Abstract
Staphylococcus aureus is opportunistic human as well as animal pathogen that causes a variety of diseases. A total of 100 Staphylococcus aureus isolates were obtained from clinical samples derived from hospitalized patients. The presumptive Staphylococcus aureus clinical isolates were identified phenotypically by different biochemical tests. Molecular identification was done by PCR using species specific 16S rRNA primer pairs and finally 100 isolates were found to be positive as Staphylococcus aureus. Screened isolates were further analyzed by several microbiological diagnostics tests including gelatin hydrolysis, protease, and lipase tests. It was found that 78%, 81%, and 51% isolates were positive for gelatin hydrolysis, protease, and lipase activities, respectively. Antibiogram analysis of isolated Staphylococcus aureus strains with respect to different antimicrobial agents revealed resistance pattern ranging from 57 to 96%. Our study also shows 70% strains to be MRSA, 54.3% as VRSA, and 54.3% as both MRSA and VRSA. All the identified isolates were subjected to detection of mecA, nuc, and hlb genes and 70%, 84%, and 40% were found to harbour mecA, nuc, and hlb genes, respectively. The current investigation is highly important and informative for the high level multidrug resistant Staphylococcus aureus infections inclusive also of methicillin and vancomycin.
1. Introduction
Staphylococcus aureus is one of the most harmful species of staphylococci encountered. It is the leading cause of bacteremia, pneumonia, myocarditis, acute endocarditis, pericarditis, osteomyelitis, encephalitis, meningitis, chorioamnionitis, mastitis, and scalded skin syndrome [1]. Human morbidity and mortality in hospital settings are largely caused by staphylococcal bacteremia [2]. The pathogenic capacity of Staphylococcus aureus is clearly dependent on its production of exoproteins and toxins. The species is identified on the basis of a variety of conventional physiological or biochemical characters. The key characters for Staphylococcus aureus are colony pigment, free coagulase, clumping factor, protein A, heat-stable nuclease, lipase, and acid production from mannitol [1]. In addition, Staphylococcus aureus can be identified by PCR methods. 16S rRNA gene is reported to be the most useful and extensively investigated taxonomic marker molecules [3].
Due to excessive and uncontrolled use of antibiotics the organism becomes multidrug resistant leaving few therapeutic options for the treatment against it [4]. The emergence of methicillin-resistant Staphylococcus aureus (MRSA) in hospital-acquired (HA) infections highlights this species as a potential pathogen that is able to cope with the antimicrobial agent [5]. The mecA gene [6, 7] synthesizes penicillin binding protein (PBP2a) and it is the cause of methicillin resistance in MRSA. This gene resides on the staphylococcal cassette chromosome (SCC) [8]. Staphylococcal cassette chromosome is a large genetic mobile element which varies in size and genetic composition among the strains of MRSA [9]. Colonized hospital personnel and infected patients are the main source of MRSA [10]. Knowledge of selection of the antibiotics for treatment is important as antibiotic responsiveness pattern of MRSA may vary from region to region [11]. To treat staphylococcal infections, various classes of antibiotics including beta-lactams, glycopeptides, lipopeptide, oxazolidones, aminoglycosides, macrolides, and fluoroquinolones were used [12–15]. Resistance of staphylococci occurs with a variety of antimicrobial agents as well as vancomycin. Therefore, vancomycin resistance is another problem for the treatment of infections caused by this bacterium [16].
The present work was planned to identify and characterize Staphylococcus aureus isolates collected from postoperative wound swab of male and female patients hospitalized in the various departments of Midnapore Medical College and Hospital, Midnapore, West Bengal, India. The objectives of the present study were to find out the rate of MRSA and vancomycin resistant Staphylococcus aureus (VRSA) in hospital-acquired infections and to determine the antibiotic responsiveness pattern.
2. Materials and Methods
2.1. Bacterial Isolates and Culture Methods
From January 2013 to October 2014, a total of 165 nonduplicate bacterial isolates were collected from the Male Surgical Wards, Orthopedic Ward, and Burn and Wound Section of Midnapore Medical College and Hospital, Midnapore, West Bengal, India. Only strains obtained from a pure culture were included. Only the first strain from each patient was included. All the strains were collected aseptically, transferred into mannitol salt agar (MSA) media, HiMedia (Mumbai), and incubated overnight at 37°C [17].
