Skip to main content
NCBI home page
BioMed Research International logoLink to BioMed Research International
. 2016 May 31;2016:3704150. doi: 10.1155/2016/3704150

Fecal Colonization with Extended-Spectrum Beta-Lactamase and AmpC-Producing Escherichia coli

Mohamed H Al-Agamy 1,2,*, Taghrid S El Mahdy 3, Atef M Shibl 1,4
PMCID: PMC4906171  PMID: 27340657

Abstract

Background. Extended-spectrum β-lactamases (ESβLs) and AmpC β-lactamases cause β-lactam resistance in Escherichia coli. Fecal colonization by ESβL- and/or AmpC-positive E. coli is a source of nosocomial infections. Methods. In order to investigate inpatient fecal colonization by ESβLs and AmpC, antibiotic sensitivity tests were conducted and minimum inhibitory concentrations (MICs) were determined using the disk diffusion method and E-test, respectively. Characterization of ESβL and AmpC was performed using E-test strips, and a set of PCRs and DNA sequence analyses were used to characterize the ESβL and AmpC genes. Results. The whole collection of E. coli isolates (n = 50) was sensitive to imipenem, tigecycline, colistin, and fosfomycin, while 26% of the isolates showed reduced susceptibility to ceftazidime (MIC ≥ 4 μg/mL). ESβL was phenotypically identified in 26% (13/50) of cases, while AmpC activity was detected in two ESβL-producing E. coli isolates. All ESβL-producing E. coli were positive for the CTX-M gene, eleven isolates carried bla CTX-M-15, and two isolates carried bla CTX-M-14 gene. Two CTX-M-positive E. coli isolates carried bla CMY-2. Conclusions. The alimentary tract is a significant reservoir for ESβL- and/or AmpC-producing E. coli, which may lead to nosocomial infection.

1. Introduction

A remarkable increase in fecal colonization rates with extended-spectrum beta-lactamase- (ESβL-), AmpC-plasmid mediated-, and/or carbapenemases-producing Enterobacteriaceae has been reported in many regions worldwide [1, 2]. Infections caused by Enterobacteriaceae, which are resistant to β-lactams, are coupled with the inappropriate use of antibiotics and/or a prolonged period of hospital admission. The rising use of carbapenems for empirical treatment of nosocomial infections has led to fast global dissemination of carbapenemase-positive enterobacterial strains [3]. ESβLs arise through point mutations in TEM-1/TEM-2 and SHV-1. However, over the last three decades, non-TEM and non-SHV ESβLs strains have been detected, primarily CTX-M. Enterobacteriaceae that produce CTX-M enzymes have shown rapid and concerning dissemination and have been documented as the most prevalent etiological infectious agents [4]. ESβL confers resistance to penicillins, cephalosporins, and monobactam (aztreonam), but they are susceptible to cephamycins (cefoxitin and cefotetan) and carbapenems (imipenem, meropenem, and doripenem) and are typically reserved by inhibitors of Ambler class A β-lactamase (clavulanic acid, tazobactam, or sulbactam). Most ESβLs can hydrolyze fourth-generation cephalosporins. While AmpC β-lactamases confer resistance to penicillins, third-generation cephalosporins, monobactam, and cephamycins, they are sensitive to carbapenem and are not inhibited by β-lactamase inhibitors; however, they are inhibited by cloxacillin [5–7].

Numerous studies in Saudi Arabia have focused on the identification of ESβL-producing strains from clinical specimens [4], but there are few reports on the fecal colonization of ESβL-producing isolates in Saudi Arabia. Therefore, in the present study, we determine the incidence of ESβL- and/or AmpC cephalosporinase-producing Escherichia coli isolates in human fecal flora and investigated the genes encoding the corresponding enzymes.

2. Materials and Methods

2.1. Bacterial Identification

Fifty different E. coli isolates were isolated from 50 stool samples of different inpatients carriers, under nonoutbreak conditions, at a hospital in Riyadh, Saudi Arabia, from April 2014 to June 2014. Briefly, fresh stool specimens were aseptically collected and transported to the microbiology laboratory. Stool samples were suspended in sterile phosphate-buffered saline, pH 7. A 100 μL volume was directly inoculated onto blood agar and Eosin Methylene Blue agar (Oxoid Microbiology Products, Hampshire, UK). After 48 h incubation at 37°C, the isolated organisms were identified by conventional procedures and automated identification systems with the API20E identification kit (bioMerieux, Marcy l'Etoile, France). These isolates were preserved in brain heart infusion broth containing 20% glycerol at −70°C.

