | QR or RR (n = 100) | QQ (n = 9) | p Value | QR or RR (n = 68) | QQ (n = 9) | p Value | |
| MMSE score | 15.7 ± 6.01 | 16.9 ±5.06 | 0.426 | 15.7 ± 5.77 | 14.7 ± 3.57 | 0.596 | 15.7 ± 6.39 | 19.1 ± 5.53 | 0.134 |
| Global CDR score | 1.46 ± 0.63 | 1.47 ±0.56 | 0.928 | 1.42 ± 0.595 | 1.78 ± 0.441 | 0.043 | 1.52 ± 0.672 | 1.17 ± 0.500 | 0.079 |
| Total CDR score | 8.24 ± 3.66 | 7.50 ±3.15 | 0.407 | 8.03 ± 3.36 | 9.11 ± 2.26 | 0.214 | 8.57 ± 4.06 | 5.89 ± 3.19 | 0.042 |
| GDS/FAST score | 4.73 ± 0.87 | 4.50 ±0.62 | 0.283 | 4.65 ± 0.809 | 4.89 ± 0.333 | 0.099 | 4.84 ± 0.940 | 4.11 ± 0.601 | 0.007 |
| NPI-Q (S) score | 8.80 ± 8.30 | 4.89 ±4.51 | 0.004 | 8.66 ± 8.39 | 6.67 ± 3.78 | 0.206 | 9.01 ± 8.23 | 3.11 ± 4.68 | 0.039 |
| NPI-Q (CD) score | 8.92 ± 9.58 | 3.94 ±5.22 | 0.002 | 8.80 ± 9.69 | 5.56 ± 4.90 | 0.109 | 9.09 ± 9.47 | 2.33 ± 5.29 | 0.006 |
| BADLS score | 6.71 ± 8.80 | 4.50 ±6.70 | 0.303 | 6.52 ± 8.06 | 8.00 ± 7.98 | 0.598 | 6.99 ± 9.85 | 1.00 ± 2.00 | <0.001 |
Data are expressed as mean ± SD.
Prevalence of Various Neuropsychiatric Symptoms by the PON1 192Q/R Genotypes and by the Genotype and Dementia Subgroups
For the total group, the prevalence of delusion was significantly higher among patients with the QR genotype than among those with the QQ genotype (47.3 and 22.2%, respectively, p = 0.050; table 5). Within the mixed dementia subgroup, R allele carriers, compared with non-R allele carriers, showed a significantly lower prevalence of elation/euphoria (11.9 vs. 100.0%, p < 0.001) and a higher prevalence of nighttime behaviors (49.3 vs. 11.1%, p = 0.037; table 6).
Table 5.
Frequencies of neuropsychiatric symptoms in PWD by PON1 192 Q/R genotypes
| RR (n = 75) | QR (n = 93) | QQ (n = 18) | p values (from c2 test) |
|||
|---|---|---|---|---|---|---|
| RR vs. QR | RR vs. QQ | QR vs. QQ | ||||
| Delusions | 26 (35.1) | 43 (47.3) | 4 (22.2) | 0.117 | 0.295 | 0.050 |
| Hallucinations | 15 (20.3) | 22 (24.2) | 3 (16.7) | 0.550 | 1.000 | 0.759 |
| Agitation/aggression | 36 (48.6) | 50 (54.9) | 9 (50.0) | 0.421 | 0.918 | 0.700 |
| Depression/dysphoria | 35 (47.3) | 37 (40.7) | 6 (33.3) | 0.393 | 0.285 | 0.561 |
| Anxiety | 29 (39.2) | 40 (44.0) | 5 (27.8) | 0.537 | 0.368 | 0.203 |
| Elation/euphoria | 9 (12.2) | 8 (8.8) | 2 (11.1) | 0.479 | 1.000 | 0.669 |
| Apathy/indifference | 39 (52.7) | 51 (56.0) | 9 (50.0) | 0.668 | 0.837 | 0.638 |
| Disinhibition | 30 (40.5) | 31 (34.1) | 5 (27.8) | 0.392 | 0.317 | 0.604 |
| Irritability/liability | 34 (45.9) | 40 (44.0) | 7 (38.9) | 0.798 | 0.589 | 0.692 |
| Aberrant motor behavior | 22 (29.7) | 32 (35.2) | 7 (38.9) | 0.459 | 0.453 | 0.763 |
| Nighttime behaviors | 38 (51.4) | 41 (45.1) | 6 (33.3) | 0.421 | 0.170 | 0.359 |
| Appetite/eating change | 23 (31.1) | 36 (39.6) | 4 (22.2) | 0.258 | 0.459 | 0.163 |
Figures are numbers with percentages in parentheses.
