Skip to main content
PMC home page
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2004 Jul 12;101(29):10602–10607. doi: 10.1073/pnas.0404100101

Requirement of matrix metalloproteinase-9 for the transformation of human mammary epithelial cells by Stat3-C

Tobias N Dechow *,†, Laura Pedranzini †, Andrea Leitch †, Kenneth Leslie †, William L Gerald ‡, Irina Linkov ‡, Jacqueline F Bromberg †,§
PMCID: PMC489981  PMID: 15249664

Abstract

Persistently activated Stat3 is found in many different cancers, including ≈60% of breast tumors. Here, we demonstrate that a constitutively activated Stat3 transforms immortalized human mammary epithelial cells and that this oncogenic event requires the activity of matrix metalloproteinase-9 (MMP-9). By immunohistochemical analysis, we observe a positive correlation between strong MMP-9 expression and tyrosine phosphorylated Stat3 in primary breast cancer specimens. These results demonstrate a relationship between activated Stat3 and MMP-9 in breast oncogenesis.

Signal transducer and activator of transcription (STAT) proteins are a family of transcription factors that are normally inactive within the cytoplasm of cells and become activated by tyrosine phosphorylation in response to cytokines and growth factors. Dimerization through reciprocal SH2-phospho-tyrosine interactions of tyrosine-phosphorylated STATs leads to their accumulation in the nucleus where they bind DNA and activate transcription. STAT dimers are dephosphorylated within the nucleus and transported back to the cytoplasm (1). In normal cells, STAT activation is transient whereas, in a large number of primary tumors and cancer-derived cell lines, STAT proteins (in particular Stat3) remain activated by persistently activated tyrosine kinases and/or a decrease in the negative regulators of STAT dephosphorylation (2). Introduction of dominant negative Stat3 or Stat3 antisense oligonucelotides leads to induction of apoptosis, decreased angiogenesis, or growth arrest of cancer-derived cell lines, including breast cancer cells (2, 3). In addition, a constitutively active mutant form of Stat3, Stat3-C, which is dimerized by cysteine-cysteine residues instead of pY-SH2 interactions, can transform immortalized cultured rodent fibroblasts (4). Stat3 is persistently tyrosine phosphorylated (by immunohistochemical and biochemical analyses) in 30–60% of primary breast cancer specimens (3, 5–7), leading us to test whether Stat3-C could mediate transformation of immortalized human mammary epithelial cell lines (HMECs), possibly more relevant to human tumor biology.

We report here that Stat3-C can transform immortalized HMECs and have determined that matrix metalloproteinase-9 (MMP-9) activity is increased in the Stat3-C-containing cell lines and that this activity is required for Stat3-C-mediated anchorage-independent growth.

Experimental Procedures

Cells and Growth Conditions. MCF-10A cells were obtained from the American Type Culture Collection (ATCC). Immortalized HMECs (referred to as HMLHT) and HrasV12-transformed HMLHT cells were obtained from R. A. Weinberg (Massachusetts Institute of Technology, Boston) (8). Stat3-C and v-src-expressing cells were generated by retroviral infection as described (9). Puromycin (2 μg/ml) was added for selection. Cell proliferation was determined after 7 days by using alamarBlue (BioSource International, Camarillo, CA).

Plasmids and Reagents. pBabe-Stat3-C was generated by inserting a BamHI site 3′ of Stat3-C RcCMV (4) and subcloning the BamHI cDNA insert into pBabe-Puro (10). PBabe-vsrc was from H. Hanafusa (Osaka Bioscience Institute, Osaka, Japan). The MMP-9 promoter luciferase pGL2 construct was obtained from M. Seiki (Kanazawa University, Kanazawa, Japan) (11). The MMP-2/9 inhibitor II (Calbiochem) was resuspended in DMSO (50 μM) and subsequently diluted in PBS for further use. Recombinant MMP-9 was obtained from R & D Systems.

Soft Agar Assays. Soft agar assays were performed as described (8). HMLHT cells (2 × 104) and MCF-10A cells (2 × 105) were seeded per six-well in triplicate in 3 ml of top-agar. Colonies were stained with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) (Sigma.)

S.C. Tumorigenicity Assays. Six- to 8-week-old immunocompromised nonobese diabetic (NOD)/severe combined immunodeficient (SCID) mice (Taconic) were γ-irradiated with 300 rad, 4 h before injection to suppress natural killer cell activity. Cells (5 × 106) were harvested, mixed with an equal volume of Matrigel (Becton Dickinson), and injected in the mouse flank. Tumor size was measured once a week. Mice were killed after 10 weeks of observation or after the tumor grew to ≈600 mm3. Nuclear extracts were isolated from the tumors and analyzed for the presence of Stat3-C by anti-Flag Western blots.

