Skip to main content
PMC home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Aug 1.
Published in final edited form as: Brain Res. 2016 May 17;1644:240–248. doi: 10.1016/j.brainres.2016.05.031

Neural endocannabinoid CB1 receptor expression, social status, and behavior in male European starlings

M Susan DeVries 1,1, Melissa A Cordes 1,2, Jonathan D Rodriguez 1, Sharon A Stevenson 1, Lauren V Riters 1,✉
PMCID: PMC4904780  NIHMSID: NIHMS790470  PMID: 27206544

Abstract

Many species modify behavior in response to changes in resource availability or social status; however, the neural mechanisms underlying these modifications are not well understood. Prior work in male starlings demonstrates that status-appropriate changes in behavior involve brain regions that regulate social behavior and vocal production. Endocannabinoids are ubiquitously distributed neuromodulators that are proposed to play a role in adjusting behavior to match social status. As an initial step to provide insight into this hypothesis we observed flocks of male starlings in outdoor aviaries during the breeding season. We used quantitative real-time PCR to measure expression of endocannabinoid CB1 receptors in brain regions involved in social behavior and motivation (lateral septum [LS], ventral tegmental area [VTA], medial preoptic nucleus [POM]) and vocal behavior (Area X and robust nucleus of the arcopallium; RA). Males with nesting sites sang to females and displaced other males more than males without nesting sites. They also had higher levels of CB1 receptor expression in LS and RA. CB1 expression in LS correlated positively with agonistic behaviors. CB1 expression in RA correlated positively with singing behavior. CB1 in VTA also correlated positively with singing when only singing birds were considered. These correlations nicely map onto the well-established role of LS in agonistic behavior and the known role of RA in song production and VTA in motivation and song production. Studies are now needed to precisely characterize the role of CB1 receptors in these regions in the production of status-appropriate social behaviors.

Keywords: cannabinoids, social behavior, dominance, songbird, motivation, territoriality

1. Introduction

Many species modify the production of vocal, sexual, and agonistic behaviors in response to changes in social status or territory ownership (e.g., mammals (Oyegbile and Marler, 2005); fish (Burmeister et al., 2005; Maruska and Fernald, 2010); birds (Gwinner et al., 1987); reptiles; (Korzan et al., 2002)); however, the neural mechanisms underlying these changes are still unclear. Endocannabinoids (ECBs), their receptors, and associated enzymes are widely distributed in the brains of vertebrates (e.g., mammals (Egertova et al., 2003; Felder et al., 1996; Herkenham et al., 1991); birds (Soderstrom and Johnson, 2000); amphibians (Hollis et al., 2006)), and recent studies implicate ECBs in social, agonistic, and sexually-motivated behaviors (e.g., (Fattore et al., 2010; Rodriguez-Arias et al., 2013; Rodriguez-Manzo and Canseco-Alba, 2015; Trezza et al., 2012)).

The ECBs (anandamide and 2-arachidonoylglycerol) are synthesized “on demand” and released from postsynaptic membranes to primarily influence presynaptic neurons through retrograde signaling. In the central nervous system they bind to presynaptic G-protein coupled receptors (CB1 and to a lesser extent CB2) to inhibit calcium influx and neurotransmitter release (reviewed in (Castillo et al., 2012; Wilson and Nicoll, 2002)). It has been proposed that by rapidly gating neurotransmitter release, CB1 receptors may function to adjust behavior so that it is appropriate given changing environmental or social factors (Soderstrom, 2009). The present study was designed as an initial step to begin to provide insight into this hypothesis.

Male European starlings, Sturnus vulgaris, provide an excellent study species to address this topic. At the onset of the breeding season as testosterone (T) concentrations rise, male starlings without nesting territories avoid other males and appear to ignore females. However, once a male acquires a territory, T peaks and males begin to court females and socially dominate other males (Cordes et al., 2014; Gwinner et al., 1987; Kelm et al., 2011; Riters et al., 2000; Sartor and Ball, 2005). Past studies in starlings show that such “status-appropriate” behavioral changes are associated with differences in brain areas that across vertebrates are centrally involved in sexual motivation (i.e., the medial preoptic nucleus [often referred to as POM in birds]), agonistically-motivated behavior (i.e., the lateral septum [LS]), and the motivation to engage multiple behaviors (i.e., the ventral tegmental area [VTA]) (Balthazart and Ball, 2007; Blanchard et al., 1977; Goodson et al., 1999; O'Connell and Hofmann, 2011; Ramirez et al., 1988; Riters, 2012; Will et al., 2014). Similar brain regions are also implicated in status-appropriate behavioral differences in fish, lizards, rodents, and primates (e.g., (Albers, 2012; Fuxjager et al., 2010; Korzan et al., 2006; Maruska, 2015; Noonan et al., 2014; O'Connell and Hofmann, 2011)), indicating well-conserved mechanisms.

Past studies show that the promoter region of the CB1 receptor gene Cnr1 has androgen and estrogen binding sites, and both estrogens and androgens can alter CB1 expression (Gonzalez et al., 2000; Lee et al., 2013; Notarnicola et al., 2008; Proto et al., 2012). T is critical for male starlings (and other species) to initiate territorial acquisition and associated behaviors (Ball et al., 2002; Pinxten et al., 2002). In male starlings, androgen receptor markers in POM are denser in males with nest sites and correlate positively with female-directed courtship song (Cordes et al., 2014; Cordes et al., 2015). It is thus possible that T may directly or indirectly (via its metabolite estradiol) modify CB1 receptor expression to adjust status-appropriate behaviors.

If CB1 receptors influence status-appropriate behavior in starlings this may be reflected in CB1 receptor mRNA expression levels. Thus, as a first step we chose to focus on CB1 receptor expression. Here we observed flocks of male starlings in outdoor aviaries during the breeding season. Brains were collected and quantitative real-time polymerase chain reaction (qPCR) was used to measure expression of ECB CB1 receptors in POM, LS, and VTA in males with and without nesting sites. We additionally looked at CB1 receptor expression in two brain regions that are unique to songbirds; one that is selectively involved in vocal motor production (the robust nucleus of the arcopallium; RA) and one that is involved in vocal learning and contextual adjustment of song (Area X) (Bottjer et al., 1984; Nottebohm et al., 1976; Scharff and Nottebohm, 1991; Sohrabji et al., 1990). These regions are rich in CB1 receptor expression (Soderstrom and Johnson, 2000), and it is thought that CB1 receptors play a role in vocal motor production in RA and a role in auditory learning in Area X (Soderstrom and Tian, 2006). Finally, we measured T to gain insight into a possible role for circulating T (or its metabolites) in modifying CB1 expression.