Table 6.
Frequencies of neuropsychiatric symptoms in PWD by PON1 192 Q/R allele status and among dementia subtypes
| Whole sample |
AD |
Mixed dementia |
|||||||
|---|---|---|---|---|---|---|---|---|---|
| QR or RR (n = 168) | QQ (n = 18) | p value | QR or RR (n = 100) | QQ (n = 9) | p value | QR or RR (n = 68) | QQ (n = 9) | p value | |
| Delusions | 69 (41.8) | 4 (22.2) | 0.107 | 41 (41.8) | 2 (22.2) | 0.309 | 28 (41.8) | 2 (22.2) | 0.469 |
| Hallucinations | 37 (22.4) | 3 (16.7) | 0.767 | 23 (23.5) | 1 (11.1) | 0.680 | 14 (20.9) | 2 (22.2) | 1.000 |
| Agitation/aggression | 86 (52.1) | 9 (50.0) | 0.864 | 50 (51.0) | 5 (55.6) | 1.000 | 36 (53.7) | 4 (44.4) | 0.728 |
| Depression/dysphoria | 72 (43.6) | 6 (33.3) | 0.401 | 42 (42.9) | 2 (22.2) | 0.302 | 30 (44.8) | 4 (44.4) | 1.000 |
| Anxiety | 69 (41.8) | 5 (27.8) | 0.249 | 44 (44.9) | 1 (11.1) | 0.076 | 25 (37.3) | 4 (44.4) | 0.725 |
| Elation/euphoria | 17 (10.3) | 2 (11.1) | 1.000 | 9 (9.2) | 2 (22.2) | 0.232 | 8 (11.9) | 9 (100) | <0.001 |
| Apathy/indifference | 90 (54.5) | 9 (50.0) | 0.713 | 53 (54.1) | 6 (66.7) | 0.728 | 37 (55.2) | 3 (33.3) | 0.294 |
| Disinhibition | 61 (37.0) | 5 (27.8) | 0.441 | 39 (39.8) | 3 (33.3) | 1.000 | 22 (32.8) | 2 (22.2) | 0.711 |
| Irritability/liability | 74 (44.8) | 7 (38.9) | 0.629 | 41 (41.8) | 3 (33.3) | 0.734 | 33 (49.3) | 4 (44.4) | 1.000 |
| Aberrant motor behavior | 54 (32.7) | 7 (38.9) | 0.598 | 33 (33.7) | 5 (55.6) | 0.275 | 21 (31.3) | 2 (22.2) | 0.715 |
| Nighttime behaviors | 79 (47.9) | 6 (33.3) | 0.240 | 46 (46.9) | 54 (55.6) | 0.734 | 33 (49.3) | 1 (11.1) | 0.037 |
| Appetite/eating change | 59 (35.8) | 4 (22.2) | 0.251 | 38 (38.8) | 3 (33.3) | 1.000 | 21 (31.3) | 1 (11.1) | 0.271 |
Figures are numbers with percentages in parentheses.
Discussion
This study provides unique pilot data on the PON1 192Q/R polymorphism and its distribution among older Chinese patients with AD and mixed dementia in Singapore. We found that 67% of the AD patients and 63.1% of the patients with mixed dementia carried at least one R allele. In contrast to populations of European descent where the Q allele is predominant, the R allele is more frequent among Chinese PWD in Singapore. This finding is similar to that in Japan [29]. In a study on a mainland Chinese Han ethnic population, He et al. [23] reported that the PON1 R allele frequencies in AD patients and healthy controls were 0.607 and 0.647, respectively. Our study confirms the predominance of the R allele amongst the Chinese with concordant frequencies between the Han and Singaporean Chinese dementia subpopulations of AD and mixed dementia. It also adds to the findings of previous studies which suggest ethnic variations in the distribution of R and Q alleles, which in turn confer different AD risk associations in different ethnic populations.
The role of PON1 in AD and non-AD dementia has been explored in various studies. Helbecque et al. [32] studied both AD and non-AD demented patients (VaD and mixed dementia) and showed that the R allele was an independent risk factor for non-AD dementia. Within the PON1 gene itself, the differences in importance between the promoter and coding regions of PON1 on dementia have been clearly defined. In a more recent paper by Bednarska-Makaruk et al. [45], the significant association of PON1 activity with PON1 −108C>T and the PON1 Q192R polymorphisms was confirmed in a multivariate regression analysis, and the PON1 −108T allele had an effect on PON1 activity compared to the PON1 192R allele. This study also showed that PON1 activity was significantly lower in demented patients when compared with controls, particularly in AD and mixed dementia patients [45].