2.2. Isolation and Phenotypic Identification of Staphylococcus aureus
Each isolated bacterial sample from MSA media was initially evaluated on 5% sheep blood agar and incubated overnight at 37°C. Each culture underwent Gram staining and was tested for production of catalase, free coagulase, yellow pigment, and thermonuclease (TNase), according to Lancette and Tatini [18].
2.3. Molecular Identification through PCR Amplification of 16S rRNA Gene
The bacterial isolates which were found to be Staphylococcus aureus by specific phenotypic features were further tested by PCR for confirmation using specific primer pairs of 16S rRNA (Table 1). These primers amplify 228 bp region of 16S rRNA gene fragment of Staphylococcus aureus, which is highly conserved at species level. PCR programming was begun with an initial denaturation step at 94°C for 2 min followed by 35 cycles of 94°C for 30 sec, 50°C for 30 sec, and 72°C for 45 sec, ending with a final extension step at 72°C for 4 min. S. aureus ATCC 25923 was used as positive control in this experiment.
Table 1.
Primer sequences of 16S rRNA, mecA, nuc, and hlb genes of Staphylococcus aureus.
| Primer | Direction | Sequences (5′-3′) | Amplicon sizes (bp) | Reference |
|---|---|---|---|---|
| 16S rRNA | F | GTA GGT GGC AAG CGT TAT CC | 228 | [19] |
| R | CGCACATCAGCGTCAG | |||
|
| ||||
| mecA | F | GTG AAG ATA TAC CAA GTG ATT | 147 | [20] |
| R | ATG CGC TAT AGA TTG AAA GGA T | |||
|
| ||||
| nuc | F | GCGATTGATGGTGATACGGTT | 270 | [21] |
| R | AGCCAAGCCTTGACGAACTAAAGC | |||
|
| ||||
| hlb | F | GTGCACTTACTGACAATAGTGC | 309 | [22] |
| R | GTTGATGAGTAGCTACCTTCAGT | |||
2.4. Biochemical Characterization of Staphylococcus aureus Strains
The bacterial strains that were confirmed as Staphylococcus aureus by species specific 16S rRNA screening were further analyzed by several microbiological diagnostics tests including mannitol fermentation and growth on high salt concentration, gelatin hydrolysis, urea hydrolysis, protease activity on milk agar medium, lipase production on egg yolk agar medium (HiMedia, Mumbai), and hydrolysis of esculin by standard methods [23–26]. Hemolytic activity was determined on sheep blood agar (15 mL of 5% sheep blood in Trypticase soy agar overlaid on 10 mL of blood agar base) according to Rodgers et al. [27].
2.5. Antibiotic Susceptibility Pattern of Isolated Staphylococcus aureus to Some Antimicrobial Agents and Detection of VRSA
The susceptibility of the Staphylococcus aureus isolates to different antimicrobial agents was done by disk diffusion method using commercial disks obtained from HiMedia, Mumbai [28]. The antimicrobial disks were as follows: ampicillin (30 μg), streptomycin (10 μg), kanamycin (30 μg), erythromycin (10 μg), chloramphenicol (30 μg), cefoxitin (30 μg), nalidixic acid (30 μg), and novobiocin (30 μg). Clinical strains were categorized as susceptible and resistant according to evaluation criteria developed by the Clinical and Laboratory Standards Institute (CLSI) guidelines [29]. To identify VSSA and VRSA, MIC of vancomycin was determined by the microbroth dilution method using the Mueller-Hinton broth according to the Clinical Laboratory Standards Institute guidelines [29]. Staphylococcus aureus ATCC 29213 strains were used as vancomycin-susceptible controls and Enterococcus faecalis ATCC 51299 as vancomycin resistant control.