2.2. Phenotypic Detection of ESβL

The isolates showing reduced susceptibility to ceftazidime (CAZ), cefotaxime (CTX), or aztreonam (ATM) (minimum inhibitory concentration (MIC) ≥ 1 μg/mL or zone diameter ≤ 22 mm) were selected for screening of ESβL production (Clinical and Laboratory Standards Institute (CLSI), 2014). E-test ESβL strips were used in accordance with the manufacturer's instructions to evaluate ESβL production. The CAZ/ceftazidime + clavulanate- (CAZ/CAL-) ESβL E-test strip was used to detect ESβL production. The test is considered positive if the ratio of MIC of CAZ/CAL is ≥8. To inhibit AmpC β-lactamase, the CAZ/CAL-ESβL E-test was carried out on cloxacillin Mueller-Hinton agar, and the results were interpreted in a similar manner.

2.3. Phenotypic Detection of AmpC

The isolates showing reduced susceptibility to cefoxitin (FOX) or cefotetan (CTT) (zone diameter of 18 or 16 mm, resp.) were selected for screening of AmpC enzyme production [9]. The phenotypic detection test consists of a strip containing CTT on one end and CTT-cloxacillin (CTT/CXT) on the other end. Ratios of the MICs of CTT/CXT ≥ 8 are considered to indicate positive AmpC β-lactamase production.

2.4. Susceptibility Testing

MICs for the isolates showing a phenotype of producing ESβL and AmpC activities were determined by using E-test strips (bioMerieux, Marcy l'Etoile, France). Interpretation was based on the Clinical and Laboratory Standards Institute (CLSI) criteria [9]. Escherichia coli ATCC 25922 strains were used as reference strains. The following antibiotics were tested: piperacillin (PIP), piperacillin/tazobactam (TZP), CAZ, CAZ/CAL, CTX, cefepime (FEP), ATM, FOX, CTT, CTT/CXT, imipenem (IMI), gentamicin (GM), amikacin (AK), ciprofloxacin (CI), colistin (COL), tigecycline (TGC), and fosfomycin (FOS).

2.5. Screening for the Presence of β-Lactamase Genes

The isolate was cultured in 2 mL of Tryptic Soy Broth (Difco, Franklin Lakes, NJ, USA). A 200 μL volume of overnight culture was heated at 99°C in a heat block for 10 min. The obtained DNA was used in polymerase chain reaction (PCR) assays on a Techne Flexigene Thermal Cycler (Techne, Duxford, Cambridge, UK). Positive and negative controls were included in all PCR assays. All PCR products were analyzed on 0.8% agarose gels (incorporated with 0.5 mg/L ethidium bromide) and then visualized under UV light (Pharmacia LKB, Biotechnology AB, Gothenburg, Sweden) and photographed using a documentation system (CE, DP-CF-011.C, European Union).

The PCR primers used are listed in Table 1. The primers were used to search for class A β-lactamase genes (bla TEM, bla SHV, bla OXA-1, and bla CTX-M families) and class C β-lactamase genes (bla CMY, bla MOX, bla FOX, bla DHA, bla ACC, bla ACT, bla MIR, bla EBC, bla CIT, and bla BIL). PCR assays were conducted as previously described [8].

Table 1.

Primers used for amplification of the tested β-lactamase genes (Dallenne et al., 2010 [8]).