At the pathophysiological level, recent research has shown the contributing role of the PON1 192Q/R polymorphism towards the pathogenesis and risk of AD. While research has shown that PON1 gene polymorphisms may be limited in the pathogenesis of AD, a recent paper by Erlich et al. [46] (in 2010) showed that while the mechanisms by which PON1 influences AD is unknown, the risk-conferring effect of PON1 on AD is nevertheless significant. By measuring the arylesterase and lactonase activity, the odds of AD (adjusted for age, gender and ethnicity) increased 20% for each standard deviation decrease in arylesterase or lactonase activity. This study also showed association signals with activity across all 3 PON genes (i.e. PON1, PON2 and PON3). Haplotypes including SNPs spanning the PON genes were noted to be more significant than haplotypes comprising SNPs from 1 gene with significant interactions between SNP pairs located across the PON cluster. It concluded that low serum PON activity is a risk factor for AD with the further explanation that multiple variants in PON influence serum PON activity and their effects may be synergistic.
A recent study also demonstrated the positive correlation of PON1 activity with serum insulin level and homeostatic model assessment index (HOMA-IR) [47]. In another paper by Leduc and Poirier [19], the M55M genotype was significantly associated with AD risk, whereas PON1 192Q/R was not. In addition, the PON1 192Q/R polymorphism had no effect on choline acetyltransferase activity and nicotinic receptor density in the temporal cortex of AD patients compared to the met allele. However, it was found that AD subjects carrying at least one Arg allele at the Q192 locus had significantly lower Aβ42/Aβ40 ratios relative to AD Q192Q homozygous patients. These results highlight the role of PON1 as an anti-oxidant HDL-associated enzyme in lipoprotein complexes which function as scavengers of normally secreted extracellular lipophilic/ nonaggregated Aβ peptides in vivo.
The findings of this current study which suggest that Singaporean Chinese patients with mixed dementia (in particular those carrying the R allele) presented with greater numbers of neuropsychiatric symptoms and at more severe stages of dementia and AD invites interesting considerations. Low serum levels of PON1 activity were reported in one study of AD patients compared to VaD [30]. The R allele has been associated with an increased risk of stroke in Asians [48,49,50,51].
The presence of cerebrovascular disease in AD patients resulting in neuropsychiatric symptoms has been studied. A previous paper established that cerebral white matter disease is independently associated with behavioral and psychological symptoms of dementia in AD in Singapore [52]. Other studies, e.g. the Cache County Study in the USA, reflect the same association [53,54].
Regarding the role of PON1 in enhancing the risk of cerebrovascular disease which in turn leads to greater disease burden in AD patients in the form of neuropsychiatric symptoms and severity, this has not been examined before. PON1 inhibits LDL oxidation, which in turn drives HDL to exert its anti-atherogenic activity. It has been established that different PON polymorphisms, which affect lipid oxidation activity, are risk factors for different neurological diseases [26,55]. Another study has postulated that enhanced lipid peroxides target specific cells in different populations of patients, e.g. endothelial cells in stroke patients and cortical neurons in AD patients [56]. We hypothesize that the PON1 R allele does play a role in increasing cerebrovascular disease burden in AD patients and in turn neuropsychiatric symptoms, the mechanisms of which need to be further explored and understood.
The study has several limitations. (1) The sample size of the patient groups with the PON1 QQ genotype was small (9 QQ in the AD group and 9 QQ in the mixed dementia group). Although highly significant, the use of multiple testing could generate spurious results by chance, hence, the results suggesting an effect of the PON1 192Q/R polymorphism on neuropsychiatric symptoms would have to be replicated in studies with larger numbers of the QQ genotype. (2) The effect of the APOE status on disease severity and neuropsychiatric symptoms in AD patients has been well-documented. Subanalyses (data not shown) did not demonstrate an association of APOE with the PON1 status, or a confounding effect on dementia severity and neuropsychiatric symptoms. However, an interaction effect of APOE and PON1 is still possible and cannot be excluded. (3) Inadequate control of confounding by vascular and other risk factors (including age, smoking, lifestyle and education status) may also have contributed to the findings. (4) The influence of other polymorphisms in the PON1 gene on AD and mixed dementia could not be excluded. Other PON1 polymorphisms including pL55M and −108C>T have been shown to play a significant role in AD risk and pathogenesis. (5) The number of VaD patients was too small to examine the role of the PON1 Q/R genotype on this dementia subtype. (6) While the assessments were conducted by an experienced geriatrician and a trained nurse, it is still possible that there was an element of human subjectivity during the assessments of cognitive status and neuropsychiatric symptoms. This could potentially reduce the credibility of the results. (7) Analyses into possible associations of allele and genotype frequencies with diabetes mellitus, hypertension, hyperlipidemia and stroke were not conducted. (8) Associations of the R allele status with age of onset, clinical course and stage of dementia together with neuroimaging evidence of cerebrovascular disease were not studied.