2.6. Detection of mecA, nuc, and hlb Genes
Staphylococcus aureus isolates were subjected to the detection of mecA, nuc, and hlb genes by PCR using specific primer pairs (Table 1). The amplification was performed in a Thermal Cycler (Eppendorf, Germany) beginning with an initial denaturation step at 95°C for 2 min followed by 35 cycles of 94°C for 1 min, 55°C for 45 sec, 50° for 50 sec, and 52° for 40 sec for mecA, nuc, and hlb gene, respectively, and a common extension for 72°C for 2 min, ending with a final extension step at 72°C for 4 min. For rapid DNA extraction from Staphylococcus aureus one to five bacterial colonies were suspended in 50 μL of sterile Milli Q water (Millipore-Synergy®, India) and heated at 99°C for 10 min in a 500 μL Eppendorf tube. After centrifuge at 14000 r.p.m. for 10 min in a mini centrifuge (Eppendorf, Germany), 2 μL of the supernatant was used as template.
3. Results
In the present study 165 nonduplicate samples were collected from hospitalized patients. Among 165 samples, 100 strains (60.60%) were isolated from a selective MSA media and then these isolates were identified for Staphylococcus aureus by different biochemical tests (Table 2). Gram staining, catalase, coagulase, and thermonuclease were important phenotypic identifying markers of Staphylococcus aureus. In this study we found that 100%, 92%, and 84% isolates were positive for catalase, coagulase, and heat-stable nuclease, respectively (Table 2). All Staphylococcus aureus isolates (100) in this study were confirmed by PCR using the species specific primer pair (Table 1). The enzyme gelatinase was secreted by Staphylococcus aureus liquefy gelatin protein. Present study also showed that 78% of Staphylococcus aureus isolates were able to produce gelatinase. In Table 3, 81%, 51%, and 48% of isolated strains produced protease, lipase, and nonwhite pigmented colonies, respectively. Present study showed that 40% of Staphylococcus aureus isolates were able to produce clearing zone surrounding their growth on blood agar media (Table 4) demonstrating that they can produce hemolysin. Rates of resistance pattern of Staphylococcus aureus ranged from 57 to 96%. Resistance of Staphylococcus aureus isolates to ampicillin (96%), cefoxitin (70%), kanamycin (74%), erythromycin (81%), streptomycin (75%), nalidixic acid (89%), novobiocin (75%), and chloramphenicol (57%) was found (Table 5). All Staphylococcus aureus strains isolated in this study were found to be multidrug resistant. In the present study we have found that the prevalence rate of MRSA is 70%. Our study also found that 54.3% of the isolated Staphylococcus aureus were vancomycin resistant (Table 6) and 54.3% of the methicillin-resistant Staphylococcus aureus were resistant to vancomycin. According to the CLSI guideline [29] strains having a vancomycin MIC of 4–8 μg/mL were vancomycin-intermediate Staphylococcus aureus. Further we had found that 38.6% strains were vancomycin-intermediate Staphylococcus aureus. All phenotypically identified methicillin resistant Staphylococcus aureus (MRSA) strains possessed mecA gene. An extracellular thermostable endonuclease (TNase) which cuts both DNA and RNA was produced by Staphylococcus aureus characterized by its gene nuc specific for Staphylococcus aureus [21]. Eighty-four % strains were found to harbour nuc gene. PCR analysis also revealed 40 strains to carry hlb gene responsible for beta hemolysis.
Table 2.
Phenotypic characteristics for identification of Staphylococcus aureus.
| Source of the isolates | Number of examined samples | Number of S. aureus isolates | Colony pigment | Gram stain Number∗ (%) |
Catalase activity Number∗ (%) |
Coagulase activity Number∗ (%) |
Tnase activity Number∗ (%) |
||
|---|---|---|---|---|---|---|---|---|---|
| White | Creamy | Yellow | |||||||
| Number∗ (%) | Number∗ (%) | Number∗ (%) | |||||||
| Male Surgical Ward | 80 | 45 | 5 (11) | 15 (33) | 25 (55) | 45 (100) | 45 (100) | 42 (93) | 37 (83) |
| Orthopedic Ward | 70 | 50 | 18 (36) | 12 (24) | 20 (40) | 50 (100) | 50 (100) | 45 (90) | 42 (83) |
| Burn and Wound Section | 15 | 5 | 0 (0) | 2 (40) | 3 (60) | 5 (100) | 5 (100) | 5 (100) | 5 (100) |
| Total | 165 | 100 | 23 (23) | 29 (29) | 48 (48) | 100 (100) | 100 (100) | 92 (92) | 84 (84) |
∗Positive number; percentage is presented in parenthesis.