2. Results

Nest site possession and behavior

Results of a MANOVA revealed that behavior (square root transformed for analyses) differed significantly in males that acquired and occupied nest boxes (n=10) compared to males that did not (n =10; main effect for nest box possession: F1,18 = 43.20, p = 0.000004). Fisher LSD posthoc tests indicate that males with nest boxes sang at higher rates (p = 0.00007; effect size Cohen’s d = 1.40; Figure 1A) and displaced other males more often (p = 0.000004; effect size Cohen’s d = 2.82; Figure 1B) than males without nest boxes (Confidence intervals [CIs] Song rate: males with nest boxes CI −95% = 2.67, +95% = 4.97; males without nest boxes CI −95 = 0.45, +95 = 2.73; Displacement: males with nest boxes CI −95% = 2.56, +95% = 4.49; males without nest boxes CI −95 = 0.40, +95 = 1.00). No differences were found between males with and without nest boxes for feeding (p = 0.537; effect size Cohen’s d = 0.29; males with nest boxes CI −95% = 1.83, +95% = 2.93; males without nest boxes CI −95 = 1.33, +95 = 2.88) or drinking behaviors (p = 0.377; effect size Cohen’s d = 0.90; males with nest boxes CI −95% = 1.39, +95% = 1.79; males without nest boxes CI −95 = 0.80, +95 = 1.59). A separate t-test on time spent singing also revealed that males with nest boxes spent significantly more time singing than males without boxes (t18 = 3.29, p = 0.004; effect size Cohen’s d = 1.47; males with nest boxes CI −95% = 10.29, +95% = 20.45; males without nest boxes CI −95 = −0.47, +95 = 10.01).

Figure 1.

Figure 1

Open in a new tab

Territory ownership, behavior and CB1 expression. Mean total song rate (i.e., number of songs produced during 4, 20 min observation periods) (A) and displacement behavior (B) for males with (filled bars) or without (open bars) nest sites. Data presented show the sum of behaviors for each male produced during 4, 20 min observation days divided by the total number of males in each group. Raw data are shown here. Data were square root transformed for analysis. Mean CB1 expression levels in RA (C) and LS (D) for males with (filled bars) or without (open bars) nest sites. * indicates p < 0.05, but not significant at a Bonferroni corrected p < 0.01, see discussion and methods for discussion of effect sizes. Scatterplots illustrating relationships between CB1 expression levels in RA and time spent singing (E; total number of seconds a male spent singing during 4, 20 min observation periods) and CB1 expression levels in LS and the number of times males displaced other males (F; total number of times a male displaced another male during 4, 20 min observation periods). Each point represents data for an individual male. Filled points indicate males with nest sites; open point indicate males without nest sites. Regression line indicates p < 0.05.

Nest site possession and CB1 expression

Compared to males without nest boxes, males that acquired and occupied nest boxes had significantly higher CB1 expression in RA (Table 1; Figure 1C) and LS (Table 1; Figure 1D). The sample size was n = 10 for each brain region, except that for RA one outlier was removed for a male with a nest box with a CB1 value that was more than 2 standard deviations below the mean. No significant differences were found for Area X, VTA or POM (p > 0.270 in all cases; Table 1). Results for RA and LS were not significant when Bonferroni corrected for the 5 separate t-tests run for each brain region (p = 0.032 and 0.039, respectively which are above the corrected p value of 0.01).

Table 1.

CB1 and testosterone: t-test results for comparisons of males with and without nest boxes

RA CB1 expression mean sd CI −95 CI +95 t (df) p Effect size (Cohen's d)
no box (n = 10) 0.43 0.11 0.36 0.51 2.34
(17)		 0.032 1.07
box (n = 9) 0.56 0.12 0.47 0.65
LS CB1 expression
no box (n = 10) 0.90 0.35 0.64 1.15 2.23
(18)		 0.039 1.00
box (n = 10) 1.26 0.39 0.99 1.54
Area X CB1 expression
no box (n = 10) 1.08 0.45 0.76 1.4 0.01
(18)		 0.990 0.01
box (n = 10) 1.08 0.31 0.85 1.3
VTA CB1 expression
no box (n = 9) 0.92 0.59 0.47 1.38 1.11
(15)		 0.285 0.55
box (n = 8) 0.68 0.23 0.48 0.87
POM CB1 expression
no box (n = 10) 1.22 0.62 0.78 1.67 1.13
(18)		 0.273 0.51
box (n = 10) 1.51 0.50 1.15 1.87
Testosterone (pg/ml)
no box (n = 10) 912.98 972.43 217.34 1608.62 1.21
(18)		 0.242 0.54
box (n = 10) 1469.36 1082.66 694.87 2243.85
Open in a new tab

Behaviors and CB1 expression

A standard multiple regression analysis in which CB1 expression in RA was entered as the predictor variable and time singing, displacements, and feeding were entered as independent variables was significant (Table 2) with both time singing (Table 2; Figure 1E) and feeding (Table 2; Figure 2) relating significantly to CB1 expression in RA. Displacement did not contribute significantly (Table 2). (Note: the lowest CB1 value that was identified as an outlier in the t-test described above was not found to be a statistical outlier when included in regression analyses. Its inclusion or removal had no effects on statistical significance. This point is therefore included.) The result of the same analysis for LS was also significant (Table 2) with displacements relating significantly to CB1 expression in LS (Table 2; Figure 1F). Time singing and feeding did not contribute significantly (Table 2).

Table 2.

CB1 and behavior: Multiple regression results

RA (dependent variable) IV Beta std error of
Beta		 t (df) p
adj R2 = 0.40, p = 0.011 time singing 0.56 0.19 2.91
(16)		 0.010
n = 20 displacements −
0.22		 0.19 1.11
(16)		 0.282
feeding 0.50 0.18 2.77
(16)		 0.014
LS (dependent variable) IV Beta std error of
Beta		 t (df) p
adj R2 =0.34, p = 0.021 time singing −
0.14		 0.20 0.69
(16)		 0.499
n = 20 displacements 0.71 0.20 3.54
(16)		 0.003
feeding 0.08 0.19 0.42
(16)		 0.679
VTA (dependent variable) IV Beta std error of
Beta		 t (df) p
adj R2 = 0.20, p = 0.12 time singing 0.02 0.24 0.09
(13)		 0.930
n = 17 displacements −
0.22		 0.24 0.96
(13)		 0.356
feeding −
0.54		 0.22 2.42
(13)		 0.031
POM (dependent variable) IV Beta std error of
Beta		 t (df) p
adj R2 = −0.08, p = 0.656 time singing −
0.18		 0.26 0.71
(16)		 0.485
n = 20 displacements 0.21 0.26 0.79
(16)		 0.439
feeding −
0.20		 0.24 0.81
(16)		 0.427
Area × (dependent variable) IV Beta std error of
Beta		 t (df) p
adj R2 = −0.06, p = 0.272 time singing 0.08 0.24 0.35
(16)		 0.727
n = 20 displacements 0.02 0.24 0.10
(16)		 0.919
feeding −
0.43		 0.23 1.92
(16)		 0.073
Open in a new tab

Figure 2.