Gene Array Analysis. For gene array analysis, see Supporting Materials and Methods, which is published as supporting information on the PNAS web site.

RT-PCR for MMP-9. RT-PCR for MMP-9 was performed by preparation of total RNA with RNeasy (Qiagen, Valencia, CA) followed by RT (Clontech). PCR reactions were performed by using MMP-9 primers (5′-primer GATGCGTGGAGAGTCGAAAT; 3′-primer CACCAAACTGGATGACGATG). GAPDH primers were used for loading control as described (12).

Western Blots, Immunoprecipitation, Zymography, Electrophoretic Mobility-Shift Assay (EMSA), Luciferase, MMP-9 Activity ELISA, and Immunocytochemistry. Cytoplasmic and nuclear extracts were prepared as described (4). Anti-Flag antibody (M2, Sigma) was diluted 1:1,000. MMP-9 antibody (Ab-2, Oncogene Research Products) was used for immunoprecipitations (1:20) and Western blots (1:1,000). Zymograms were performed as described (13, 14). EMSA was carried out as described by using a high-affinity m67 binding probe (4). HMLHT cells (2 × 104/24-well dish) were transiently transfected with 0.4 μg of MMP-9 Luciferase construct and 0.4 μg of either pBabe or pBabe Stat3-C, by using Lipofectamine 2000 (GIBCO/BRL). Luciferase activity (Promega) was measured 24 h later. MMP-9 activity ELISA (Amersham Pharmacia) was conducted according to the manufacturer's instructions. In situ zymography was performed as described (15). HMLHT cells grown on multichamber slides were overlayed with DQ gelatin (100 μg/ml) for 2 h at 37°C, washed, stained with 4′,6-diamidino-2-phenylindole (DAPI), fixed, and analyzed by confocal laser microscopy. Immunocytochemistry was performed by fixing cells in 50:50 acetone:methanol and permeabilized with 0.1% Triton X-100. MMP-9 Ab-1 (Oncogene Research Products) was added overnight at 4°C (1:20).

Immunohistochemistry. Multitissue blocks of formalin-fixed, paraffin-embedded breast cancer tissue (containing four representative 0.6-mm cores) were prepared by using a tissue arrayer, and immunohistochemistry was performed as described (5). Antigen retrieval using citric acid (pH 6.0) at 97°C for 30 min was followed by treatment with 3% H2O2. Phospho-Stat3 (Tyr-705) antibody (Cell Signaling Technology, Beverly, MA) was used at 1:200 dilution. The phospho-peptide used for generating the antibody was used to confirm specificity of antibody binding. MMP-9 antibody (NCL-MMP9, NovoCastra, Newcastle, U.K.) was used at 1:50 dilution. Scoring of the tissue microarray was performed by two independent observers (J.F.B. and T.N.D) with a high correlation between scorers (P < 0.001) for both pStat3 and MMP-9. In order for a tumor to be considered positive for either pStat3 or MMP-9, all four replicates in the tissue array had to have a similar staining intensity; otherwise it was excluded. Statistical analyses were done by using statview (SAS Inst., Cary, NC). The correlation between the scores of both scorers and the relationship between that of pStat3 and MMP-9 were measured by using the χ2 test.

Results

Stat3-C Transforms HMEC Cell Lines. Given the incidence of phosphorylated Stat3 in primary breast cancer specimens, we wished to determine whether the introduction of a constitutively activated version of Stat3 (Stat3-C) was sufficient for mediating transformation of HMECs. For these studies, we used two different immortalized nontransformed HMEC lines. HMECs from reduction mammoplasties were immortalized by introducing both SV40 large-T antigen and the telomerase catalytic subunit (8). MCF-10As are a spontaneously immortalized human breast epithelial cell line mutant in the cdk inhibitor p16 (9). Immortalized HMECs (referred to as HMLHT cells in this article) and MCF-10A cell lines have many of the characteristics of normal breast epithelium and do not form tumors in nude mice nor form colonies in soft agar, but undergo transformation upon the introduction of Ha-ras (8, 16).

Flag-tagged Stat3-C was introduced into MCF-10A and HMLHT cells by retroviral gene transfer, and polyclonal populations were selected. Western blot analysis showed expression of Stat3-C in both MCF-10A and HMLHT cells (Fig. 1A). EMSA of extracts from Stat3-C-expressing cells showed strong binding to a high-affinity Stat3 binding site (m67) in contrast to extracts from cell lines harboring the empty retroviral vector (Fig. 1B). The DNA–protein complex could be supershifted with an anti-Flag antibody but not by an anti-Stat1 antibody (data not shown).