Table 3.
Important biochemical markers of Staphylococcus aureus isolates.
| Source of the isolates | Mannitol fermentation with high salt concentration | Gelatinase activity Number∗ (%) |
Urease activity Number∗ (%) |
Protease activity Number∗ (%) |
Lipase production Number∗ (%) |
Esculin hydrolysis Number∗ (%) |
|---|---|---|---|---|---|---|
| Number∗ (%) | ||||||
| Male Surgical Ward | 45 (100) | 33 (73) | 34 (76) | 36 (80) | 22 (49) | 5 (11) |
| Orthopedic Ward | 50 (100) | 40 (80) | 35 (70) | 41 (82) | 25 (50) | 5 (10) |
| Burn and Wound Section | 5 (100) | 5 (100) | 4 (80) | 4 (80) | 4 (80) | 0 (0) |
| Total | 100 (100) | 78 (78) | 73 (73) | 81 (81) | 51 (51) | 10 (10) |
∗Positive number; percentage is presented in parenthesis.
Table 4.
Hemolytic activity of clinical isolates of Staphylococcus aureus.
| Source of the isolates | Number of examined samples | Alpha | Beta | Gamma |
|---|---|---|---|---|
| Number∗ (%) | Number∗ (%) | Number∗ (%) | ||
| Male Surgical Ward | 45 | 25 (56) | 15 (33) | 5 (11) |
| Orthopedic Ward | 50 | 18 (36) | 20 (40) | 12 (24) |
| Burn and Wound Section | 5 | 0 (0) | 5 (100) | 0 (0) |
| Total | 100 | 43 (43) | 40 (40) | 17 (17) |
∗Positive number; percentage is presented in parenthesis.
Table 5.
Susceptibility and resistance pattern of Staphylococcus aureus to 8 antimicrobial agents.
| Antibiotics | % resistant | % sensitive |
|---|---|---|
| Ampicillin (30 mcg) | 96 | 4 |
| Chloramphenicol (30 mcg) | 57 | 53 |
| Streptomycin (10 mcg) | 75 | 25 |
| Erythromycin (10 mcg) | 81 | 19 |
| Kanamycin (30 mcg) | 74 | 26 |
| Nalidixic acid (30 mcg) | 89 | 11 |
| Novobiocin (30 mcg) | 75 | 25 |
| Cefoxitin (30 mcg) | 70 | 30 |
Table 6.
Minimum inhibitory concentration of vancomycin of Staphylococcus aureus clinical isolates.
| Vancomycin MIC (μg/mL) | MRSA (N = 70) | MSSA (N = 30) | ||||
|---|---|---|---|---|---|---|
| VSSA Number∗ (%) |
VISA Number∗ (%) |
VRSA Number∗ (%) |
VSSA Number∗ (%) |
VISA Number∗ (%) |
VRSA Number∗ (%) |
|
| 0.25 | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
| 0.5 | 3 (4.28) | 0 (0) | 0 (0) | 18 (60) | 0 (0) | 0 (0) |
| 1 | 2 (2.85) | 0 (0) | 0 (0) | 12 (40) | 0 (0) | 0 (0) |
| 2 | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
| 4 | 0 (0) | 10 (14.3) | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
| 8 | 0 (0) | 17 (24.3) | 0 (0) | 0 (0) | 0 (0) | 0 (0) |
| 16 | 0 (0) | 0 (0) | 36 (51.4) | 0 (0) | 0 (0) | 0 (0) |
| 32 | 0 (0) | 0 (0) | 2 (2.9) | 0 (0) | 0 (0) | 0 (0) |
| Total | 5 (7.1) | 27 (38.6) | 38 (54.3) | 30 (100) | 0 (0) | 0 (0) |
∗Positive number; percentage is presented in parenthesis; VSSA: vancomycin-susceptible Staphylococcus aureus; VISA: vancomycin-intermediate Staphylococcus aureus; VRSA: vancomycin resistant Staphylococcus aureus; MRSA: methicillin-resistant Staphylococcus aureus; MSSA: methicillin-susceptible Staphylococcus aureus.