Figure 2

Open in a new tab

Scatterplots illustrating relationships between feeding behavior and CB1 expression levels in RA. Each point represents data for an individual male. Filled points indicate males with nest sites; open point indicate males without nest sites. Regression line indicates p < 0.05.

For VTA, the overall multiple regression model was not significant (Table 2); although feeding did relate significantly to CB1 in VTA (Table 2). Examination of scatterplots suggested that time spent singing related to CB1 in VTA (but not any other brain region) when only singers were considered. This observation was significant when analyzed using simple regression (r = 0.64, p = 0.035; Figure 3). No significant models or contributing variables were identified in analyses of CB1 expression in either POM (p = 0.66) or Area X (p = 0.27) (Table 2).

Figure 3.

Figure 3

Open in a new tab

CB1 expression levels in VTA and time spent singing. Each point represents data for an individual male. Filled points indicate males with nest sites; open point indicate males without nest sites. Regression line indicates p < 0.05. Light regression line indicates that this was only significant when singing males were considered (see text for details).

Testosterone concentrations and CB1 expression

T-tests indicated that although testosterone concentrations tended to be greater in males with nest boxes compared to those without nest boxes, this was not statistically significant (p > 0.24; Table 1). For reference, these values are in the range of spring condition males with fully recrudesced gonads (Cordes et al., 2014; Gwinner et al., 2002; Stevenson et al., 2009). Results of correlation analyses revealed no significant correlations between testosterone concentrations and CB1 expression in any brain region (RA: r = 0.06, p = 0.814; LS: r = −0.08, p = 0.727; VTA: r = −0.17, p = 0.504; POM: r = 0.28, p = 0.226; Area X: r = −0.37, p = 0.106).

3. Discussion

The results presented here show strong associations between status-appropriate behaviors and CB1 receptor expression in brain regions involved in social motivation (LS and VTA) and vocal control (RA). Based on past studies demonstrating cannabinoids to modify production of sociosexual behaviors (e.g., (Fattore et al., 2010; Rodriguez-Arias et al., 2013; Rodriguez-Manzo and Canseco-Alba, 2015)), we interpret our results as consistent with a causal role for CB1 in these regions in modifying social behavior. However, our data are correlational and also support the non-mutually exclusive possibility that agonistic and sexual behavior modify CB1 expression (or that an unidentified third variable may be involved).

Nest site possession, CB1 expression, and sociosexual behaviors

As expected, males that successfully acquired nesting territories sang more than males without nest sites, and they socially dominated other males (as indicated by displacement behavior). Males with nest boxes had higher CB1 receptor mRNA expression in LS and RA. These results were nonsignificant when Bonferroni corrected. However, the effect sizes were strong and confidence intervals were relatively narrow, which we suggest may reflect a biologically important effect (as proposed by (Garamszegi, 2006)).

CB1 expression in LS correlated positively and strongly with agonistic behavior, whereas CB1 expression in RA correlated positively with singing behavior. This distinction nicely maps onto the well-established role of LS in agonistic behavior and the known role of RA in song production (Blanchard et al., 1977; Goodson et al., 1999; Heimovics et al., 2009; Nottebohm et al., 1976; Ramirez et al., 1988). The positive correlation between CB1 expression in RA and singing behavior is also consistent with a proposed role for CB1 in RA in vocal motor production (Soderstrom and Tian, 2006). The positive correlation that we identify between CB1 expression in LS is novel. Some studies in mammals show that cannabinoid administration decreases agonistic behavior (e.g., (Miczek, 1978; Rodriguez-Arias et al., 2013)); however, other studies demonstrate that administration of cannabinoids can induce agonistic behavior, particularly in animals exposed to stressful conditions (e.g., (Carlini, 1977; Fujiwara and Ueki, 1979)). Furthermore, effects can be biphasic with high doses inhibiting agonistic behavior and low doses stimulating agonistic behavior in low-aggressive mice (Sulcova et al., 1998). Studies that directly manipulate cannabinoids in LS are now needed to determine the role of CB1 in LS in agonistic behavior. Finally, whether acquiring a nest box is inducing the changes in gene expression or alternatively birds with a particular pattern of gene expression are more likely to become nest box owners must be examined in future experimental studies.

Our results also offer support for a role for CB1 receptors in VTA in singing behavior. When only singing birds (perhaps the most highly sexually-motivated birds) were considered, CB1 mRNA expression in VTA correlated positively with time spent singing. Studies using electrophysiology and immediate early gene expression demonstrate a central role for VTA in female-directed song (Goodson et al., 2009; Hara et al., 2007; Heimovics and Riters, 2005; Huang and Hessler, 2008; Yanagihara and Hessler, 2006). Measures of dopamine and opioids as well as GABA and glutamate neuron activity in VTA also relate positively to sexually-motivated singing behavior (Goodson et al., 2009; Hara et al., 2007; Heimovics and Riters, 2008; Heimovics et al., 2011; Huang and Hessler, 2008). Studies in mammals show that in VTA, CB1 receptors inhibit glutamate release (Melis et al., 2004) and inhibit GABA- and opioid-mediated inhibition of dopaminergic VTA neurons (Johnson and North, 1992; Wang and Lupica, 2014), which is proposed to disinhibit activity in VTA dopamine neurons to facilitate production of motivated behaviors (Oleson et al., 2012). Studies are now needed to test the prediction that CB1 inhibition of opioid and GABA neurons facilitates dopamine release and female-directed song.

Expression of CB1 receptors in RA and feeding behavior

We found a positive correlation between CB1 expression in RA and feeding behavior. This finding is consistent with results of a study in zebra finches that showed that limiting access to food increases ECB levels in tissue samples that included RA (as well as other regions (Soderstrom et al., 2004)). Perhaps birds that fed more in the present study were relatively more food deprived (and hungry) than birds that fed less, which may increase CB1 expression in RA. However, past studies in zebra finches suggest that CB1 receptors have opposing effects on feeding and singing (stimulatory and inhibitory, respectively) (Soderstrom et al., 2004; Soderstrom, 2009). Thus the finding that CB1 expression in RA correlates positively with both feeding and singing in the present study is difficult to resolve. Our results are certainly consistent with the idea that CB1 receptors, feeding and singing are interrelated; however additional study is required to fully interpret these somewhat contradictory results.

Expression of CB1 receptors and testosterone

In male starlings, T rises just before and after a male has acquired a nesting site (Gwinner et al., 1987; Gwinner and Gwinner, 1994). As reviewed in the introduction, both androgens and estrogens can modulate CB1 receptor expression (Gonzalez et al., 2000; Lee et al., 2013; Notarnicola et al., 2008; Proto et al., 2012); however in this study we did not find any correlations between circulating T and CB1 expression. Changes in local production of neurosteroids in the brain are also associated with singing and social behavior in songbirds (reviewed in (Heimovics et al., 2015; Remage-Healey et al., 2010)). It is thus possible that local interactions between steroids produced by the brain influenced CB1 expression in some brain regions. The influence of T on CB1 expression and behavior requires further study.