Fig. 1.

Fig. 1.

Open in a new tab

Stat3-C induces tumorigenesis of HMLHT and MCF-10A cells in a dose-dependent manner. (A) Anti-Flag Western blot showing Stat3-C expression in MCF-10A and HMLHT cells expressing pBabe control vector (pB) and pBabe-Stat3-C (pB-3C). (B) EMSA performed with nuclear extracts from cell lines described in A. Stat3-C DNA binding was supershifted with anti-Flag antibody, indicated with a +. (C) Colony formation in soft agar of empty retroviral control (pB) and Stat3-C infected (pB-3C) MCF-10A and HMLHT cells (mean ± SD). (D) Tumor growth in nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice when using the HMLHT pBabe control cell line and subclones with high Stat3-C expression levels (no. 16 and no. 24) or low Stat3-C expression (3CL). Results are expressed as the mean of 4–10 tumors ± SD at the indicated times after injection. (E) Nuclear extracts from a Stat3-C-derived tumor (tu), normal murine breast tissue (nbr), and cell line no. 16 (+con) were analyzed for the presence of Stat3-C by Flag immunoblot.

A classical assay for cellular transformation is anchorage-independent growth. Control and Stat3-C-expressing MCF-10A and HMLHT cells were plated in soft agar, and colony formation after 3 weeks by Stat3-C-expressing cell lines but not control lines was evident (Fig. 1C).

To determine whether the amount of Stat3-C expressed influenced the efficiency of transformation, single clones were isolated, and DNA-binding assays were carried out. Low (L) and high (H) Stat3-C-expressing clones were isolated and compared with the heterogeneous population (pB-3C) (see Fig. 6A, which is published as supporting information on the PNAS web site). Cells expressing low levels of Stat3-C did not grow in soft-agar, whereas higher expression levels (H) showed colony formation suggesting that a threshold amount of Stat3-C is required for soft-agar growth (see Fig. 6B).

Two high-expressing Stat3-C clones (no. 24 and no. 16) were injected s.c. into the flank of irradiated nonobese diabetic/severe combined immunodeficient (NOD/SCID) mice and gave rise to tumors in all animals in contrast to cells bearing the empty retroviral vector or a low-expressing clone (L) (Fig. 1D). The presence of Stat3-C within the tumor was determined by anti-Flag Western blot analysis (Fig. 1E). Thus, Stat3-C can mediate transformation of immortalized human breast epithelial cells. This finding is an extension of our previous report that Stat3-C induced transformation of immortalized murine fibroblasts (4).

Stat3-C Induced Gene Expression. It is logical that the mechanism(s) by which this persistently active transcription factor mediates cellular transformation is through activation of specific genes. We next wished to identify differentially expressed mRNAs in Stat3-C-containing HMLHT and MCF-10A cells. By RT-PCR analysis of mRNA, Cyclin D1, Bcl-xL, myc, and vascular endothelial growth factor (VEGF), known target genes of activated Stat3 in fibroblasts, were not increased in the Stat3-C-expressing cell lines compared with those bearing the empty retroviral vector (data not shown). Thus, Affymetrix Gene Chip Analysis was performed on RNA isolated from HMLHT-Stat3-C and MCF-10A-Stat3-C cell lines compared with their respective, vector-infected control cells. One hundred and forty-one mRNAs were up-regulated, and 63 were down-regulated in the HMLHT-Stat3-C-expressing cells compared with HMLHT cells containing the empty retroviral vector; and 163 mRNAs were up-regulated and 36 were down-regulated in the MCF-10A-Stat3-C cells compared with MCF-10A cells bearing the empty vector (2-fold, P < 0.001). We then determined those mRNAs that were up- or down-regulated in both Stat3-C-expressing cell lines. Twenty-three mRNAs were increased, and one decreased in both cell lines (see Tables 1–3, which are published as supporting information on the PNAS web site). Some transcripts were increased by >8-fold in at least one of the Stat3-C-containing cell lines. However, the importance of these transcripts in tumorigenesis has not been well documented. One of the mRNAs up-regulated in both of the Stat3-C-expressing cell lines was MMP-9 (2.6- to 4-fold induction). Given the role of MMP-9 in tumor formation, invasion, metastasis, and angiogenesis (17), we focused our attention on this gene as possibly relevant to Stat3-C-mediated transformation in these breast epithelial cells.