4. Discussion
In the present study a total of one hundred (60.60%) isolates of clinical bacterial samples from Male Surgical Wards, Orthopedic Ward, and Burn and Wound Section of Midnapore Medical College and Hospital, Midnapore, West Bengal, India, were confirmed to be Staphylococcus aureus. Vijayalakshmi [30] reported that a surgical site infection by Staphylococcus aureus has found 43.2% in Hyderabad, India. Gram staining, catalase, coagulase, and thermonuclease were important phenotypic identifying markers of Staphylococcus aureus [1]. In this study we found that 92% isolates were coagulase positive but the rest of the strains were coagulase-negative, though they were found to be Staphylococcus aureus confirmed by PCR analysis using 16S rRNA primers which is specific for this species. This finding is correlated with the findings of Korman [31]. Matthews et al. and Rukumani et al. [32, 33] also found atypical coagulase-negative Staphylococcus aureus from food and clinical specimen, respectively. Sanford et al. [34] reported that most clinical strains of Staphylococcus aureus associated with pneumonia produced thermostable DNase (88%) and protease (94%). Present study showed that 84% and 81% of the clinical strains produce thermostable DNase and protease, respectively. Staphylococcus aureus resistant to methicillin are life threatening bacteria in hospital settings [5]. Studies show that the majority of MRSA strains are associated with hospital-acquired colonization and infections [35]. All Staphylococcus aureus strains isolated in this study were multidrug resistant. PCR amplification of mecA gene was positive in the 70% of isolates. Khan et al. [36] reported that mecA harbouring multidrug resistant Staphylococcus aureus strains were found in hospital personnel in a premier hospital in North India. Prevalence rate of MRSA was 44% in a Tertiary Care Hospital, AIIMS, New Delhi [35]. In the present study we have found that the prevalence rate of MRSA is 70%. This finding is supported by Boucher and Corey [5]. They reported that the frequency of methicillin-resistant Staphylococcus aureus (MRSA) infections increases continuously in hospital-associated infection. Increased prevalence of infection due to MRSA led to the use of glycopeptides for therapeutic purpose [10]. We found that 54.3% of the methicillin-resistant Staphylococcus aureus isolates were also resistant to vancomycin. Vancomycin resistance was also found from intensive care units of tertiary care hospitals in Hyderabad among MRSA isolates [37]. Yaseen et al. [38] reported high prevalence of VRSA among multidrug-resistance MRSA from Al-Jumhuory Teaching Hospital Patients in Mosul, Iraq, and that is similar to our results. Tiwari and Sen [39] also reported the emergence of vancomycin resistant Staphylococcus aureus (VRSA) from the northern part of India. The nuc gene is used for identification for Staphylococcus aureus strains [21]. Among the 100 clinical samples, those that were identified as Staphylococcus aureus 84% were found to be nuc positive. Sahebnasagh et al. [40] found 80.2% isolates to be nuc positive in hospitals of Tehran, Iran. In our study the percentage of hlb gene in Staphylococcus aureus isolates was 40. This study can be compared with the study performed by Rusenova et al. [41] who showed that thirty-one MRSA isolates (42.5%) were positive for beta toxin. Our data though could not cover the entire population; however, at least in the premise of this hospital, it can be said that MRSA and VRSA are prevalent in the hospital environment. Hereby, it is suggested that there should be periodic review of hospital-associated infections including antimicrobial sensitivity testing. It would be helpful in making antibiotic policy for infection control and reducing the incidence of multidrug resistant MRSA and VRSA.