Conclusion
This study provides significant pilot data on the PON1 192Q/R polymorphism and its prevalence amongst Singaporean Chinese patients with AD and mixed dementia which has hitherto not been demonstrated locally. It concurs with previous studies demonstrating the predominance of the R allele amongst Chinese dementia patients. It also provides interesting data on the possible association of the R allele with disease severity, functional status and manifestation in the mixed dementia subgroup. These findings should be replicated in other studies. Future study directions include: (1) a comparison of the distribution of the PON1 192Q/R polymorphism among PWD and controls in Singapore; this would enable us to assess the postulated protective effect of the R genotype against AD, (2) association studies between the different PON gene polymorphisms (PON1, PON2 and PON3), vascular risk factors (including lifestyle risk factors e.g. smoking) and dementia across different ethnic groups and (3) association studies of PON1 polymorphisms with neuroimaging markers of cerebrovascular disease and AD in light of the high burden of cerebrovascular white matter disease in the local population and its association with behavioral and psychological symptoms of dementia in AD [57]. These will help further our understanding of the association and clinical significance of PON and dementia in Singapore.
Disclosure Statement
There is no conflict of interest.
Acknowledgements
This study was funded by a National Medical Research Council (Singapore) Enabling Grant awarded in 2007. Protocol No. A07271.
References
- 1.Sahadevan S, Saw SM, Gao W, Tan LC, Chin JJ, Hong CY, Venketasubranmanian N. Ethnic differences in Singapore's dementia prevalence: the stroke, Parkinson's disease, epilepsy, and dementia in Singapore study. J Am Geriatr Soc. 2008;56:2061–2068. doi: 10.1111/j.1532-5415.2008.01992.x. [DOI] [PubMed] [Google Scholar]
- 2.Dong Y, Gan DZ, Tay SZ, Koay WI, Collinson SL, Hilal S, Venketasubramanian N, Chen C. Patterns of neuropsychological impairment in Alzheimer's disease and mixed dementia. J Neurol Sci. 2013;333:5–8. doi: 10.1016/j.jns.2013.05.011. [DOI] [PubMed] [Google Scholar]
- 3.Lyketsos CG, Lopez O, Jones B, Fitzpatrick AL, Breitner J, DeKosky S. Prevalence of neuropsychiatric symptoms in dementia and mild cognitive impairment: results from the cardiovascular health study. JAMA. 2002;288:1475–1483. doi: 10.1001/jama.288.12.1475. [DOI] [PubMed] [Google Scholar]
- 4.Lyketsos CG, Steinberg M, Tschanz JT, Norton MC, Steffens DC, Breitner JC. Mental and behavioural disturbances in dementia: findings from the Cache County Study on Memory in Aging. Am J Psychiatry. 2000;157:708–714. doi: 10.1176/appi.ajp.157.5.708. [DOI] [PubMed] [Google Scholar]
- 5.Clendenning JB, Humbert R, Green ED, Wood C, Traver D, Furlong CE. Structural organization of the human PON1 gene. Genomics. 1996;35:586–589. doi: 10.1006/geno.1996.0401. [DOI] [PubMed] [Google Scholar]
- 6.Mackness M, Durrington P, Mackness B. Paraoxonase 1 activity, concentration and genotype in cardiovascular disease. Curr Opin Lipidol. 2004;15:399–404. doi: 10.1097/01.mol.0000137227.54278.29. [DOI] [PubMed] [Google Scholar]
- 7.Roest M, Jansen AC, Barendrecht A, Leus FR, Kastelein JJ, Voorbij HA. Variation at the paraoxonase gene locus contributes to carotid arterial wall thickness in subjects with familial hypercholesterolemia. Clin Biochem. 2005;38:123–127. doi: 10.1016/j.clinbiochem.2004.10.005. [DOI] [PubMed] [Google Scholar]