PCR type Target Primer Sequence of primers (5′-3′) Amplified products (bp)
Multiplex I TEM, SHV, and OXA-1-like TEM MultiTSO-T_for CATTTCCGTGTCGCCCTTATTC 800
MultiTSO-T_rev CGTTCATCCATAGTTGCCTGAC
SHV MultiTSO-S_for AGCCGCTTGAGCAAATTAAAC 713
MultiTSO-S_rev ATCCCGCAGATAAATCACCAC
OXA-1 MultiTSO-O_for GGCACCAGATTCAACTTTCAAG 564
MultiTSO-O_rev GACCCCAAGTTTCCTGTAAGTG
Multiplex II CTX-M group 1, group 2, and group 9 CTX-M group 1 MultiCTXMGp1_for TTAGGAARTGTGCCGCTGYA 688
MultiCTXMGp1-2_rev CGATATCGTTGGTGGTRCCAT
CTX-M group 2 MultiCTXMGp2_for CGTTAACGGCACGATGAC 404
MultiCTXMGp1-2_rev CGATATCGTTGGTGGTRCCAT
CTX-M group 9 MultiCTXMGp9_for TCAAGCCTGCCGATCTGGT 561
MultiCTXMGp9_rev TGATTCTCGCCGCTGAAG
CTX-M group 8/25 CTX-M group 8/25 CTX-Mg8/25_for AACRCRCAGACGCTCTAC 326
CTX-Mg8/25_rev TCGAGCCGGAASGTGTYAT
Multiplex III ACC, FOX, MOX, DHA, CIT, and EBC ACC-1 and ACC-2 MultiCaseACC_for CACCTCCAGCGACTTGTTAC 346
MultiCaseACC_rev GTTAGCCAGCATCACGATCC
FOX-1 to FOX-5 MultiCaseFOX_for CTACAGTGCGGGTGGTTT 162
MultiCaseFOX_rev CTATTTGCGGCCAGGTGA
MOX-1, MOX-2, CMY-1, CMY-8 to CMY-11, and CMY-19 MultiCaseMOX_for GCAACAACGACAATCCATCCT 895
MultiCaseMOX_rev GGGATAGGCGTAACTCTCCCAA
DHA-1 and DHA-2 MultiCaseDHA_for TGATGGCACAGCAGGATATTC 997
MultiCaseDHA_rev GCTTTGACTCTTTCGGTATTCG
LAT-1 to LAT-3, BIL-1, CMY-2 to CMY-7, CMY-12 to CMY-18, and CMY-21 to CMY-23 MultiCaseCIT_for CGAAGAGGCAATGACCAGAC 538
MultiCaseCIT_rev ACGGACAGGGTTAGGATAGY
ACT-1 and MIR-1 MultiCaseEBC_for CGGTAAAGCCGATGTTGCG 683
Open in a new tab

2.6. Sequencing of β-Lactamase Genes

Purification of PCR amplicons was performed using a PCR purification kit (Qiagen, Hilden, Germany). PCR products of bla genes were sequenced on both strands using PCR primers to determine their molecular types. DNA sequences were analyzed using the ABI 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's recommendations.

3. Results

3.1. Bacterial Identification

Fifty fecal E. coli samples were isolated randomly from hospitalized patients in Riyadh, Saudi Arabia. The patients were treated for noninfectious diseases under nonoutbreak conditions. Escherichia coli isolates were identified manually and according to the API20E identification kit (bioMerieux, Marcy l'Etoile, France).

3.2. Characterization of bla ESβL and bla AmpC

Thirteen of the 50 E. coli isolates, which showed reduced susceptibility to CAZ, CTX, or ATM (MIC ≥ 1 μg/mL or inhibition zone ≤ 22 mm), were selected for screening of ESβL and AmpC enzyme production using CAZ/CAL-ESβL and CTT/CXT-AmpC E-test strips. Thirteen isolates were positive for ESβL and two ESβL-positive isolates produced AmpC β-lactamase.

PCR was used to detect bla ESβL genes and AmpC plasmid-mediated genes in ESβL- and AmpC-positive E. coli isolates (n = 13). The results of PCR and DNA sequencing of bla genes are shown in Table 2.

Table 2.

Antimicrobial susceptibility profiles of ESβL- and AmpC-producing E. coli isolates from fecal samples and associated resistance patterns.