5. Conclusion
The current study depicts the high level of multidrug resistant Staphylococcus aureus infections in Surgical Ward, Orthopedic Ward, and Burn and Wound Section of a hospital environment. The emergence of multidrug resistant forms of pathogenic Staphylococcus aureus is a worldwide problem in clinical medicine. The prevalence of MRSA isolates is increasing in hospital settings and these isolates are more resistant to vancomycin than previously isolated MRSA. A rapid, conventional identification method, based on phenotypic and genotypic characters, is suitable in clinical laboratory procedures.
Acknowledgments
The authors are thankful to all the patients for their cooperation in conducting the study. We also thank Dr. T. K. Pathak, Microbiology Laboratory, Midnapore Medical College and Hospital, for providing clinical samples and strains.
Competing Interests
The authors declare that they have no competing interests.
References
- 1.Murray P. R., Baron E. J., Jorgensen J. H., Pfaller M. A., Yolken R. H. Manual of Clinical Microbiology. 8th. Washington, DC, USA: American Society for Microbiology; 2003. [Google Scholar]
- 2.Klevens R. M., Morrison M. A., Nadle J., et al. Invasive methicillin-resistant Staphylococcus aureus infections in the United States. The Journal of the American Medical Association. 2007;298(15):1763–1771. doi: 10.1001/jama.298.15.1763. [DOI] [PubMed] [Google Scholar]
- 3.Becker K., Harmsen D., Mellmann A., et al. Development and evaluation of a quality-controlled ribosomal sequence database for 16S ribosomal DNA-based identification of Staphylococcus species. Journal of Clinical Microbiology. 2004;42(11):4988–4995. doi: 10.1128/JCM.42.11.4988-4995.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.DeLeo F. R., Otto M., Kreiswirth B. N., Chambers H. F. Community-associated meticillin-resistant Staphylococcus aureus . The Lancet. 2010;375(9725):1557–1568. doi: 10.1016/s0140-6736(09)61999-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Boucher H. W., Corey G. R. Epidemiology of methicillin-resistant Staphylococcus aureus. Clinical Infectious Diseases. 2008;46(supplement 5):S344–S349. doi: 10.1086/533590. [DOI] [PubMed] [Google Scholar]
- 6.Zapun A., Contreras-Martel C., Vernet T. Penicillin-binding proteins and β-lactam resistance. FEMS Microbiology Reviews. 2008;32(2):361–385. doi: 10.1111/j.1574-6976.2007.00095.x. [DOI] [PubMed] [Google Scholar]
- 7.Matsuhashi M., Song M. D., Ishino F., et al. Molecular cloning of the gene of a penicillin-binding protein supposed to cause high resistance to β-lactam antibiotics in Staphylococcus aureus . Journal of Bacteriology. 1986;167(3):975–980. doi: 10.1128/jb.167.3.975-980.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Katayama Y., Ito T., Hiramatsu K. A new class of genetic element, staphylococcus cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus . Antimicrobial Agents and Chemotherapy. 2000;44(6):1549–1555. doi: 10.1128/aac.44.6.1549-1555.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Ito T., Katayama Y., Asada K., et al. Structural comparison of three types of staphylococcal cassette chromosome mec integrated in the chromosome in methicillin-resistant Staphylococcus aureus . Antimicrobial Agents and Chemotherapy. 2001;45(5):1323–1336. doi: 10.1128/aac.45.5.1323-1336.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Rajaduraipandi K., Mani K. R., Panneerselvam K., Mani M., Bhaskar M., Manikandan P. Prevalence and antimicrobial susceptibility pattern of methicillin resistant Staphylococcus aureus: a multicentre study. Indian Journal of Medical Microbiology. 2006;24(1):34–38. doi: 10.4103/0255-0857.19892. [DOI] [PubMed] [Google Scholar]
- 11.Vidhani S., Mehndiratta P. L., Mathur M. D. Study of methicillin resistant S. aureus (MRSA) isolates from high risk patients. Indian Journal of Medical Microbiology. 2001;19(2):13–16. [PubMed] [Google Scholar]