- 8.Voetsch B, Benke KS, Panhuysen CI, Damasceno BP, Loscalzo J. The combined effect of paraoxonase promoter and coding region polymorphisms on the risk of arterial ischemic stroke among young adults. Arch Neurol. 2004;61:351–356. doi: 10.1001/archneur.61.3.351. [DOI] [PubMed] [Google Scholar]
- 9.Wheeler JG, Keavney BD, Watkins H, Collins R, Danesh J. Four paraoxonase gene polymorphisms in 11212 cases of coronary heart disease and 12786 controls: meta-analysis of 43 studies. Lancet. 2004;63:689–695. doi: 10.1016/S0140-6736(04)15642-0. [DOI] [PubMed] [Google Scholar]
- 10.Sanghera DK, Aston CE, Saha N, Kamboh MI. DNA polymorphisms in two paraoxonase genes (PON1 and PON2) are associated with the risk of coronary heart disease. Am J Hum Genet. 1998;62:36–44. doi: 10.1086/301669. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Jarvik GP, Rozek LS, Brophy VH, Hatsukami TS, Richter RJ, Schellenberg GD, Furlong CE. Paraoxonase (PON1) phenotype is a better predictor of vascular disease than is PON1(192) or PON1(55) genotype. Arterioscle Thromb Vasc Biol. 2000;20:2441–2447. doi: 10.1161/01.atv.20.11.2441. [DOI] [PubMed] [Google Scholar]
- 12.Chen Q, Reis SE, Kammerer CM, McNamara DM, Holubkov R, Sharaf BL, Sopko G, Pauly DF, Merz CN, Kamboh MI. WISE Study Group Association between the severity of angiographic coronary artery disease and paraoxonase gene polymorphisms in the National Heart, Lung, and Blood Institute-sponsored Women's Ischemia Syndrome Evaluation (WISE) study. Am J Hum Genet. 2003;72:13–22. doi: 10.1086/345312. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Précourt LP, Amre D, Denis MC, Lavoie JC, Delvin E, Seidman E, Levy E. The three-gene paraoxonase family: physiologic roles, actions and regulation. Atherosclerosis. 2011;214:20–36. doi: 10.1016/j.atherosclerosis.2010.08.076. [DOI] [PubMed] [Google Scholar]
- 14.Lescai F, Marchegiani F, Franceschi C. PON1 is a longevity gene: results of a meta-analysis. Aging Res Rev. 2009;8:277–284. doi: 10.1016/j.arr.2009.04.001. [DOI] [PubMed] [Google Scholar]
- 15.Blatter MC, James RW, Messmer S, Barja F, Pometta D. Identification of a distinct human high-density lipoprotein subspecies defined by a lipoprotein-associated protein, K-45: identity of K-45 with paraoxonase. Eur J Biochem. 1993;211:871–879. doi: 10.1111/j.1432-1033.1993.tb17620.x. [DOI] [PubMed] [Google Scholar]
- 16.Fong CS, Cheng CW, Wu RM. Pesticides exposure and genetic polymorphism of paraoxonase in the susceptibility of Parkinson's disease. Acta Neurol Taiwan. 2005;14:55–60. [PubMed] [Google Scholar]
- 17.Kondo I, Yamamoto M. Genetic polymorphism of paraoxonase 1 (PON1) and susceptibility to Parkinson's disease. Brain Res. 1998;806:271–273. doi: 10.1016/s0006-8993(98)00586-1. [DOI] [PubMed] [Google Scholar]
- 18.Cellini E, Tedde A, Bagnoli S, Nacmias B, Piacentini S, Bessi V, Bracco L, Sorbi S. Association analysis of the paraoxonase-1 gene with Alzheimer's disease. Neurosci Lett. 2006;408:199–202. doi: 10.1016/j.neulet.2006.08.074. [DOI] [PubMed] [Google Scholar]
- 19.Leduc V, Poirier J. Polymorphisms at the paraoxonase 1 L55M and Q192R loci affect the pathophysiology of Alzheimer's disease: emphasis on the cholinergic system and beta-amyloid levels. Neurodegener Dis. 2008;5:225–227. doi: 10.1159/000113709. [DOI] [PubMed] [Google Scholar]
- 20.Humbert R, Adler DA, Disteche CM, Hassett C, Omiecinski CJ, Furlong CE. The molecular basis of the human serum paraoxonase activity polymorphism. Nat Genet. 1993;3:73–76. doi: 10.1038/ng0193-73. [DOI] [PubMed] [Google Scholar]