Isolates number E-test MIC (mg/L) Resistance genes
PIP TZP CTX CAZ CAZ/CAL FEP ATM FOX CTT CTT/CXT IMI GM AK CI COL TGC FOS
EC1 >256 <1 >256 32 32/2 4 8 0.032 0.25 <0.5/<0.5 0.06 0.5 2 1 <0.016 0.25 0.016 TEM-1+CTX-M-15+OXA-1
EC2 >256 <1 >256 16 16/0.5 4 16 0.065 0.25 <0.5/<0.5 0.12 1.5 3 0.25 <0.016 0.25 <0.016 TEM-1+CTX-M-15++SHV-1
EC3 >256 64 >256 >256 >32/4 12 >256 0.125 0.25 <0.5/<0.5 0.25 64 3 4 <0.016 0.125 <0.016 TEM-1+CTX-M-15+OXA-1
EC4 >256 8 >256 32 32/0.064 8 16 0.032 0.06 <0.5/<0.5 0.06 12 4 4 <0.016 0.125 <0.016 TEM-1+CTX-M-15+OXA-1
EC5 >256 32 >256 16 16/0.5 4 12 0.125 0.125 <0.5/<0.5 0.03 8 3 6 <0.016 0.25 <0.016 TEM-1+CTX-M-15+SHV-1
EC6 >256 8 >256 >256 >32/4 192 >256 0.25 0.25 <0.5/<0.5 0.06 192 48 >32 <0.016 0.25 <0.016 TEM-1+CTX-M-15+OXA-1
EC7 >256 8 >256 >256 >32/4 128 192 0.25 0.25 <0.5/<0.5 0.12 128 16 >32 <0.016 0.25 <0.016 TEM-1+CTX-M-15+OXA-1
EC8 >256 <1 >256 >256 >32/4 96 128 0.25 0.25 <0.5/<0.5 0.06 96 0.5 0.25 <0.016 0.25 0.125 TEM-1+CTX-M-14+OXA-1
EC9 >256 16 >256 4 4/0.064 3 3 0.032 0.032 <0.5/<0.5 0.06 8 2 0.25 <0.016 0.38 <0.016 TEM-1+CTX-M-15
EC10 >256 4 >256 6 6/0.125 4 6 0.032 0.032 <0.5/<0.5 0.125 16 1 0.5 <0.016 0.25 <0.016 TEM-1+CTX-M-15+SHV-1
EC11 >256 <1 >256 48 >32/1 8 24 0.032 0.032 <0.5/<0.5 0.25 2 32 1 <0.016 0.25 <0.016 TEM-1+CTX-M-14+OXA-1
EC12 >256 >256 >256 >256 >32/>4 48 >256 64 32 32/32 0.25 >256 192 0.75 <0.016 0.25 0.016 TEM-1+CTX-M-15+CMY-2+OXA-1
EC13 >256 128 >256 >256 >32/>4 64 >256 64 48 >32/>32 0.25 128 4 >32 <0.016 0.38 0.016 TEM-1+CTX-M-15+CMY-2
Open in a new tab

PIP: piperacillin; TZP: piperacillin/tazobactam; CAZ: ceftazidime; CAZ/CAL: ceftazidime/ceftazidime + clavulanic acid; CTX: cefotaxime; FEP: cefepime; ATM: aztreonam; FOX: cefoxitin; CTT: cefotetan; CTT/CXT: cefotetan/cefotetan + cloxacillin; IMI: imipenem; GM: gentamicin; AK: amikacin; CI: ciprofloxacin; COL: colistin; TGC: tigecycline; FOS: fosfomycin.

Eleven of 13 ESβL-producing E. coli isolates were found to contain CTX-M-15, while two isolates harbored bla CTX-M-14. CMY-2-positive isolates (n = 2) were concomitant with CTX-M-15. All ESβL-producing E. coli isolates (n = 13) were positive for bla TEM-1, while eight (61.5%) isolates carried bla OXA-1. In contrast, three (23%) isolates were found to contain bla SHV-1.

3.3. Antimicrobial Resistance Pattern of ESβL and AmpC Enzyme-Positive Isolates

The MICs of 17 antimicrobial agents were determined for E. coli fecal isolates. The results of the susceptibility pattern for ESβL and AmpC enzyme-producing E. coli isolates are illustrated in Table 2.