- 12.McDanel J. S., Perencevich E. N., Diekema D. J., et al. Comparative effectiveness of beta-lactams versus vancomycin for treatment of methicillin-susceptible Staphylococcus aureus bloodstream infections among 122 hospitals. Clinical Infectious Diseases. 2015;61(3):361–367. doi: 10.1093/cid/civ308. [DOI] [PubMed] [Google Scholar]
- 13.Pangercić A., Bukovski-Simonoski S., Barsić B. Lipopeptides and oxazolidinones—novel antibiotics in MRSA infection treatment. Liječnički Vjesnik. 2010;132(supplement 1):11–13. [PubMed] [Google Scholar]
- 14.Chambers W. B., Pallagrosi A. U. Gentamicin in the treatment of staphylococcal infections. Journal of International Medical Research. 1977;5(6):442–449. doi: 10.1177/030006057300100211. [DOI] [PubMed] [Google Scholar]
- 15.Cruciani M., Bassetti D. The fluoroquinolones as treatment for infections caused by Gram-positive bacteria. Journal of Antimicrobial Chemotherapy. 1994;33(3):403–417. doi: 10.1093/jac/33.3.403. [DOI] [PubMed] [Google Scholar]
- 16.Van Belkum A., Verbrugh H. 40 Years of methicillin resistant Staphylococcus aureus . The British Medical Journal. 2001;323(7314):644–645. doi: 10.1136/bmj.323.7314.644. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Biswas S., Karmakar A., Ghosh C. Multidrug resistant pathogenic Staphylococcus aureus in the pimples. Medical Science. 2015;16:41–50. [Google Scholar]
- 18.Lancette G. A., Tatini S. R. Staphylococcus aureus . In: Vanderzant C., Splittstoesser D. F., editors. Compendium of Methods for the Microbiological Examination of Foods. 3rd. Washington, DC, USA: American Public Health Association; 1992. pp. 533–550. [Google Scholar]
- 19.Monday S. R., Bohach G. A. Use of multiplex PCR to detect classical and newly described pyrogenic toxin genes in Staphylococcal isolates. Journal of Clinical Microbiology. 1999;37(10):3411–3414. doi: 10.1128/jcm.37.10.3411-3414.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Zhang K., McClure J.-A., Elsayed S., Louie T., Conly J. M. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus . Journal of Clinical Microbiology. 2005;43(10):5026–5033. doi: 10.1128/jcm.43.10.5026-5033.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Brakstad O. G., Aasbakk K., Maeland J. A. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene. Journal of Clinical Microbiology. 1992;30(7):1654–1660. doi: 10.1128/jcm.30.7.1654-1660.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Jarraud S., Mougel C., Thioulouse J., et al. Relationships between Staphylococcus aureus genetic background, virulence factors, agr groups (alleles), and human disease. Infection and Immunity. 2002;70(2):631–641. doi: 10.1128/iai.70.2.631-641.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Blair E. B., Emerson J. S., Tull A. H. A new medium, salt mannitol plasma agar, for the isolation of Staphylococcus aureus. American Journal of Clinical Pathology. 1967;47(1):30–39. doi: 10.1093/ajcp/47.1.30. [DOI] [PubMed] [Google Scholar]
- 24.Chapman G. H. The significance of sodium chloride in studies of staphylococci. Journal of bacteriology. 1945;50:201–203. doi: 10.1128/JB.50.2.201-203.1945. [DOI] [PubMed] [Google Scholar]
- 25.Cruickshank R., Duguid J. P., Marmion B. P., Swain R. H. A. Medical Microbiology. 12th. II. Edinburgh, UK: Chruchill Livingstone; 1975. [Google Scholar]
- 26.Swan A. The use of a bile-aesculin medium and of Maxted's technique of Lancefield grouping in the identification of enterococci (Group D Streptococci) Journal of Clinical Pathology. 1954;7(2):160–163. doi: 10.1136/jcp.7.2.160. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Rodgers J. D., McCullagh J. J., McNamee P. T., Smyth J. A., Ball H. J. Comparison of Staphylococcus aureus recovered from personnel in a poultry hatchery and in broiler parent farms with those isolated from skeletal disease in broilers. Veterinary Microbiology. 1999;69(3):189–198. doi: 10.1016/s0378-1135(99)00112-1. [DOI] [PubMed] [Google Scholar]