MMP-9 Is Expressed and Zymographically Active in Stat3-C-Expressing HMEC Lines. Relative levels of MMP-9 mRNA were determined by RT-PCR in MCF-10A and HMLHT cells and found to be increased in the Stat3-C-expressing cells compared with empty retroviral vector-containing cells (Fig. 2A). To evaluate possible transcriptional regulation of MMP-9 by Stat3-C, we transiently transfected a luciferase construct containing the human MMP-9 promoter (with two potential Stat3-binding sites) with either empty vector or Stat3-C into HMLHT cells. Stat3-C expression led to a 4-fold increase of MMP-9 promoter-driven luciferase activity in HMLHT cells (Fig. 2B). MMP-9 (gelatinase B) is secreted as a 92-kDa pro-enzyme and cleaved by other proteases to an activated 84-kD form. By immunoprecipitation and Western blotting, latent MMP-9 protein was increased in the cell culture medium from Stat3-C-expressing HMLHT and MCF-10A cells compared with that in the medium from their respective control cell lines (Fig. 7A, which is published as supporting information on the PNAS web site). MMP-9 and MMP-2 (gelatinase B and A) are the two major gelatinases produced by cells. An increase in the latent 92-kDa MMP-9 was observed in the cell culture medium from Stat3-C-expressing cells compared with that from control-infected cells by gelatin zymography (Fig. 2C). The latent form of MMP-9 is active zymographically due to the denaturing conditions of SDS/PAGE, which reveals the catalytic domain of MMP-9. Notably, gelatin zymography did not reveal any 72-kDa, MMP-2 activity. Moreover, Stat3-C protein levels in HMLHT cells positively correlated with latent MMP-9 expression as determined by gelatin zymography (Fig. 7B). Thus, an increase of only the latent form of MMP-9 is observed in the cell culture medium of Stat3-C-expressing MCF-10A and HMLHT cells.

Fig. 2.

Fig. 2.

Open in a new tab

Stat-3C-dependent induction of MMP-9 mRNA, luciferase activity, and protein. (A) Induction of MMP-9 mRNA in pBabe-Stat3-C (pB-3C)- and pBabe (pB)-infected MCF-10A and HMLHT cells determined by RT-PCR (Upper), normalized to GAPDH (Lower). (B) HMLHT cells were transfected with an MMP-9 promoter luciferase construct in conjunction with either pBabe (pB)- or pB Stat3-C (3-C)-expressing plasmids. Luciferase activities are shown as the mean ± SD of three experiments performed in duplicate. (C) MMP-9 protein expression in cell culture medium from pBabe (pB)- and pBabe-Stat3-C (pB-3C)-infected MCF-10A and HMLHT cells shown by gelatin zymography.

Proteolytically Active MMP-9 Is Localized to the Cell Surface of Stat3-C-Containing Cells. A second assay for MMP-9 activity, which measures only cleaved (84-kD) protein, showed as expected no extracellular activity in either control or Stat3-C-expressing cells (Fig. 3A, black columns). In this assay, the total MMP-9 activity can be measured by treating the samples with 4-aminophenylmercuric acetate (APMA), which results in the cleavage of the MMP-9 pro-peptide, revealing enzymatically active MMP-9. After APMA treatment, an increase in MMP-9 in the medium from Stat3-C-expressing HMLHT cells was observed (Fig. 3A, gray columns). In contrast, total cell-associated MMP-9 activity was ≈8-fold higher in Stat3-C-expressing HMLHT cells as compared with vector-infected cells (Fig. 3B, black columns). Treatment of these extracts with APMA led to only a modest increase in activity, suggesting that much of the cell-associated MMP-9 is in an enzymatically active form (Fig. 3B, gray columns). We also examined gelatinase activity in situ on cells grown in culture (Fig. 3C). Fluorescein-conjugated gelatin (DQ gelatin) was overlayed on cells, revealing an increase in fluorescence in the Stat3-C-expressing cells compared with control cells, which is a measure of the proteolytic activity of the gelatinase (Fig. 3C Upper). Furthermore, this activity was reduced in the presence of a dual specific MMP-2/9 enzymatic inhibitor, an N-sulfonylamino acid derivative that chelates zinc at the active site and inhibits MMP-2/9-dependent invasion, tumor growth, and metastasis in both cell culture and mouse tumor models (18, 19) (Fig. 3C Lower). Given the lack of MMP-2 expression in the Stat3-C-containing HMLHT cells as determined by zymography (Fig. 2C), we felt that this inhibitor was appropriate for the assay. The cellular localization of MMP-9 was examined by immunocytochemistry and was found to be predominantly in a membrane-associated distribution (Fig. 3D).

Fig. 3.

Fig. 3.