4. Discussion

The human and animal alimentary tracts are vital reservoirs for ESβL-, carbapenemases-, and AmpC enzyme-producing Enterobacteriaceae. Patient-to-patient transmission of resistant microorganisms may occur in hospitals [10, 11]. The overuse of antibiotics has recently been associated with the emergence of resistant intestinal bacteria, particularly ESβL-, carbapenemases-, and AmpC enzyme-producing Enterobacteriaceae. Numerous studies have demonstrated that exposure to β-lactam antibiotics is a risk factor for the selection of multidrug-resistant E. coli [12]. Therefore, the current study examined the antimicrobial resistance patterns of fecal E. coli isolates, as well as the molecular basis for their β-lactam resistance mechanisms, using phenotypic and genotypic methods. The present study included 50 patients admitted to a hospital in Riyadh, Saudi Arabia, from April 2014 to June 2014. These patients were treated for noninfectious diseases under nonoutbreak conditions. Fifty fecal stool specimens collected from the 50 patients were cultured on blood agar and EMB agar as described in Materials and Methods. Fifty suspected E. coli isolates were selected and the isolates were identified by conventional procedures and using the API20E identification kit. All isolates were identified as E. coli.

Production of β-lactamases is the main mechanism of β-lactam resistance in Gram-negative bacteria, including E. coli [6, 7]. Several β-lactamases (ESβLs, AmpC enzymes, and carbapenemases) have been previously reported in fecal E. coli isolates [13–15].

In the present study, 100% of 50 E. coli isolates were found to be sensitive to imipenem and 13 (26%) of 50 isolates were resistant or showed reduced susceptibility to CAZ, CTX-M, or ATM. The carbapenem susceptibility results indicated that our isolates did not harbor carbapenemase, while 26% (13/50) of the E. coli isolates harbored ESβL and/or AmpC β-lactamase. Two of 13 isolates exhibited reduced susceptibility to cephamycins (FOX and CTT).

Phenotypic screening for the presence of different types of β-lactamases was conducted using E. coli isolates. Thirteen E. coli isolates were selected for screening of ESβL and AmpC β-lactamase production using CAZ/CAL-ESβL, and CTT/CXT-AmpC E-test strips were used to detect ESβL production. Using phenotypic detection methods, all isolates were found to produce ESβL, while two isolates phenotypically produced AmpC enzyme. A battery of PCR assays was conducted to detect bla ESβL genes and AmpC plasmid-mediated genes in the 13 E. coli isolates. Therefore, class A and class C β-lactamase genes were tested. The PCR-purified product was subjected to DNA sequencing to identify the gene variants. The results of molecular characterization of bla genes are shown in Table 2. PCR amplification and DNA sequencing analyses of the PCR products showed that all isolates possessed a CTX-M-type ESβL and that bla CTX-M-15 was present in 1 isolate, while two isolates contained bla CTX-M-14. Other CTX-M families were not detected. The gene encoding CMY-2 enzyme was detected in two E. coli isolates. CMY-2-positive isolates are concomitant with CTX-M-15. All E. coli isolates (n = 13) were positive for bla TEM-1, while 61.5% and 23% of the isolates contained bla OXA-1 and bla SHV-1, respectively. The increase in expression of the AmpC β-lactamases may mask the recognition of ESβLs [16]. Therefore, in the present study, the genotypic methods revealed that all 13 strains were ESβL CTX-M-positive, while phenotypic methods showed that 11 strains were ESβL-positive and two strains were AmpC enzyme-positive. AmpC-producing strains producing CTX-M-15 may act as a dormant reservoir for ESβLs.