- 21.Pola R, Flex A, Ciaburri M, Rovella E, Valiani A, Reali G, Silveri MC, Bernabei R. Responsiveness to cholinesterase inhibitors in Alzheimer's disease: a possible role for the 192 Q/R polymorphism of the PON-1 gene. Neurosci Lett. 2005;382:338–341. doi: 10.1016/j.neulet.2005.03.027. [DOI] [PubMed] [Google Scholar]
- 22.Pi Y, Zhang L, Chang K, Li B, Guo L, Fang C, Gao C, Wang J, Xiang J, Li J. Lack of an association between Paraoxonase 1 gene polymorphisms (Q192R, L55M) and Alzheimer's disease: a meta-analysis. Neurosci Lett. 2012;523:174–179. doi: 10.1016/j.neulet.2012.06.071. [DOI] [PubMed] [Google Scholar]
- 23.He XM, Zhang ZX, Zhang JW, Zhou YT, Tang MN, Wu CB, Hong Z. Gln192Arg polymorphism in paraoxonase 1 gene is associated with Alzheimer disease in a Chinese Han ethnic population. Chin Med J (Engl) 2006;119:1204–1209. [PubMed] [Google Scholar]
- 24.Scacchi R, Gambina G, Martini MC, Broggio E, Vilardo T, Corbo RM. Different pattern of association of paraoxonase Gln192->Arg polymorphism with sporadic late-onset Alzheimer's disease and coronary artery disease. Neurosci Lett. 2003;339:17–20. doi: 10.1016/s0304-3940(02)01437-4. [DOI] [PubMed] [Google Scholar]
- 25.Chapuis J, Boscher M, Bensemain F, Cottel D, Amouyel P, Lambert JC. Association study of the paraoxonase 1 gene with the risk of developing Alzheimer's disease. Neurobiol Aging. 2009;30:152–156. doi: 10.1016/j.neurobiolaging.2007.05.021. [DOI] [PubMed] [Google Scholar]
- 26.Erlich PM, Lunetta KL, Cupples LA, Huyck M, Green RC, Baldwin CT, Farrer LA. MIRAGE Study Group Polymorphisms in the PON gene cluster are associated with Alzheimer disease. Hum Mol Genet. 2006;15:77–85. doi: 10.1093/hmg/ddi428. [DOI] [PubMed] [Google Scholar]
- 27.Pola R, Gaetani E, Flex A, Gerardino L, Aloi F, Flore R, Serricchio M, Pola P, Bernabei R. Lack of association between Alzheimer's disease and Gln-Arg 192 Q/R polymorphism of the PON-1 gene in an Italian population. Dement Geriatr Cogn Disord. 2003;15:88–91. doi: 10.1159/000067975. [DOI] [PubMed] [Google Scholar]
- 28.Shi JJ, Zhang SZ, Ma C, Tang MN, Liu XH, Wang YC, Han HY, Guo YB, Feng RM, Miao GD. Gln192Arg polymorphism of the paraoxonase-1 gene is not associated with Alzheimer's disease in Chinese. Di Yi Jun Yi Da Xue Xue Bao. 2004;24:371–374. [PubMed] [Google Scholar]
- 29.Sodeyama N, Yamada M, Itoh Y, Suematsu N, Matsushita M, Otomo E, Mizusawa H. No association of paraoxonase gene polymorphism with atherosclerosis or Alzheimer's Disease. Neurology. 1999;53:1146–1148. doi: 10.1212/wnl.53.5.1146. [DOI] [PubMed] [Google Scholar]
- 30.Paragh G, Balla P, Katona E, Seres I, Egerhazi A, Degrell I. Serum paraoxonase activity changes in patients with Alzheimer's disease and vascular dementia. Eur Arch Psychiatry Clin Neurosci. 2002;252:63–67. doi: 10.1007/s004060200013. [DOI] [PubMed] [Google Scholar]
- 31.Dantoine TF, Drouet M, Debord J, Merle L, Cogne M, Charmes JP. Paraoxonase 1 192/55 gene polymorphisms in Alzheimer's disease. Ann NY Acad Sci. 2002;977:239–244. doi: 10.1111/j.1749-6632.2002.tb04821.x. [DOI] [PubMed] [Google Scholar]
- 32.Helbecque N, Cottel D, Codron V, Berr C, Amouyel P. Paraoxonase 1 gene polymorphisms and dementia in humans. Neurosci Lett. 2004;358:41–44. doi: 10.1016/j.neulet.2003.12.100. [DOI] [PubMed] [Google Scholar]