Open in a new tab

Active MMP-9 is localized to the cell surface. (A and B) An ELISA specific for enzymatically active MMP-9 was performed on cell culture medium (A) and cell extracts (B) from pBabe (pB)- and pBabe-Stat3-C (pB-3C)-expressing cells. MMP-9 activity from cell culture medium and cell extracts was measured without (black columns) and with pretreatment with APMA (gray columns). Results are shown as the mean ± SD of three experiments performed in duplicate. (C) In situ zymography of HMLHT cells expressing pBabe and pBabe-Stat3-C (pB-3-C) treated with DMSO (Upper) or 1.5 μM MMP-2/9 inhibitor (Lower). The cells were then overlayed with DQ gelatin. Green staining indicates MMP-9-digested gelatin whereas blue indicates nuclear staining [4′,6-diamidino-2-phenylindole (DAPI)]. (D) MMP-9 expression shown by immunofluorescence in the cell lines described in C.

Inhibition of MMP-9 Reduces Stat3-C-Dependent Transformation in HMLHT Cells. To determine whether the enzymatic activity of MMP-9 contributes to Stat3-C-induced anchorage-independent growth of HMLHT cells, a polyclonal population of Stat3-C-expressing cells and a high Stat3-C-expressing clone (data not shown) were grown in soft agar in the presence of the MMP-2/9 inhibitor. Colony formation was attenuated in the presence of increasing concentrations of the MMP-2/9 inhibitor (Fig. 4A). The MMP-2/9 inhibitor did not influence the proliferation of Stat3-C-expressing HMLHT cells grown in monolayer culture (see Fig. 8, which is published as supporting information on the PNAS web site). Specificity of the MMP-2/9 inhibitor was examined in HMLHT cells transformed by either v-src or H-rasV12. Colony formation of HMLHT cells expressing v-src, an oncogene that activates Stat3 and requires Stat3 for its transforming capacity (20, 21), was suppressed by 1.5 μM MMP-2/9 inhibitor (Fig. 4A). In contrast, H-rasV12-induced anchorage-independent growth of HMLHT cells was not affected by 1.5 μM inhibitor (Fig. 4A). Gelatin zymography revealed high levels of latent MMP-9 in the medium of v-src-transformed HMLHT cells whereas the cell culture medium from H-rasV12-expressing cells did not have any detectable MMP-9 but did contain increased MMP-2 levels (Fig. 4B). These results demonstrate that MMP-9 activity is required for anchorage-independent growth of HMLHT cells induced by Stat3-C and v-src but not by H-rasV12.

Fig. 4.

Fig. 4.

Open in a new tab

MMP-9 activity is required for Stat-3C-dependent anchorage-independent growth. (A) Anchorage-independent growth of pBabe-Stat3-C cells (pB-3C)-, pBabe v-src (pB-src)-, and pBabe H-ras V12 (pB-ras)-expressing HMLHT cells. DMSO (D) control and increasing concentrations of MMP-2/9 inhibitor in μM were added to the soft agar assay every other day (mean ± SD). (B) Gelatin zymography of supernatants derived from HMLHT cells expressing either pBabe (pB), pBabe-Stat3-C (3C), pBabe v-src (src), or pBabe H-ras V12 (ras) and 0.5 ng of recombinant MMP-9 as a loading control.

MMP-9 Expression Correlates with That of Activated Stat3 in Primary Breast Cancer Specimens. Immunohistochemical analysis of microtissue arrays of primary human breast cancer specimens (34 tumor specimens and 8 normal) shows that 27% contain high levels (+++) of nuclear phospho-Stat3 (pStat3), 30% contain moderate levels of nuclear pStat3 (++), and 42% contain little to no pStat3 (0/+) (Fig. 5). Normal breast has little to no pStat3 (Fig. 5. Bottom). It has been determined that MMP-9 is overexpressed in primary breast carcinomas by immunohistochemistry (22–26). The cellular distribution of MMP-9 protein in paraffin sections is typically cytoplasmic (23–27). We stained sequential, serial sections of the breast microtissue arrays with anti-sera to MMP-9 and observed a strong cytoplasmic and perinuclear staining in 27% of these tumor specimens (+++), moderate staining in 32% (++), and no to little staining in 38%(0/+) (Fig. 5). The majority of the MMP-9 staining was specific to the epithelial cells. However, the stromal cells surrounding the epithelial cells were also positive in two samples (data not shown). Not all samples that stained positively for pStat3 were also positive for MMP-9. However, a statistically positive correlation was observed between (+++/++) staining for pStat3 and MMP-9 (P < 0.001).

Fig. 5.

Fig. 5.