- 28.Bauer A. W., Kirby W. M., Sherris J. C., Turck M. Antibiotic susceptibility testing by a standardized single disk method. American Journal of Clinical Pathology. 1966;45(4):493–496. [PubMed] [Google Scholar]
- 29.CLSI. CLSI Document. M100-S25. Wayne, Pa, USA: Clinical and Laboratory Standards Institute; 2015. Performance standards for antimicrobial susceptibility testing. Twenty-fifth informational supplement. [Google Scholar]
- 30.Vijayalakshmi P. Incidence of Staphylococcus aureus in surgical site infections in a teaching hospital. International Journal of Current Microbiology and Applied Sciences. 2015;4(4):32–34. [Google Scholar]
- 31.Korman R. Z. Coagulase-negative mutants of Staphylococcus aureus: genetic studies. Journal of Bacteriology. 1963;86:363–369. doi: 10.1128/jb.86.3.363-369.1963. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Matthews K. R., Roberson J., Gillespie B. E., Luther D. A., Oliver S. P. Identification and differentiation of coagulase-negative Staphylococcus aureus by polymerase chain reaction. Journal of Food Protection. 1997;60(6):686–688. doi: 10.4315/0362-028X-60.6.686. [DOI] [PubMed] [Google Scholar]
- 33.Rukumani D. V., Ardita D. R., Shankar E. M., et al. Recalcitrant coagulase-negative methicillin-sensitive Staphylococcus aureus in an extremely low-birth-weight pre-term infant with thrombocytopaenia. JMM Case Reports. 2014 doi: 10.1099/jmmcr.0.004242. [DOI] [Google Scholar]
- 34.Sanford B. A., Thomas V. L., Ramsay M. A., Jones T. O. Characterization of clinical strains of Staphylococcus aureus associated with pneumonia. Journal of Clinical Microbiology. 1986;24(1):131–136. doi: 10.1128/jcm.24.1.131-136.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Tyagi A., Kapil A., Singh P. Incidence of methicillin resistant Stahylococcus aureus (MRSA) in pus samples at a Tertiary Care Hospital, AIIMS, New Delhi. Journal, Indian Academy of Clinical Medicine. 2008;9(1):33–35. [Google Scholar]
- 36.Khan A. U., Sultan A., Tyagi A., et al. Amplification of mecA gene in multi-drug resistant Staphylococcus aureus strains from hospital personnel. Journal of Infection in Developing Countries. 2007;1(3):289–295. [PubMed] [Google Scholar]
- 37.Thati V., Shivannavar C. T., Gaddad S. M. Vancomycin resistance among methicillin resistant Staphylococcus aureus isolates from intensive care units of tertiary care hospitals in Hyderabad. Indian Journal of Medical Research. 2011;134(11):704–708. doi: 10.4103/0971-5916.91001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Yaseen I. H., Shareef A. Y., Daoud A. S. High prevalence of multidrug-resistance MRSA and VRSA of different infections from Al-Jumhuory teaching hospital patients in Mosul. Journal of Life Sciences. 2013;7(12):1255–1259. [Google Scholar]
- 39.Tiwari H. K., Sen M. R. Emergence of vancomycin resistant Staphylococcus aureus (VRSA) from a tertiary care hospital from northern part of India. BMC Infectious Diseases. 2006;6, article 156 doi: 10.1186/1471-2334-6-156. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Sahebnasagh R., Saderi H., Owlia P. The prevalence of resistance to methicillin in Staphylococcus aureus strains isolated from patients by PCR Method for detection of mecA and nuc genes. Iranian Journal of Public Health. 2014;43(1):84–92. [PMC free article] [PubMed] [Google Scholar]
- 41.Rusenova N., Gebreyes W., Koleva M., et al. Comparison of three methods for routine detection of Staphylococcus aureus isolated from bovine mastitis. Kafkas Universitesi Veteriner Fakultesi Dergisi. 2013;19(4):709–712. doi: 10.9775/kvfd.2013.8753. [DOI] [Google Scholar]