- 33.Zuliani G, Ble' A, Zanca R, Munari MR, Zurlo A, Vavalle C, Atti AR, Fellin R. Genetic polymorphisms in older subjects with vascular or Alzheimer's dementia. Acta Neurol Scand. 2001;103:304–308. doi: 10.1034/j.1600-0404.2001.103005304.x. [DOI] [PubMed] [Google Scholar]
- 34.McKhann G, Drachman D, Folstein M, Katzman R, Price D, Stadlan EM. Clinical diagnosis of Alzheimer's disease: report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer's disease. Neurology. 1984;34:939–944. doi: 10.1212/wnl.34.7.939. [DOI] [PubMed] [Google Scholar]
- 35.Roman GC, Tatemichi TK, Erkinjuntti T, et al. Vascular dementia: diagnostic criteria for research studies. Report of the NINDS-AIREN International Workshop. Neurology. 1993;43:250–260. doi: 10.1212/wnl.43.2.250. [DOI] [PubMed] [Google Scholar]
- 36.McKeith IG, Dickson DW, Lowe J, et al. Diagnosis and management of dementia with Lewy bodies: third report of the DLB Consortium. Neurology. 2005;65:1863–1872. doi: 10.1212/01.wnl.0000187889.17253.b1. [DOI] [PubMed] [Google Scholar]
- 37.McKhann GM, Albert MS, Grossman M, Miller B, Dickson D, Trojanowski JQ. Work Group on Frontotemporal Dementia and Pick's Disease Clinical and pathological diagnosis of frontotemporal dementia: report of the Work Group on Frontotemporal Dementia and Pick's Disease. Arch Neurol. 2001;58:1803–1809. doi: 10.1001/archneur.58.11.1803. [DOI] [PubMed] [Google Scholar]
- 38.Folstein MF, Folstein SE, McHugh PR. Mini-Mental State: a practical method for grading the cognitive state of patients for the clinician. J Psychiatr Res. 1975;12:189–198. doi: 10.1016/0022-3956(75)90026-6. [DOI] [PubMed] [Google Scholar]
- 39.Berg L. Clinical dementia rating (letter) Br J Psychiatry. 1982;145:339. [PubMed] [Google Scholar]
- 40.Hughes CP, Berg L, Danziger WL, Coben LA, Martin RL. A new clinical scale for the staging of dementia. Br J Psychiatry. 1982;140:566–572. doi: 10.1192/bjp.140.6.566. [DOI] [PubMed] [Google Scholar]
- 41.Reisberg B, Ferris SH, de Leon MJ, Crook T. Global Deterioration Scale (GDS) Psychopharm Bull. 1988;24:661–663. [PubMed] [Google Scholar]
- 42.Cummings JL. The Neuropsychiatric Inventory: assessing psychopathology in dementia patients. Neurology. 1997;48:S10–S16. doi: 10.1212/wnl.48.5_suppl_6.10s. [DOI] [PubMed] [Google Scholar]
- 43.Kaufer DI, Cummings JL, Ketchel P, Smith V, MacMillan A, Shelley T, Lopez OL, DeKosky ST. Validation of the NPI-Q, a brief clinical form of the neuropsychiatric inventory. J Neuropsy Clin Neurosci. 2000;12:233–239. doi: 10.1176/jnp.12.2.233. [DOI] [PubMed] [Google Scholar]
- 44.Bucks RS, Ashworth DL, Wilcock GK, Siegfried K. Assessment of activities of daily living in dementia: development of the Bristol Activities of Daily Living Scale. Age Ageing. 1996;25:113–120. doi: 10.1093/ageing/25.2.113. [DOI] [PubMed] [Google Scholar]
- 45.Bednarska-Makaruk ME, Krzywkowski T, Graban A, Lipczynska-Lojkowska W, Bochynska A, Rodo M, Wehr H, Ryqlewicz DK. Paraoxonase 1 (PON1) gene −108C>T and p.Q192R polymorphisms and arylesterase activity of the enzyme in patients with dementia. Folia Neuropathol. 2013;51:111–119. doi: 10.5114/fn.2013.35953. [DOI] [PubMed] [Google Scholar]
- 46.Erlich PM, Lunetta KL, Cupples LA, Abraham CR, Green RC, Baldwin CT, Farrer LA. Serum paraoxonase activity is associated with variants in the PON gene cluster and risk of Alzheimer disease. Neurobiol Aging. 2012;33:1015.e7–e23. doi: 10.1016/j.neurobiolaging.2010.08.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47.Benaraska-Makaruk M, Graba A, Lipczynska-Lojkowska W, Bochynska A, Rodo M, Krzywkowski T, Rygleicz D, Wehr H. Positive correlation of paraoxonase 1 (PON1) activity with serum insulin level and HOMA-IR I dementia: a possible advantageous role of PON1 in dementia development. J Neurol Sci. 2013;324:172–175. doi: 10.1016/j.jns.2012.11.003. [DOI] [PubMed] [Google Scholar]