Open in a new tab

Persistently phosphorylated Stat3 correlates with MMP-9 expression in primary breast cancer samples. Immunohistochemistry was performed on sequential sections of 34 primary breast cancer microtissue arrays with antiphospho-Stat3 (pStat3) and anti-MMP-9 antibodies. A schematic overview of the tissue arrays and a summary of the immunohistochemistry results are shown. Representative sections of strong staining are indicated as +++ and shaded in black, moderate staining as ++ and shaded in gray, and weak to no staining as 0/+ and shaded in white. Normal breast had 0/+ staining for both pStat3 and MMP-9. A positive correlation was observed between (+++/++) staining for pStat3 and MMP-9 (P < 0.001) by χ2 test.

Discussion

Breast carcinogenesisis is a process dependent upon the loss of tumor suppressors and gain of oncogenes. Our data suggest that activated Stat3 plays a role in breast tumorigenesis in part through the actions of MMP-9. Stat3 is persistently activated in a large fraction of primary breast cancers both by biochemical and immunohistochemical analyses (3, 5–7). Here, we demonstrate, by using two immortalized breast epithelial cell lines used to define oncogenes involved in breast tumorigenesis, the sufficiency of Stat3-C in mediating transformation. We also determined that a threshold amount of Stat3-C is required for growth in soft agar and in nude mice.

Further characterization of Stat3-C-expressing MCF-10A and HMLHT cells did not reveal any significant differences in growth rate, growth-factor requirement, or resistance to proapoptotic stimuli (data not shown). The mechanism of transformation by Stat3-C is proposed to be through the genes it transcriptionally regulates. Some of the known targets of Stat3-C in fibroblasts were not altered in the breast epithelial cell lines. Transcriptional regulation of genes by activated Stat3 is likely dependent upon the cellular context and thus the mechanism of transformation. By Affymetrix Gene Chip analysis a short list of transcripts were identified (and many confirmed by RT/PCR) that were commonly up- or down-regulated in the Stat3-C-transformed cell lines (data not shown). Some of these transcripts may be involved in Stat3-C-mediated transformation, but we focused our attention on MMP-9.

By immunohistochemistry of cancer specimens, MMPs and in particular gelatinases have been found to be up-regulated in almost every tumor entity, including breast cancer (22–28). Cell culture and mouse experiments with mammary epithelial cells and cancer cells have revealed a crucial role for MMP-9 in tumor growth, invasion, metastasis, and angiogenesis (29–32). Many molecules and signaling pathways have been reported to be involved in the induction of MMP-9 in breast cancer cells, such as heregulin, estrogen, epidermal growth factor (EGF), c-jun, NF-κB, and mitogen-activated protein kinase (MAPK) (28, 33–37). In addition to tumor-derived MMP expression, it is largely accepted that the tumor environment plays a crucial role in the activity of MMPs (17). Nevertheless, it has been demonstrated that expression of MMP-3/Stromelysin-1 is sufficient to transform mammary epithelial cells in culture as well as in a breast-specific transgenic mouse model, demonstrating an oncogenic potential of MMPs produced by epithelial cells (39).

Here, we show that MMP-9 mRNA and protein can be induced by Stat3-C in mammary epithelial cells. The MMP-9 promoter contains multiple putative Stat3-binding sites, two of which can be considered as high-affinity binding sites (11). However, a direct association between Stat3 and the MMP-9 promoter by chromatin immunoprecipitation has not been observed (data not shown). Nevertheless, an MMP-9 promoter luciferase construct (-670) is induced at least 4-fold by Stat3-C when transfected into HMLHT cells. We observed an increase in the levels of latent MMP-9 protein from conditioned media isolated from cells expressing Stat3-C. Furthermore, we demonstrated that proteolytically active MMP-9 is localized primarily to the cell surface, which is in accordance with prior studies supporting a role for cell surface-associated MMP-9 with respect to its enzymatic and biological activity (13, 14, 39). By using a dual-specific MMP-2/9 inhibitor, we observed suppression of anchorage-independent growth of Stat3-C and v-src (an oncogene that activates and requires Stat3 for transformation)-expressing cells but not of H-rasV12-transformed HMLHT cells. Thus, this inhibitor does not decrease growth in soft agar nonspecifically and indicates a crucial role for MMP-9 in anchorage-independent growth by Stat3-C and v-src in HMLHT cells.

We have examined the abundance and distribution of tyrosinephosphorylated Stat3 in primary breast cancer samples and find that ≈30% of the invasive tumors have strong staining for nuclear tyrosine phosphorylated Stat3. We did not have access to prognostic information with our tissue-array samples and therefore cannot say whether strong nuclear phospho-Stat3 is associated with indolent or aggressive breast cancer. Interestingly, high MMP-9 protein levels in sequential sections of the tissue micro arrays correlates with that of activated Stat3, supporting our cell culture work that MMP-9 induced by Stat3 may contribute to mammary tumorigenesis.