Numerous studies have documented a remarkable increase in intestinal colonization rates with ESβL- and AmpC enzyme-producing Enterobacteriaceae in many countries [2, 10, 11, 14–17]. The prevalence of ESβL-producing E. coli fecal isolates varies widely from country to country, from region to region, and at different time periods. A high incidence of fecal carriage rate of ESβL-producing E. coli has been observed in Asia, Africa, and South America [13, 14, 18–21], while a significantly lower prevalence of ESβL-producing E. coli fecal isolates was reported in most European countries [22, 23]. In Argentina, the rate of fecal carriage of Enterobacteriaceae-resistant strains to third-generation cephalosporins was 26.8% [20]. Villar et al. [20] reported that 20.22% and 6.7% of fecal strains were colonized by ESβL- and AmpC enzyme-producing Enterobacteriaceae [20]. In Egypt, Al-Agamy et al. reported that 22.6% and 3.22% of hospitalized patients were colonized by ESβL- and AmpC-positive E. coli, respectively. The bla CTX-M-like gene was the predominant ESβL gene, detected in 71.4% of ESβL-producing E. coli isolates [21]. In a recent study in Egypt, Bassyouni et al. reported that 21% and 3% of patients were colonized by ESβL- and AmpC-producing E. coli, respectively. They also found that bla SHV gene was the predominant ESβL gene, detected in 81.8% of the resistant E. coli isolates [13]. In Korea, 20.3% of fecal Enterobacteriaceae members were ESβLs [19]. In India, the prevalence of ESβL-positive E. coli isolates was 19% in healthy volunteers from the community [14]. In Libya, 13.4% and 6.7% of E. coli isolates were ESβLs- and AmpC-positive, respectively [18]. In a previous study in Saudi Arabia, 17.7% of strains were found to be ESβL-positive [24]. A high (26.1%) prevalence was detected in inpatients, followed by outpatients (15.4%), and the lowest prevalence rate (13.1%) was detected in healthy individuals [24]. In the present study, the prevalence of ESβL-producing E. coli was 26%. Despite differences in the date and region of isolation, the prevalence of fecal carriage rate of ESβL in the present study (26%) was in agreement with the prevalence (26.1%) reported by Kader et al. In contrast, the prevalence rate of ESβL-producing Enterobacteriaceae was 2.9% among healthy Swedish children. Escherichia coli containing CTX-M β-lactamase predominated, and only one E. coli isolate harbored genes encoding for CMY [22]. The carriage rate of ESβL- and AmpC enzyme-producing E. coli was 3.57% and 2.38% among 84 Danish army recruits, respectively. bla CTX-M-14 gene was the predominant ESβL gene detected in three (100%) ESβL-producing E. coli isolates, while bla CMY-2 was detected in two AmpC enzyme-producing E. coli isolates [23]. In Spain, the prevalence of ESβL and AmpC enzyme carriers was 5.06% and 0.59%, respectively [25]. bla CTX-M genes were the ESβL dominating genes (96.15%) and CTX-M-14 was the most prevalent gene (50%), followed by CTX-M-15 (40%). CMY-2 was the most prevalent gene (81.25%), followed by DHA-1 (18.75%) [25].

MICs were determined for ESβL- and AmpC enzyme-producing E. coli (n = 13) isolates. The results of MIC are shown in Table 2.

In conclusion, a high incidence of carriage of ESβL-positive E. coli fecal isolates among hospitalized patients in Riyadh was detected, reaching 26%, with bla CTX-M-15 (84.6%) being the most predominant gene. The emergence of fecal carriage of CMY-2-producing E. coli among hospitalized patients has been reported to be 4%. These outcomes emphasize the importance of the intestinal tract as a reservoir for ESβL- and AmpC enzyme-producing E. coli, which may lead to nosocomial infection. The admission of colonized fecal carriers of ESβL- and AmpC-positive E. coli to the medical setting increases the possibility of other patients acquiring infection in the same hospital. Our results emphasize the necessity for continuous surveillance in hospitals to detect the ESβL-, AmpC enzyme-, and carbapenemase-producing strains and multidrug strains as well applying effective strategies for antimicrobial therapy and infection control measures to decrease the abuse and misuse of antimicrobial agents against resistant strains and to prevent their spread.

Acknowledgments

The authors extend their appreciation to the Deanship of Scientific Research at King Saud University for funding the work through the research group Project no. RGP-038.

Competing Interests

The authors declare that they have no competing interests.

References

  • 1.Bhargava A., Hayakawa K., Silverman E., et al. Risk factors for colonization due to carbapenem-resistant enterobacteriaceae among patients exposed to long-term acute care and acute care facilities. Infection Control and Hospital Epidemiology. 2014;35(4):398–405. doi: 10.1086/675614. [DOI] [PubMed] [Google Scholar]
  • 2.Woerther P.-L., Burdet C., Chachaty E., Andremont A. Trends in human fecal carriage of extended-spectrum β-lactamases in the community: toward the globalization of CTX-M. Clinical Microbiology Reviews. 2013;26(4):744–758. doi: 10.1128/cmr.00023-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Karah N., Haldorsen B., Hermansen N. O., et al. Emergence of OXA-carbapenemase- and 16S rRNA methylase-producing international clones of Acinetobacter baumannii in Norway. Journal of Medical Microbiology. 2011;60(4):515–521. doi: 10.1099/jmm.0.028340-0. [DOI] [PubMed] [Google Scholar]
  • 4.Yezli S., Shibl A. M., Memish Z. A. The molecular basis of β-lactamase production in Gram-negative bacteria from Saudi Arabia. Journal of Medical Microbiology. 2015;64(2):127–136. doi: 10.1099/jmm.0.077834-0. [DOI] [PubMed] [Google Scholar]
  • 5.Guzmán-Blanco M., Labarca J. A., Villegas M. V., Gotuzzo E. Extended spectrum β-lactamase producers among nosocomial Enterobacteriaceae in Latin America. Brazilian Journal of Infectious Diseases. 2014;18(4):421–433. doi: 10.1016/j.bjid.2013.10.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Pfeifer Y., Cullik A., Witte W. Resistance to cephalosporins and carbapenems in Gram-negative bacterial pathogens. International Journal of Medical Microbiology. 2010;300(6):371–379. doi: 10.1016/j.ijmm.2010.04.005. [DOI] [PubMed] [Google Scholar]
  • 7.Cantón R., Coque T. M. The CTX-M beta-lactamase pandemic. Current Opinion in Microbiology. 2006;9(5):466–475. doi: 10.1016/j.mib.2006.08.011. [DOI] [PubMed] [Google Scholar]
  • 8.Dallenne C., da Costa A., Decré D., Favier C., Arlet G. Development of a set of multiplex PCR assays for the detection of genes encoding important β-lactamases in Enterobacteriaceae. Journal of Antimicrobial Chemotherapy. 2010;65(3):490–495. doi: 10.1093/jac/dkp498. [DOI] [PubMed] [Google Scholar]
  • 9.Clinical and Laboratory Standards Institute (CLSI) Document. M100-24. Wayne, Pa, USA: Clinical and Laboratory Standards Institute (CLSI); 2014. Performance standards for antimicrobial susceptibility testing; Twenty-fourth informational supplement performance standards for antimicrobial susceptibility testing. [Google Scholar]
  • 10.Severin J. A., Lestari E. S., Kloezen W., et al. Faecal carriage of extended-spectrum β-lactamase-producing Enterobacteriaceae among humans in Java, Indonesia, in 2001-2002. Tropical Medicine and International Health. 2012;17(4):455–461. doi: 10.1111/j.1365-3156.2011.02949.x. [DOI] [PubMed] [Google Scholar]
  • 11.Li B., Sun J.-Y., Liu Q.-Z., Han L.-Z., Huang X.-H., Ni Y.-X. High prevalence of CTX-M β-lactamases in faecal Escherichia coli strains from healthy humans in Fuzhou, China. Scandinavian Journal of Infectious Diseases. 2011;43(3):170–174. doi: 10.3109/00365548.2010.538856. [DOI] [PubMed] [Google Scholar]
  • 12.Sanchez G. V., Master R. N., Karlowsky J. A., Bordon J. M. In vitro antimicrobial resistance of urinary Escherichia coli isolates among U.S. outpatients from 2000 to 2010. Antimicrobial Agents and Chemotherapy. 2012;56(4):2181–2183. doi: 10.1128/AAC.06060-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bassyouni R. H., Gaber S. N., Wegdan A. A. Fecal carriage of extended-spectrum β-lactamase- and AmpC- producing Escherichia coli among healthcare workers. Journal of Infection in Developing Countries. 2015;9(3):304–308. doi: 10.3855/jidc.5633. [DOI] [PubMed] [Google Scholar]
  • 14.Mathai D., Kumar V. A., Paul B., et al. Fecal carriage rates of extended-spectrum β-lactamase-producing Escherichia coli among antibiotic naive healthy human volunteers. Microbial Drug Resistance. 2015;21(1):59–64. doi: 10.1089/mdr.2014.0031. [DOI] [PubMed] [Google Scholar]
  • 15.Jørgensen S. B., Samuelsen Ø., Sundsfjord A., et al. High prevalence of faecal carriage of ESBL-producing Enterobacteriaceae in Norwegian patients with gastroenteritis. Scandinavian Journal of Infectious Diseases. 2014;46(6):462–465. doi: 10.3109/00365548.2014.896031. [DOI] [PubMed] [Google Scholar]
  • 16.Yilmaz N. O., Agus N., Bozcal E., Oner O., Uzel A. Detection of plasmid-mediated AmpC β-lactamase in E. coli and K. pneumoniae . Indian Journal of Medical Microbiology. 2013;31(1):53–59. doi: 10.4103/0255-0857.108723. [DOI] [PubMed] [Google Scholar]
  • 17.Bui T. M. H., Hirai I., Ueda S., et al. Carriage of Escherichia coli producing CTX-M-type extended-spectrum β-lactamase in healthy Vietnamese individuals. Antimicrobial Agents and Chemotherapy. 2015;59(10):6611–6614. doi: 10.1128/aac.00776-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Ahmed S. F., Ali M. M. M., Mohamed Z. K., Moussa T. A., Klena J. D. Fecal carriage of extended-spectrum β-lactamases and AmpC-producing Escherichia coli in a Libyan community. Annals of Clinical Microbiology and Antimicrobials. 2014;13, article 22 doi: 10.1186/1476-0711-13-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Ko Y. J., Moon H.-W., Hur M., Park C.-M., Cho S. E., Yun Y.-M. Fecal carriage of extended-spectrum β-lactamase-producing Enterobacteriaceae in Korean community and hospital settings. Infection. 2013;41(1):9–13. doi: 10.1007/s15010-012-0272-3. [DOI] [PubMed] [Google Scholar]
  • 20.Villar H. E., Baserni M. N., Jugo M. B. Faecal carriage of ESBL-producing enterobacteriaceae and carbapenem-resistant Gram-negative bacilli in community settings. Journal of Infection in Developing Countries. 2013;7(8):630–634. doi: 10.3855/jidc.2900. [DOI] [PubMed] [Google Scholar]
  • 21.Al-Agamy M. H., Ali M. S., Salem M. M., Mohamed T. R. Faecal colonization by extended-spectrum beta-lactamase-producing Escherichia coli from hospitalized patients. New Egyptian Journal of Microbiology. 2008;19:285–314. [Google Scholar]
  • 22.Kaarme J., Molin Y., Olsen B., Melhus Å. Prevalence of extended-spectrum beta-lactamase-producing Enterobacteriaceae in healthy Swedish preschool children. Acta Paediatrica. 2013;102(6):655–660. doi: 10.1111/apa.12206. [DOI] [PubMed] [Google Scholar]
  • 23.Hammerum A. M., Lester C. H., Jakobsen L., Porsbo L. J. Faecal carriage of extended-spectrum β-lactamase-producing and AmpC β-lactamase-producing bacteria among Danish army recruits. Clinical Microbiology and Infection. 2011;17(4):566–568. doi: 10.1111/j.1469-0691.2010.03340.x. [DOI] [PubMed] [Google Scholar]
  • 24.Kader A. A., Kumar A., Kamath K. A. Fecal carriage of extended-spectrum β-lactamase-producing Escherichia coli and Klebsiella pneumoniae in patients and asymptomatic healthy individuals. Infection Control and Hospital Epidemiology. 2007;28(9):1114–1116. doi: 10.1086/519865. [DOI] [PubMed] [Google Scholar]
  • 25.Garrido A., Seral C., Gude M. J., et al. Characterization of plasmid-mediated β-lactamases in fecal colonizing patients in the hospital and community setting in Spain. Microbial Drug Resistance. 2014;20(4):301–304. doi: 10.1089/mdr.2013.0109. [DOI] [PubMed] [Google Scholar]

Articles from BioMed Research International are provided here courtesy of Wiley

RESOURCES