Interpretational limitations

The qPCR method stands out for yielding highly quantifiable information; however, as with any technique there are limitations. We interpret our results to suggest that high CB1 mRNA expression reflects high ECB receptor synthesis and increased tissue sensitivity to ECBs. This is plausible and supported by existing past studies (as detailed above); however, there are important caveats. First, we do not have information about translational and post-translational regulation of CB1 receptors, including availability of mRNA for translation or post-translational receptor migration and turnover. Second, with the existing study design, we do not know whether preexisting CB1 differences in the brain drive behavioral differences or whether behavior or other variables influence CB1 expression. We suggest that our data reflect constitutive, stable individual differences in CB1 expression and behavior; however, at least one study demonstrated that changes in CB1 mRNA in the goldfish brain can be detected 1 hour after presentation of a stressor (Palermo et al., 2013). If these changes can occur even earlier, it may be that behavior in the present study led to rapid transcriptional changes in CB1 expression. Future studies using measures and manipulations of CB1 as well as CB2 receptors, ECBs, synthetic and degradative enzymes are now needed to thoroughly characterize ECB regulation of behavior.

4. Experimental procedure

Study species, capture, and housing

Male starlings were captured during 2009–2010 in baited fly-in traps on a local farm in Madison, WI. Males were banded with stainless steel identification bands and unique combinations of plastic color bands to aid behavioral observations. Individuals were housed in single sex cages (91 cm × 47cm × 47 cm; 5 birds/cage) in the University of Wisconsin’s Department of Zoology indoor animal facility and subjected to artificial photoperiods of 18h light (L):6h dark (D) for 6 weeks, followed by 6 weeks of 8L:16D to induce photosensitivity before the onset of the experiment. All procedures and protocols adhered to the guidelines of the National Institutes of Health Guide for the Care and Use of Laboratory Animals and a protocol approved by the University of Wisconsin Institutional Animal Care and Use Committee.

Behavioral observations

Outdoor aviaries (2.13 m × 2.4 m × 1.98 m) exposed to natural light (approximately 13L:11D) were used to conduct behavioral observations. All aviaries (5) were equipped with appropriate enrichment for starlings (nest boxes, perches, nesting material, baths) and food and water were provided ad libitum. Twenty-five male starlings were randomly distributed into the aviaries (5 birds / aviary) and allowed to acclimate for 7-days prior to behavioral observations. By the end of the study 5 birds were removed from aviaries for various reasons (e.g., concerns that injury would result from agonistic interactions) leaving 20 birds. After the acclimation period, the behavior of each male in response to a 20 minute exposure to a female stimulus bird was recorded for 4 consecutive days. A single observer recorded behavioral measures, which included number of songs produced per 20 minute observation period (song rate), time spent singing (sec), and bouts (performance of behavior separated by at least 2 seconds from prior behavior) of non-specific behaviors eating and drinking. The number of displacements (times a male approached another male [landed within approx. 4cm] followed by that male’s departure) were also recorded. Each male was also categorized as a nest box owner or non-owner as determined by a male spending a majority of his time near a nest box opening or entering the box. At the end of each behavioral observation, the stimulus female was removed from the aviary and returned to the indoor housing facility (with similar light cycle length as outdoor aviaries). A single female was rotated through all aviaries on a single day and a new female was used each day (4 females total). The sum of behavior for each individual across the 4 test days was used for analyses (transformed when appropriate as detailed below).

Quantitative real-time polymerase chain reaction preparation and analyses

After the last behavioral observation (on day 4), brains were collected via rapid decapitation, flash frozen in Isopentane (C5H12) surrounded by dry ice, and stored at −80°C. Brains were sectioned coronally at −15°C into 200µm sections with a cryostat and placed onto slides. For LS, VTA, RA and Area X 2 punches were collected (one from each hemisphere) and for POM a single central punch was taken using a Stoelting brain punch set (#57401; punch sizes and locations are shown in Figure 4). Tissue punches were stored in 0.5 ml microcentrifuge tubes at −80°C until RNA extraction. All tissue punches were homogenized with an electric Dremel tool and RNA was extracted with a Bio-Rad Aurum Total RNA Fatty and Fibrous Tissue Kit (Catalog No. 732-6830; Bio-Rad, Hercules, CA). The concentration of RNA was measured with a Nanodrop system (Thermo Scientific, Wilmington, DE) and RNA integrity verified with Agilent 2100 BioAnalyzer and Agilent RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA) on a subset of samples. The RNA (100ng) was then converted into single stranded cDNA using Invitrogen SuperScript III First-Strand Synthesis System (Catalog No. 18080-051; Life Technologies, Carlsbad, CA). Following cDNA conversion, relative gene expression for CB1 was determined for all brain regions as a normalized ratio to reference genes as described below using qPCR analysis. (As part of separate studies, tissue from this set of males was also used to examine androgen receptor, opioid-related, dopamine-related and neurotensin-related mRNA (Cordes et al., 2015; DeVries et al., 2015; Merullo et al., 2015)).

Figure 4.

Figure 4

Open in a new tab

Location of tissue punches illustrated in one, coronal hemisphere of the starling brain. Punches were taken bilaterally, except in POM for which a single central punch was collected. Sections progress rostrally to caudally from A – E. Approximate punch sizes and locations are represented by circles centered in Area X and POM (1.25 mm diameter), LS, VTA, and RA (0.75 mm diameter). Abbreviations listed alphabetically: A = arcopallium; Cb = cerebellum; CO = optic chiasm; CoA = anterior commissure; GP = globus pallidus; HP = hippocampus; HVC = used as a proper name; ICo = nucleus intercollicularis; MLd = mesencephalicus lateralis, dorsalis mMAN = medial portion of the magnocellular nucleus; N = nidopallium; NIII = 3rd cranial nerve; PAG = periaqueductal gray; PVN = periventricular nucleus; Rt = nucleus rotundus; StL = striatum laterale; V = ventricle; VMN = ventromedial nucleus of the hypothalamus.

Primers for CB1 were designed (NCBI Gene Database, Primer-Blast) using the chicken (Gallus gallus) genome for qPCR analysis (Accession number: NM_001038652.1; Forward sequence: GGTCTTCTGTGGACTTAGGG; Reverse sequence: CTCCTCTATTCCTTTGTTGCTC; Product (bp) = 30). The qPCR reaction product was sequenced using Sanger sequencing with both forward and reverse primers at the University of Wisconsin Biotechnology Center (Sequence: TAATTTTTCCCCCTCCTTTTCTTTCACATGCATATGAGACTAACAGCAACAAAGGAATAGAGGAGA). Using NCBI BLAST this sequence matches the intended target. Two reference genes (glyceraldehyde-3-phosphate dehydrogenase [GAPDH]; hypoxanthine-guanine phosophoribosyltransferase [HPRT]) were also analyzed to normalize mRNA levels across samples. These reference genes were selected because they have been reported to be stable in starling neural tissue and suitable for use in calculating a normalization factor in studies of testicular growth, season-, context- and sex differences (Bentley et al., 2013a; Bentley et al., 2013b). The primers used for references genes were previously shown to match the intended targets (using Sanger sequencing) in starlings (Riters et al., 2014).

Samples were prepared for analysis in qPCR reaction tubes containing sample cDNA, nuclease free water, forward and reverse primers (5µM; University of Wisconsin), and SsoFast EvaGreen Supermix (Catalog No. 172-5201; Bio-Rad, Hercules, CA). Five standards were run with each plate of samples (1:10 serial dilution, starting concentration at 500ng/µl), along with a negative control (nuclease free water substituted for cDNA). Standards and samples were run in triplicate on each plate and all plates were read with the BioRad CFX96 Touch Real-Time PCR Detection System (Catalog No. 185-5195; Bio-Rad, Hercules, CA). Each qPCR run consisted of the following: an initiation step at 95°C for 30s, followed by 40 cycles of 95°C for 5s, a 30s annealing phase, a 20s elongation phase at 72°C, and a melt curve from 60°C to 88°C, 0.5 degrees for each 5s step. Plates were read following each elongation and melt curve step. Criteria for inclusion in the dataset were: run efficiencies between 90–110%, an R2 of at least 0.990, and a melt curve displaying a single peak indicative of primer specificity.

Testosterone

Trunk blood samples were collected at the time of sacrifice to assay T. Plasma T was measured using a commercial grade competitive enzyme immunoassay (Cayman Chemical, Ann Arbor, MI, USA, Catalog # 582701) and has been reported for these same birds (Cordes et al., 2015).

Statistical analyses

The Pfaffl Method (Pfaffl, 2001) was used to determine relative levels of gene expression (detailed in (Cordes et al., 2015)) for statistical analyses. This method is comparable to the commonly used 2 delta-delta Ct method (Livak and Schmittgen, 2001) but allows input of efficiencies for each individual run, rather than assuming 100% efficiency (Pfaffl, 2001). Following this method, the mean cycle threshold (Ct; amplification threshold = 200 RFU) values of all samples were transformed. The geometric mean of the Ct values for the two reference genes for each region was used to transform the Ct values for each gene analyzed to a normalized ratio. Outliers were identified using studentized residuals >2. All data were analyzed with Statistica software (StatSoft 2014, Tulsa, OK).

A MANOVA was used to examine differences in behavior (song rate, displacements, feeding, and drinking) between males with and without nesting sites. A separate t-test was run on time spent singing because values were so much higher (even when transformed) than those for other variables that its inclusion washed out all other findings. Behavioral measures were square root transformed to improve homogeneity of variance. Separate t-tests were used to analyze CB1 expression in each brain region in males with and without nesting sites. A single MANOVA was not used for CB1 measures because data points were missing in some brain regions which would cause these individuals to be dropped from all regions. Residuals were examined and outliers identified if they were + 2 sd from the mean and their inclusion or removal influenced results. A standard Bonferroni corrected p value of 0.01 was used to reduce Type 1 error. This caused all p values to fall short of significance, which may be a result of Bonferroni reducing statistical power and raising Type II error (Nakagawa, 2004). To assist in interpretation of these and all other results (as recently recommended by the American Statistical Association (Wasserstein and Lazar, 2016)) we also report confidence intervals and effect sizes using Cohen’s d values to provide insight into the strength of the difference between categorical variables with 0.20, 0.50, and 0.80 considered loose benchmarks for small, medium, and large effect sizes) (Cohen, 1988).

Standard multiple regression analyses were run to examine statistical associations between CB1 expression in each brain region and time spent singing, displacements, and feeding behavior. Nearly identical results to those obtained for time spent singing were obtained when we examined song rate. We report only the former results to avoid redundancy. In separate analyses CB1 expression in each brain region was entered as predictor variables and the three behavioral measures were entered as independent variables. VTA was missing 3 CB1 measures due to technical problems, reducing the sample size to 17. For all other regions n = 20. To provide insight into the possibility that T might alter CB1 expression, we ran correlation analyses between T concentrations and CB1 expression in each brain region. For each analysis residuals were examined and outliers identified using standard residual > 2 standard deviations in the population. Standardized Betas are reported for multiple regression analyses as indices of effect sizes (with 0.20, 0.50, and 0.80 also considered loose benchmarks for small, medium, and large effect sizes). For correlations, r values of r = 0.10, 0.30, and 0.50 have been suggested to be indicative of small, medium, and large effects, respectively (Cohen, 1988).

Highlights.

  • Dominant male starlings had higher CB1 expression in LS and RA than subordinates

  • CB1 mRNA expression in LS correlated positively with agonistic behavior

  • CB1 mRNA expression in RA and VTA correlated positively with song

  • CB1 mRNA expression in RA also correlated positively with feeding behavior

  • Endocannabinoid signaling may adjust behavior to match social status

Acknowledgments

This work was supported by NIMH grant R01 MH080225 to L. V. Riters. The authors gratefully acknowledge Dr. Cynthia Kelm-Nelson for technical assistance, Chris Elliott for animal care, Devin Merullo and Jeremy Spool for helpful discussions, and both the University of Wisconsin Integrated Biological Sciences Summer Research Program and the McNair Scholars program for support to J. D. Rodriguez.

Abbreviations

ECB

endocannabinoid

LS

lateral septum

POM

medial preoptic nucleus

qPCR

quantitative real-time polymerase chain reaction

RA

robust nucleus of the arcopallium

T

testosterone

VTA

ventral tegmental area

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Albers HE. The regulation of social recognition, social communication and aggression: vasopressin in the social behavior neural network. Horm Behav. 2012;61:283–292. doi: 10.1016/j.yhbeh.2011.10.007. [DOI] [PubMed] [Google Scholar]
  2. Ball GF, Riters LV, Balthazart J. Neuroendocrinology of song behavior and avian brain plasticity: multiple sites of action of sex steroid hormones. Front Neuroendocrinol. 2002;23:137–178. doi: 10.1006/frne.2002.0230. [DOI] [PubMed] [Google Scholar]
  3. Balthazart J, Ball GF. Topography in the preoptic region: differential regulation of appetitive and consummatory male sexual behaviors. Front Neuroendocrinol. 2007;28:161–178. doi: 10.1016/j.yfrne.2007.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bentley GE, Perfito N, Calisi RM. Season- and context-dependent sex differences in melatonin receptor activity in a forebrain song control nucleus. Horm Behav. 2013a;63:829–835. doi: 10.1016/j.yhbeh.2012.11.015. [DOI] [PubMed] [Google Scholar]
  5. Bentley GE, Tucker S, Chou H, Hau M, Perfito N. Testicular growth and regression are not correlated with Dio2 expression in a wild male songbird, sturnus vulgaris, exposed to natural changes in photoperiod. Endocrinology. 2013b;154:1813–1819. doi: 10.1210/en.2013-1093. [DOI] [PubMed] [Google Scholar]
  6. Blanchard DC, Blanchard RJ, Takahashi LK, Takahashi T. Septal lesions and aggressive behavior. Behav Biol. 1977;21:157–161. doi: 10.1016/s0091-6773(77)92407-5. [DOI] [PubMed] [Google Scholar]
  7. Bottjer SW, Miesner EA, Arnold AP. Forebrain lesions disrupt development but not maintenance of song in passerine birds. Science. 1984;224:901–903. doi: 10.1126/science.6719123. [DOI] [PubMed] [Google Scholar]
  8. Burmeister SS, Jarvis ED, Fernald RD. Rapid behavioral and genomic responses to social opportunity. PLoS Biol. 2005;3:e363. doi: 10.1371/journal.pbio.0030363. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Carlini EA. Further studies of the aggressive behavior induced by delta9-tetrahydrocannabinol in REM sleep-deprived rats. Psychopharmacology (Berl) 1977;53:135–145. doi: 10.1007/BF00426483. [DOI] [PubMed] [Google Scholar]
  10. Castillo PE, Younts TJ, Chavez AE, Hashimotodani Y. Endocannabinoid signaling and synaptic function. Neuron. 2012;76:70–81. doi: 10.1016/j.neuron.2012.09.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cohen J. Statistical power analysis for the behavioral sciences. Hillsdale, N.J.: L. Erlbaum Associates; 1988. Vol. [Google Scholar]
  12. Cordes MA, Stevenson SA, Riters LV. Status-appropriate singing behavior, testosterone and androgen receptor immunolabeling in male European starlings (Sturnus vulgaris) Horm Behav. 2014;65:329–339. doi: 10.1016/j.yhbeh.2014.02.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Cordes MA, Stevenson SA, Driessen TM, Eisinger BE, Riters LV. Sexually-motivated song is predicted by androgen-and opioid-related gene expression in the medial preoptic nucleus of male European starlings (Sturnus vulgaris) Behav Brain Res. 2015;278:12–20. doi: 10.1016/j.bbr.2014.09.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. DeVries MS, Cordes MA, Stevenson SA, Riters LV. Differential relationships between D1 and D2 dopamine receptor expression in the medial preoptic nucleus and sexually-motivated song in male European starlings (Sturnus vulgaris) Neuroscience. 2015;301:289–297. doi: 10.1016/j.neuroscience.2015.06.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Egertova M, Cravatt BF, Elphick MR. Comparative analysis of fatty acid amide hydrolase and cb(1) cannabinoid receptor expression in the mouse brain: evidence of a widespread role for fatty acid amide hydrolase in regulation of endocannabinoid signaling. Neuroscience. 2003;119:481–496. doi: 10.1016/s0306-4522(03)00145-3. [DOI] [PubMed] [Google Scholar]
  16. Fattore L, Melis M, Fadda P, Pistis M, Fratta W. The endocannabinoid system and nondrug rewarding behaviours. Exp Neurol. 2010;224:23–36. doi: 10.1016/j.expneurol.2010.03.020. [DOI] [PubMed] [Google Scholar]
  17. Felder CC, Nielsen A, Briley EM, Palkovits M, Priller J, Axelrod J, Nguyen DN, Richardson JM, Riggin RM, Koppel GA, Paul SM, Becker GW. Isolation and measurement of the endogenous cannabinoid receptor agonist, anandamide, in brain and peripheral tissues of human and rat. FEBS Lett. 1996;393:231–235. doi: 10.1016/0014-5793(96)00891-5. [DOI] [PubMed] [Google Scholar]
  18. Fujiwara M, Ueki S. The course of aggressive behavior induced by a single injection of delta 9-tetrahydrocannabinol and its characteristics. Physiol Behav. 1979;22:535–539. doi: 10.1016/0031-9384(79)90022-2. [DOI] [PubMed] [Google Scholar]
  19. Fuxjager MJ, Forbes-Lorman RM, Coss DJ, Auger CJ, Auger AP, Marler CA. Winning territorial disputes selectively enhances androgen sensitivity in neural pathways related to motivation and social aggression. Proc Natl Acad Sci U S A. 2010;107:12393–12398. doi: 10.1073/pnas.1001394107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Garamszegi LZ. Comparing effect sizes across variables: generalization without the need for Bonferroni correction. Behavioral Ecology. 2006;17:682–687. [Google Scholar]
  21. Gonzalez S, Bisogno T, Wenger T, Manzanares J, Milone A, Berrendero F, Di Marzo V, Ramos JA, Fernandez-Ruiz JJ. Sex steroid influence on cannabinoid CB(1) receptor mRNA and endocannabinoid levels in the anterior pituitary gland. Biochem Biophys Res Commun. 2000;270:260–266. doi: 10.1006/bbrc.2000.2406. [DOI] [PubMed] [Google Scholar]
  22. Goodson JL, Eibach R, Sakata J, Adkins-Regan E. Effect of septal lesions on male song and aggression in the colonial zebra finch (Taeniopygia guttata) and the territorial field sparrow (Spizella pusilla) Behav Brain Res. 1999;98:167–180. [PubMed] [Google Scholar]
  23. Goodson JL, Kabelik D, Kelly AM, Rinaldi J, Klatt JD. Midbrain dopamine neurons reflect affiliation phenotypes in finches and are tightly coupled to courtship. Proc Natl Acad Sci U S A. 2009;106:8737–8742. doi: 10.1073/pnas.0811821106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Gwinner H, Gwinner E, Dittami J. Effects of nestboxes on LH, testosterone, testicular size, and the reproductive behavior of male European starlings in spring. Behaviour. 1987;103:68–82. [Google Scholar]
  25. Gwinner H, Gwinner E. Effects of testosterone on nest-box occupation and associated behaviours by male European starlings (Sturnus vulgaris) Behaviour. 1994;129:141–148. [Google Scholar]