Supplementary Material

Supporting Information
pnas_101_29_10602__.html (3.2KB, html)

Acknowledgments

We thank James Darnell for helpful discussions, Robert Weinberg for cell lines, and Agnes Viale for assistance with Affymetrix analysis. This work was supported by National Institutes of Health Grant R01 CA87637, Department of Defense Concept Award BC996273, the Speaker's Fund for Biomedical Research, a Charles E. Culpeper Scholarship Award, a Lerner Research Award (to J.F.B.), and a Deutsche Krebshilfe eingetragener Verein postdoctoral fellowship (to T.N.D.).

Abbreviations: STAT, signal transducer and activator of transcription; MMP-9, matrix metalloproteinase-9; HMEC, human mammary epithelial cells; EMSA, electrophoretic mobility-shift assay; APMA, 4-aminophenylmercuric acetate.

References

  • 1.Darnell, J. E., Jr. (1997) Science 277, 1630–1635. [DOI] [PubMed] [Google Scholar]
  • 2.Bromberg, J. (2002) J. Clin. Invest. 109, 1139–1142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Garcia, R., Bowman, T. L., Niu, G., Yu, H., Minton, S., Muro-Cacho, C. A., Cox, C. E., Falcone, R., Fairclough, R., Parsons, S., et al. (2001) Oncogene 20, 2499–2513. [DOI] [PubMed] [Google Scholar]
  • 4.Bromberg, J., Wrzeszczynska, M., Devgan, G., Zhao, Y., Albanese, C., Pestell, R. & Darnell, J. E. J. (1999) Cell 98, 295–303. [DOI] [PubMed] [Google Scholar]
  • 5.Dolled-Filhart, M., Camp, R. L., Kowalski, D. P., Smith, B. L. & Rimm, D. L. (2003) Clin. Cancer Res. 9, 594–600. [PubMed] [Google Scholar]
  • 6.Widschwendter, A., Tonko-Geymayer, S., Welte, T., Daxenbichler, G., Marth, C. & Doppler, W. (2002) Clin. Cancer Res. 8, 3065–3074. [PubMed] [Google Scholar]
  • 7.Watson, C. J. & Miller, W. R. (1995) Br. J. Cancer 71, 840–844. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Elenbaas, B., Spirio, L., Koerner, F., Fleming, M. D., Zimonjic, D. B., Donaher, J. L., Popescu, N. C., Hahn, W. C. & Weinberg, R. A. (2001) Genes Dev. 15, 50–65. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Soule, H. D., Maloney, T. M., Wolman, S. R., Peterson, W. D., Jr., Brenz, R., McGrath, C. M., Russo, J., Pauley, R. J., Jones, R. F. & Brooks, S. C. (1990) Cancer Res. 50, 6075–6086. [PubMed] [Google Scholar]
  • 10.Morgenstern, J. P. & Land, H. (1990) Nucleic Acids Res. 18, 3587–3596. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Sato, H. & Seiki, M. (1993) Oncogene 8, 395–405. [PubMed] [Google Scholar]
  • 12.Yang, E., Wen, Z., Haspel, R. L., Zhang, J. J. & Darnell, J. E., Jr. (1999) Mol. Cell. Biol. 19, 5106–5112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Fiore, E., Fusco, C., Romero, P. & Stamenkovic, I. (2002) Oncogene 21, 5213–5223. [DOI] [PubMed] [Google Scholar]
  • 14.Yu, Q. & Stamenkovic, I. (1999) Genes Dev. 13, 35–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mira, E., Lacalle, R. A., Buesa, J. M., Gonzalez de Buitrago, G., Jimenez-Baranda, S., Gomez-Mouton, C., Martinez, A. C. & Manes, S. (2003) J. Cell Sci. 117, 1847–1856. [DOI] [PubMed] [Google Scholar]
  • 16.Ciardiello, F., Gottardis, M., Basolo, F., Pepe, S., Normanno, N., Dickson, R. B., Bianco, A. R. & Salomon, D. S. (1992) Mol. Carcinog. 6, 43–52. [DOI] [PubMed] [Google Scholar]
  • 17.Egeblad, M. & Werb, Z. (2002) Nat. Rev. Cancer 2, 161–174. [DOI] [PubMed] [Google Scholar]
  • 18.Wroblewski, L. E., Pritchard, D. M., Carter, S. & Varro, A. (2002) Biochem. J. 365, 873–879. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Tamura, Y., Watanabe, F., Nakatani, T., Yasui, K., Fuji, M., Komurasaki, T., Tsuzuki, H., Maekawa, R., Yoshioka, T., Kawada, K., et al. (1998) J. Med. Chem. 41, 640–649. [DOI] [PubMed] [Google Scholar]