- 48.Imai Y, Morita H, Kurihara H, Sugiyama T, Kato N, Ebihara A, Hamada C, Kurihara Y, Shindo T, Oh-hashi Y, Yazaki Y. Evidence for association between paraoxonase gene polymorphisms and atherosclerotic disease. Atherosclerosis. 2000;149:435–442. doi: 10.1016/s0021-9150(99)00340-8. [DOI] [PubMed] [Google Scholar]
- 49.Baum L, Ng HK, Woo KS, Tomlinson B, Rainer TH, Chen X, Cheung WS, Chan DK, Thomas GN, Tong CS, Wong KS. Paraoxonase1 gene Q192R polymorphism affects stroke and myocardial infarction risk. Clin Biochem. 2006;39:191–195. doi: 10.1016/j.clinbiochem.2006.01.010. [DOI] [PubMed] [Google Scholar]
- 50.Ranade K, Kirchgessner TG, Iakoubova OA, Devlin JJ, Del Monte T, Vishnupad P, Hui L, Tsuchihashi Z, Sacks FM, Sabatine MS, Braunwald E, White TJ, Shaw PM, Dracopoli NC. Evaluation of the paraoxonases as candidate genes for stroke: Gln192Arg polymorphism in the paraoxonase 1 gene is associated with increased risk of stroke. Stroke. 2005;36:2346–2350. doi: 10.1161/01.STR.0000185703.88944.7d. [DOI] [PubMed] [Google Scholar]
- 51.Voetsch B, Benke KS, Damasceno BP, Siqueira LH, Loscalzo J. Paraoxonase 192 Gln → Arg polymorphism: an independent risk factor for nonfatal arterial ischemic stroke among young adults. Stroke. 2002;33:1459–1464. doi: 10.1161/01.str.0000016928.60995.bd. [DOI] [PubMed] [Google Scholar]
- 52.Kandiah N, Chander R, Zhang A, Yee CC. Cerebral white matter disease is independently associated with BPSD in Alzheimer's disease. J Neurol Sci. 2014;337:162–166. doi: 10.1016/j.jns.2013.11.042. [DOI] [PubMed] [Google Scholar]
- 53.Treiber KA, Lyketsos CG, Corcoran C, Steinberg M, Norton M, Green RC, Rabins P, Stein DM, Welsh-Bohmer KA, Breitner JC, Tschanz JT. Vascular factors and risk for neuropsychiatric symptoms in Alzheimer's disease: the Cache County Study. Int Psychogeriatr. 2008;20:538–553. doi: 10.1017/S1041610208006704. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54.Palmqvist S, Sarwari A, Wattmo C, Bronge L, Zhang Y, Wahlund LO, Nägga K. Association between subcortical lesions and behavioral and psychological symptoms in patients with Alzheimer's disease. Dement Geriatr Cogn Disord. 2001;32:417–423. doi: 10.1159/000335778. [DOI] [PubMed] [Google Scholar]
- 55.Rosenblat M, Hayek T, Hussein K, Aviram M. Decreased macrophage paraoxonase 2 expression in patients with hypercholesterolemia is the result of their increased cellular cholesterol content: effect of atorvastatin therapy. Arterioscler Thromb Vasc Biol. 2004;24:175–180. doi: 10.1161/01.ATV.0000104011.88939.06. [DOI] [PubMed] [Google Scholar]
- 56.Slowik A, Wloch D, Szermer P, Wolkow P, Malecki M, Pera J, Turaj W, Dziedzic T, Klimkowicz-Mrowiec A, Kopec G, Figlewicz DA, Szczudlik A. Paraoxonase 2 gene C311S polymorphism is associated with a risk of large vessel disease stroke in a Polish population. Cerebrovasc Dis. 2007;23:395–400. doi: 10.1159/000101462. [DOI] [PubMed] [Google Scholar]
- 57.Xu X, Hilal S, Collinson SL, Chong EJ, Ikram MK, Venketasubramanian N, Chen CL. Association of magnetic resonance imaging markers of cerebrovascular disease burden and cognition. Stroke. 2015;46:2808–2814. doi: 10.1161/STROKEAHA.115.010700. [DOI] [PubMed] [Google Scholar]