  26. Gwinner H, Van't Hof T, Zeman M. Hormonal and behavioral responses of starlings during a confrontation with males or females at nest boxes during the reproductive season. Horm Behav. 2002;42:21–31. doi: 10.1006/hbeh.2002.1795. [DOI] [PubMed] [Google Scholar]
  27. Hara E, Kubikova L, Hessler NA, Jarvis ED. Role of the midbrain dopaminergic system in modulation of vocal brain activation by social context. Eur J Neurosci. 2007;25:3406–3416. doi: 10.1111/j.1460-9568.2007.05600.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Heimovics SA, Riters LV. Immediate early gene activity in song control nuclei and brain areas regulating motivation relates positively to singing behavior during, but not outside of, a breeding context. J Neurobiol. 2005;65:207–224. doi: 10.1002/neu.20181. [DOI] [PubMed] [Google Scholar]
  29. Heimovics SA, Riters LV. Evidence that dopamine within motivation and song control brain regions regulates birdsong context-dependently. Physiol Behav. 2008;95:258–266. doi: 10.1016/j.physbeh.2008.06.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Heimovics SA, Cornil CA, Ball GF, Riters LV. D1-like dopamine receptor density in nuclei involved in social behavior correlates with song in a context-dependent fashion in male European starlings. Neuroscience. 2009:962–973. doi: 10.1016/j.neuroscience.2009.01.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Heimovics SA, Salvante KG, Sockman KW, Riters LV. Individual differences in the motivation to communicate relate to levels of midbrain and striatal catecholamine markers in male European starlings. Horm Behav. 2011;60:529–539. doi: 10.1016/j.yhbeh.2011.08.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Heimovics SA, Trainor BC, Soma KK. Rapid Effects of Estradiol on Aggression in Birds and Mice: The Fast and the Furious. Integr Comp Biol. 2015;55:281–293. doi: 10.1093/icb/icv048. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Herkenham M, Lynn AB, Johnson MR, Melvin LS, de Costa BR, Rice KC. Characterization and localization of cannabinoid receptors in rat brain: a quantitative in vitro autoradiographic study. J Neurosci. 1991;11:563–583. doi: 10.1523/JNEUROSCI.11-02-00563.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Hollis DM, Coddington EJ, Moore FL. Neuroanatomical distribution of cannabinoid receptor gene expression in the brain of the rough-skinned newt, Taricha granulosa. Brain Behav Evol. 2006;67:135–149. doi: 10.1159/000090978. [DOI] [PubMed] [Google Scholar]
  35. Huang YC, Hessler NA. Social modulation during songbird courtship potentiates midbrain dopaminergic neurons. PLoS ONE. 2008;3:e3281. doi: 10.1371/journal.pone.0003281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Johnson SW, North RA. Opioids excite dopamine neurons by hyperpolarization of local interneurons. J Neurosci. 1992;12:483–488. doi: 10.1523/JNEUROSCI.12-02-00483.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Kelm CA, Forbes-Lorman RM, Auger CJ, Riters LV. Mu-opioid receptor densities are depleted in regions implicated in agonistic and sexual behavior in male European starlings (Sturnus vulgaris) defending nest sites and courting females. Behav Brain Res. 2011;219:15–22. doi: 10.1016/j.bbr.2010.12.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  38. Korzan WJ, Summers TR, Summers CH. Manipulation of visual sympathetic sign stimulus modifies social status and plasma catecholamines. Gen Comp Endocrinol. 2002;128:153–161. doi: 10.1016/s0016-6480(02)00077-1. [DOI] [PubMed] [Google Scholar]
  39. Korzan WJ, Forster GL, Watt MJ, Summers CH. Dopaminergic activity modulation via aggression, status, and a visual social signal. Behav Neurosci. 2006;120:93–102. doi: 10.1037/0735-7044.120.1.93. [DOI] [PubMed] [Google Scholar]
  40. Lee KS, Asgar J, Zhang Y, Chung MK, Ro JY. The role of androgen receptor in transcriptional modulation of cannabinoid receptor type 1 gene in rat trigeminal ganglia. Neuroscience. 2013;254:395–403. doi: 10.1016/j.neuroscience.2013.09.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  42. Maruska KP, Fernald RD. Behavioral and physiological plasticity: rapid changes during social ascent in an African cichlid fish. Horm Behav. 2010;58:230–240. doi: 10.1016/j.yhbeh.2010.03.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Maruska KP. Social Transitions Cause Rapid Behavioral and Neuroendocrine Changes. Integr Comp Biol. 2015;55:294–306. doi: 10.1093/icb/icv057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Melis M, Pistis M, Perra S, Muntoni AL, Pillolla G, Gessa GL. Endocannabinoids mediate presynaptic inhibition of glutamatergic transmission in rat ventral tegmental area dopamine neurons through activation of CB1 receptors. J Neurosci. 2004;24:53–62. doi: 10.1523/JNEUROSCI.4503-03.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Merullo DP, Cordes MA, Susan DeVries M, Stevenson SA, Riters LV. Neurotensin neural mRNA expression correlates with vocal communication and other highly-motivated social behaviors in male European starlings. Physiol Behav. 2015;151:155–161. doi: 10.1016/j.physbeh.2015.07.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Miczek KA. delta9-tetrahydrocannabinol: antiaggressive effects in mice, rats, and squirrel monkeys. Science. 1978;199:1459–1461. doi: 10.1126/science.415367. [DOI] [PubMed] [Google Scholar]
  47. Nakagawa S. A farewell to Bonferroni: the problems of low statistical power and publication bias. Behavioral Ecology. 2004;15:1044–1045. [Google Scholar]
  48. Noonan MP, Sallet J, Mars RB, Neubert FX, O'Reilly JX, Andersson JL, Mitchell AS, Bell AH, Miller KL, Rushworth MF. A neural circuit covarying with social hierarchy in macaques. PLoS Biol. 2014;12:e1001940. doi: 10.1371/journal.pbio.1001940. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Notarnicola M, Messa C, Orlando A, Bifulco M, Laezza C, Gazzerro P, Caruso MG. Estrogenic induction of cannabinoid CB1 receptor in human colon cancer cell lines. Scand J Gastroenterol. 2008;43:66–72. doi: 10.1080/00365520701559011. [DOI] [PubMed] [Google Scholar]
  50. Nottebohm F, Stokes TM, Leonard CM. Central control of song in the canary, Serinus canarius. J Comp Neurol. 1976;165:457–486. doi: 10.1002/cne.901650405. [DOI] [PubMed] [Google Scholar]
  51. O'Connell LA, Hofmann HA. The vertebrate mesolimbic reward system and social behavior network: a comparative synthesis. J Comp Neurol. 2011;519:3599–3639. doi: 10.1002/cne.22735. [DOI] [PubMed] [Google Scholar]
  52. Oleson EB, Beckert MV, Morra JT, Lansink CS, Cachope R, Abdullah RA, Loriaux AL, Schetters D, Pattij T, Roitman MF, Lichtman AH, Cheer JF. Endocannabinoids shape accumbal encoding of cue-motivated behavior via CB1 receptor activation in the ventral tegmentum. Neuron. 2012;73:360–373. doi: 10.1016/j.neuron.2011.11.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  53. Oyegbile TO, Marler CA. Winning fights elevates testosterone levels in California mice and enhances future ability to win fights. Horm Behav. 2005;48:259–267. doi: 10.1016/j.yhbeh.2005.04.007. [DOI] [PubMed] [Google Scholar]
  54. Palermo FA, Cardinaletti G, Cocci P, Tibaldi E, Polzonetti-Magni A, Mosconi G. Effects of dietary nucleotides on acute stress response and cannabinoid receptor 1 mRNAs in sole, Solea solea. Comp Biochem Physiol A Mol Integr Physiol. 2013;164:477–482. doi: 10.1016/j.cbpa.2012.12.005. [DOI] [PubMed] [Google Scholar]
  55. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Pinxten R, De Ridder E, Balthazart J, Eens M. Context-dependent effects of castration and testosterone treatment on song in male European starlings. Horm Behav. 2002;42:307–318. doi: 10.1006/hbeh.2002.1824. [DOI] [PubMed] [Google Scholar]
  57. Proto MC, Gazzerro P, Di Croce L, Santoro A, Malfitano AM, Pisanti S, Laezza C, Bifulco M. Interaction of endocannabinoid system and steroid hormones in the control of colon cancer cell growth. J Cell Physiol. 2012;227:250–258. doi: 10.1002/jcp.22727. [DOI] [PubMed] [Google Scholar]
  58. Ramirez JM, Salas C, Portavella M. Offense and defense after lateral septal lesions in Columba livia. Int J Neurosci. 1988;41:241–250. doi: 10.3109/00207458808990730. [DOI] [PubMed] [Google Scholar]
  59. Remage-Healey L, London SE, Schlinger BA. Birdsong and the neural production of steroids. J Chem Neuroanat. 2010;39:72–81. doi: 10.1016/j.jchemneu.2009.06.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Riters LV, Eens M, Pinxten R, Duffy DL, Balthazart J, Ball GF. Seasonal changes in courtship song and the medial preoptic area in male European starlings (Sturnus vulgaris) Horm Behav. 2000;38:250–261. doi: 10.1006/hbeh.2000.1623. [DOI] [PubMed] [Google Scholar]
  61. Riters LV. The role of motivation and reward neural systems in vocal communication in songbirds. Front Neuroendocrinol. 2012;33:194–209. doi: 10.1016/j.yfrne.2012.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Riters LV, Stevenson SA, DeVries MS, Cordes MA. Reward associated with singing behavior correlates with opioid-related gene expression in the medial preoptic nucleus in male European starlings. PLoS One. 2014;9:e115285. doi: 10.1371/journal.pone.0115285. [DOI] [PMC free article] [PubMed] [Google Scholar]
  63. Rodriguez-Arias M, Navarrete F, Daza-Losada M, Navarro D, Aguilar MA, Berbel P, Minarro J, Manzanares J. CB1 cannabinoid receptor-mediated aggressive behavior. Neuropharmacology. 2013;75:172–180. doi: 10.1016/j.neuropharm.2013.07.013. [DOI] [PubMed] [Google Scholar]
  64. Rodriguez-Manzo G, Canseco-Alba A. Biphasic effects of anandamide on behavioural responses: emphasis on copulatory behaviour. Behav Pharmacol. 2015;26:607–615. doi: 10.1097/FBP.0000000000000154. [DOI] [PubMed] [Google Scholar]
  65. Sartor JJ, Ball GF. Social suppression of song is associated with a reduction in volume of a songcontrol nucleus in European starlings (Sturnus vulgaris) Behav Neurosci. 2005;119:233–244. doi: 10.1037/0735-7044.119.1.233. [DOI] [PubMed] [Google Scholar]
  66. Scharff C, Nottebohm F. A comparative study of the behavioral deficits following lesions of various parts of the zebra finch song system: implications for vocal learning. J Neurosci. 1991;11:2896–2913. doi: 10.1523/JNEUROSCI.11-09-02896.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  67. Soderstrom K, Johnson F. CB1 cannabinoid receptor expression in brain regions associated with zebra finch song control. Brain Res. 2000;857:151–157. doi: 10.1016/s0006-8993(99)02393-8. [DOI] [PubMed] [Google Scholar]
  68. Soderstrom K, Tian Q, Valenti M, Di Marzo V. Endocannabinoids link feeding state and auditory perception-related gene expression. J Neurosci. 2004;24:10013–10021. doi: 10.1523/JNEUROSCI.3298-04.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Soderstrom K, Tian Q. Developmental pattern of CB1 cannabinoid receptor immunoreactivity in brain regions important to zebra finch (Taeniopygia guttata) song learning and control. J Comp Neurol. 2006;496:739–758. doi: 10.1002/cne.20963. [DOI] [PubMed] [Google Scholar]
  70. Soderstrom K. Lessons from nonmammalian species. Curr Top Behav Neurosci. 2009;1:173–198. doi: 10.1007/978-3-540-88955-7_7. [DOI] [PubMed] [Google Scholar]
  71. Sohrabji F, Nordeen EJ, Nordeen KW. Selective impairment of song learning following lesions of a forebrain nucleus in the juvenile zebra finch. Behav Neural Biology. 1990;53:51–63. doi: 10.1016/0163-1047(90)90797-a. [DOI] [PubMed] [Google Scholar]
  72. Stevenson TJ, Bernard DJ, Ball GF. Photoperiodic condition is associated with region-specific expression of GNRH1 mRNA in the preoptic area of the male starling (Sturnus vulgaris) Biol Reprod. 2009;81:674–680. doi: 10.1095/biolreprod.109.076794. [DOI] [PMC free article] [PubMed] [Google Scholar]
  73. Sulcova E, Mechoulam R, Fride E. Biphasic effects of anandamide. Pharmacol Biochem Behav. 1998;59:347–352. doi: 10.1016/s0091-3057(97)00422-x. [DOI] [PubMed] [Google Scholar]
  74. Trezza V, Damsteegt R, Manduca A, Petrosino S, Van Kerkhof LW, Pasterkamp RJ, Zhou Y, Campolongo P, Cuomo V, Di Marzo V, Vanderschuren LJ. Endocannabinoids in amygdala and nucleus accumbens mediate social play reward in adolescent rats. J Neurosci. 2012;32:14899–14908. doi: 10.1523/JNEUROSCI.0114-12.2012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  75. Wang H, Lupica CR. Release of endogenous cannabinoids from ventral tegmental area dopamine neurons and the modulation of synaptic processes. Prog Neuropsychopharmacol Biol Psychiatry. 2014;52:24–27. doi: 10.1016/j.pnpbp.2014.01.019. [DOI] [PMC free article] [PubMed] [Google Scholar]
  76. Wasserstein RL, Lazar NA. The ASA's statement on p-values: context, process, and purpose. The American Statistician. 2016 00-00. [Google Scholar]
  77. Will RG, Hull EM, Dominguez JM. Influences of dopamine and glutamate in the medial preoptic area on male sexual behavior. Pharmacol Biochem Behav. 2014;121:115–123. doi: 10.1016/j.pbb.2014.02.005. [DOI] [PubMed] [Google Scholar]
  78. Wilson RI, Nicoll RA. Endocannabinoid signaling in the brain. Science. 2002;296:678–682. doi: 10.1126/science.1063545. [DOI] [PubMed] [Google Scholar]
  79. Yanagihara S, Hessler NA. Modulation of singing-related activity in the songbird ventral tegmental area by social context. Eur J Neurosci. 2006;24:3619–3627. doi: 10.1111/j.1460-9568.2006.05228.x. [DOI] [PubMed] [Google Scholar]

RESOURCES