  • 20.Bromberg, J. F., Horvath, C. M., Besser, D., Lathem, W. W. & Darnell, J. E., Jr. (1998) Mol. Cell. Biol. 5, 2553–2558. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Turkson, J., Bowman, T., Garcia, R., Caldenhoven, E., De Groot, R. P. & Jove, R. (1998) Mol. Cell. Biol. 18, 2545–2552. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Giannelli, G., Fransvea, E., Marinosci, F., Bergamini, C., Daniele, A., Colucci, S., Paradiso, A., Quaranta, M. & Antonaci, S. (2002) Biochem. Biophys. Res. Commun. 292, 161–166. [DOI] [PubMed] [Google Scholar]
  • 23.Hanemaaijer, R., Verheijen, J. H., Maguire, T. M., Visser, H., Toet, K., McDermott, E., O'Higgins, N. & Duffy, M. J. (2000) Int. J. Cancer 86, 204–207. [DOI] [PubMed] [Google Scholar]
  • 24.Iwata, H., Kobayashi, S., Iwase, H., Masaoka, A., Fujimoto, N. & Okada, Y. (1996) Jpn. J. Cancer Res. 87, 602–611. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Jones, J. L., Glynn, P. & Walker, R. A. (1999) J. Pathol. 189, 161–168. [DOI] [PubMed] [Google Scholar]
  • 26.Scorilas, A., Karameris, A., Arnogiannaki, N., Ardavanis, A., Bassilopoulos, P., Trangas, T. & Talieri, M. (2001) Br. J. Cancer 84, 1488–1496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Bodey, B., Bodey, B., Jr., Siegel, S. E. & Kaiser, H. E. (2001) Anticancer Res. 21, 2021–2028. [PubMed] [Google Scholar]
  • 28.Kondapaka, S. B., Fridman, R. & Reddy, K. B. (1997) Int. J. Cancer 70, 722–726. [DOI] [PubMed] [Google Scholar]
  • 29.Weber, M. H., Lee, J. & Orr, F. W. (2002) Int. J. Oncol. 20, 299–303. [PubMed] [Google Scholar]
  • 30.Li, H., Lindenmeyer, F., Grenet, C., Opolon, P., Menashi, S., Soria, C., Yeh, P., Perricaudet, M. & Lu, H. (2001) Hum. Gene. Ther. 12, 515–526. [DOI] [PubMed] [Google Scholar]
  • 31.Mira, E., Manes, S., Lacalle, R. A., Marquez, G. & Martinez, A. C. (1999) Endocrinology 140, 1657–1664. [DOI] [PubMed] [Google Scholar]
  • 32.Yu, Q. & Stamenkovic, I. (2000) Genes Dev. 14, 163–176. [PMC free article] [PubMed] [Google Scholar]
  • 33.Reddy, K. B., Krueger, J. S., Kondapaka, S. B. & Diglio, C. A. (1999) Int. J. Cancer 82, 268–273. [DOI] [PubMed] [Google Scholar]
  • 34.Ricca, A., Biroccio, A., Del Bufalo, D., Mackay, A. R., Santoni, A. & Cippitelli, M. (2000) Int. J. Cancer 86, 188–196. [DOI] [PubMed] [Google Scholar]
  • 35.Tsai, M. S., Shamon-Taylor, L. A., Mehmi, I., Tang, C. K. & Lupu, R. (2003) Oncogene 22, 761–768. [DOI] [PubMed] [Google Scholar]
  • 36.Smith, L. M., Wise, S. C., Hendricks, D. T., Sabichi, A. L., Bos, T., Reddy, P., Brown, P. H. & Birrer, M. J. (1999) Oncogene 18, 6063–6070. [DOI] [PubMed] [Google Scholar]
  • 37.Razandi, M., Pedram, A., Park, S. T. & Levin, E. R. (2003) J. Biol. Chem. 278, 2701–2712. [DOI] [PubMed] [Google Scholar]
  • 38.Sternlicht, M. D., Lochter, A., Sympson, C. J., Huey, B., Rougier, J. P., Gray, J. W., Pinkel, D., Bissell, M. J. & Werb, Z. (1999) Cell 98, 137–146. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Stamenkovic, I. (2000) Semin. Cancer Biol. 10, 415–433. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information
pnas_101_29_10602__.html (3.2KB, html)
pnas_101_29_10602__2.html (61.6KB, html)
pnas_101_29_10602__3.html (59.6KB, html)
pnas_101_29_10602__4.html (8.3KB, html)
pnas_101_29_10602__1.pdf (890.4KB, pdf)
pnas_101_29_10602__5.pdf (890.4KB, pdf)
pnas_101_29_10602__6.pdf (290.6KB, pdf)

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES