ABSTRACT
Deacetylcephalosporin C synthase (DACS), a 2-oxoglutarate-dependent oxygenase synthesized by Streptomyces clavuligerus, transforms an inert methyl group of deacetoxycephalosporin C (DAOC) into an active hydroxyl group of deacetylcephalosporin C (DAC) during the biosynthesis of cephalosporin. It is a step which is chemically difficult to accomplish, but its development by use of an enzymatic method with DACS can facilitate a cost-effective technology for the manufacture of semisynthetic cephalosporin intermediates such as 7-amino-cephalosporanic acid (7ACA) and hydroxymethyl-7-amino-cephalosporanic acid (HACA) from cephalosporin G. As the native enzyme showed negligible activity toward cephalosporin G, an unnatural and less expensive substrate analogue, directed-evolution strategies such as random, semirational, rational, and computational methods were used for systematic engineering of DACS for improved activity. In comparison to the native enzyme, several variants with improved catalytic efficiency were found. The enzyme was stable for several days and is expressed in soluble form at high levels with significantly higher kcat/Km values. The efficacy and industrial scalability of one of the selected variants, CefFGOS, were demonstrated in a process showing complete bioconversion of 18 g/liter of cephalosporin G into deacetylcephalosporin G (DAG) in about 80 min and showed reproducible results at higher substrate concentrations as well. DAG could be converted completely into HACA in about 30 min by a subsequent reaction, thus facilitating scalability toward commercialization. The experimental findings with several mutants were also used to rationalize the functional conformation deduced from homology modeling, and this led to the disclosure of critical regions involved in the catalysis of DACS.
IMPORTANCE 7ACA and HACA serve as core intermediates for the manufacture of several semisynthetic cephalosporins. As they are expensive, a cost-effective enzyme technology for the manufacture of these intermediates is required. Deacetylcephalosporin C synthase (DACS) was identified as a candidate enzyme for the development of technology from cephalosporin G in this study. Directed-evolution strategies were employed to enhance the catalytic efficiency of deacetylcephalosporin C synthase. One of the selected mutants of deacetylcephalosporin C synthase could convert high concentrations of cephalosporin G into DAG, which subsequently could be converted into HACA completely. As cephalosporin G is inexpensive and readily available, the technology would lead to a substantial reduction in the cost for these intermediates upon commercialization.
INTRODUCTION
Semisynthetic cephalosporins, a class of β-lactam antibiotics, have shown remarkable effectiveness in the treatment of infectious diseases. Together with penicillins, they comprise nearly 65% of anti-infectives used worldwide. Their high specificity and low toxicity, coupled with the evolvability of newer generations of antibiotics, have led to β-lactams being by far the most frequently used anti-infectives in clinical medicine (1, 2). The growing incidence of resistant isolates and the need for effective broad-spectrum antibiotics constantly drive the development of semisynthetic β-lactam antibiotics, which are obtained primarily from three core intermediates, namely, 7-aminodeacetoxy-cephalosporanic acid (7ADCA), 7-amino-cephalosporanic acid (7ACA)/hydroxymethyl-7-amino-cephalosporanic acid (HACA), and 7-amino-3-vinyl-cephalosporanic acid (7AVCA).
The current process for the production of 7ADCA involves several steps, consisting of chemical ring expansion of penicillin G (PenG) to cephalosporin G (CephG) followed by enzymatic hydrolysis by PenG amidase (3). Although 7ADCA is inexpensive due to the low cost of penicillin G and is used in the manufacture of active pharmaceutical ingredients (APIs) such as cephalexin, the presence of an inactive methyl group at the third position of its cephem moiety limits its industrial utility. 7ACA is currently manufactured by a two-stage enzymatic process from cephalosporin C (4, 5) (Fig. 1A) and is used for making APIs such as cefalotin, cefaloglycin, etc. Far more significantly, HACA, a deacetylated derivative of 7ACA, is used for producing prominent APIs such as cefuroxime axetil. There has been progress to simplify the current process for manufacturing 7ACA from a two-step to a single-step enzymatic process (6). Since cephalosporin C is inherently chemically unstable, the need for additional steps in removing the associated impurities during the manufacture of cephalosporin C leads to the high cost of 7ACA. Despite the high cost, 7ACA and its derivative HACA are widely used and remain remarkably attractive for the evolution of newer generations of semisynthetic cephalosporins due to their versatility for derivatization from the cephem third position in addition to the seventh amino position. Currently, one-third of cephalosporins are manufactured from penicillins, while the remaining two-thirds are synthesized from 7ACA/HACA and similar intermediates. There exists a tremendous need for an alternate route for the production of these β-lactam bulk intermediates, which needs to be far more cost-effective and which will also drastically reduce the negative environmental impact.
FIG 1.
Schematics of existing and proposed routes of synthesis of HACA and 7ACA. (A) Current process of synthesis of 7ACA and HACA from cephalosporin C. (B) Biosynthetic reaction catalyzed by DACS. (C) Proposed route of synthesis of 7ACA and HACA from CephG.
Native penicillins and cephalosporins are produced by a variety of bacteria and fungi, and their genetic and biochemical pathways have been well characterized (7). It is known that 2-oxoglutarate (2-OG)-dependent and related oxygenases are involved in the biosynthesis of at least four families of β-lactam antibiotics and β-lactamase inhibitors, namely, the penicillins, cephalosporins, clavams, and carbapenems. They catalyze a wide range of reactions, including hydroxylations, desaturations, and oxidative ring closures (8). Deacetylcephalosporin C synthase (DACS) (encoded by cefF), one of the 2-OG-dependent oxygenases involved in the biosynthesis of cephalosporins, carries out a critical transformation of an inert cephem methyl group of deacetoxycephalosporin C (DAOC) into an active hydroxyl group of deacetylcephalosporin C (DAC) in the presence of iron, oxygen, ascorbic acid, and 2-oxoglutarate (9, 10) (Fig. 1B). It is a step which is chemically difficult to accomplish and which offers a second substitution site for derivatization in cephalosporins. For instance, cephalosporin G, alternatively known as CephG or DAOG, is an abundantly available analogue of DAOC. It is less expensive, and its phenylacetyl group can be readily cleaved by PenG amidase. Efficient transformation of CephG by DACS can lead to a novel intermediate, deacetylcephalosporin G (DAG), and upon chemical/enzymatic modification can lead to the formation of 7ACA or HACA (Fig. 1C). Thus, the biocatalytic strategy for the development of an alternate route of synthesis is focused on DACS and became the object for further investigation.
The cefF gene from Streptomyces clavuligerus, coding for DACS, has been cloned and sequenced, and the biochemical parameters have been characterized (9, 10, 11). When cefF from S. clavuligerus was expressed in Escherichia coli and evaluated for catalytic efficiency toward CephG, a commercially available substrate, it showed negligible activity. Sequence comparison of DACS suggests 71% similarity at the nucleotide level and 59% similarity at the amino acid level to deacetoxycephalosporin C synthase (DAOCS) (also called expandase), another 2-OG-dependent oxygenase involved in the ring expansion of penicillin into cephalosporin (10). To date, a total of 17 variant crystal structures of DAOCS have been produced, thus offering greater detail regarding its coordination chemistry, the residues involved in binding the substrate, and the cosubstrate, which facilitated the development of a possible catalytic mechanistic model (12, 13, 14, 15, 16). However, rational alterations based on crystallographic data for DAOCS resulted in only limited improvement in the ring expansion activity of penicillin G, whereas random mutagenesis using conventional chemical mutagenesis, error-prone PCRs, shuffling of the family of expandase genes, and directed-evolution studies could increase expandase activity dramatically (17, 18, 19, 20). The contrasting activity levels observed between rational and random mutagenesis studies reflect the limitations of current understanding of catalytic mechanisms derived from static crystallographic data and hence the need for adopting random, semirational, computational modeling and rational mutagenesis strategies for the systematic evolution of DACS as an industrial biocatalyst. Functional analysis of large numbers of mutants thus accumulated may provide insights toward fundamental understanding of the structure-function relationship of DACS and may lead to further refinement of rational engineering strategies. Hence, the objective of this work was to improve the activity of DACS by using the above-mentioned approach and also to rationalize the functional conformation by homology modeling.
MATERIALS AND METHODS
Materials.
All chemicals and reagents were purchased from USB or Sigma-Aldrich Chemicals Pvt. Ltd., USA, or from Merck Specialties Private Ltd., India, unless otherwise specified. Oligonucleotides were synthesized and supplied by Microsynth GMBH, Switzerland, or Eurofins MWG, India. Restriction enzymes, the pUC19 vector, and strains were obtained from either New England BioLabs Inc., USA, or Gene Technologies, India. The pET24a vector, E. coli strain BL21(DE3), and the Bugbuster reagent were purchased from Novagen, USA. Kanamycin was supplied by Bio Basic Canada Inc., Canada. The deoxynucleoside triphosphate (dNTP) mix was purchased from 5 Prime, Germany. The Kapa polymerase kit was purchased from Kapa Biosystems, USA. The S. clavuligerus strain was obtained from the American Type Culture Collection (ATCC), USA. Bradford reagent and protein marker were purchased from Bio-Rad, USA. C18 Xterra columns (50 by 4.6 mm; 5 μm) were obtained from Waters, USA. The DNeasy plant mini-gDNA isolation kit was supplied by Qiagen, Germany, and growth medium components were obtained from Becton Dickinson, USA. Highly purified cephalosporin G and deacetylcephalosporin G were supplied by the Process Development Laboratory, Orchid Chemicals and Pharmaceuticals Ltd., India. 2-Oxoglutarate was obtained from SD Fine-Chem Ltd., India. DNA sequencing was facilitated by Eurofins Genomics India Private Ltd., India.
Cloning of the cefF gene from S. clavuligerus in E. coli BL21(DE3).
The S. clavuligerus strain (ATCC 27064) was inoculated in yeast-malt-glucose (YMG) medium and incubated at 25°C and 180 rpm for 48 h. Once the culture reached an optical density at 600 nm (OD600) of 3, it was pelleted by centrifugation at 16,000 rpm for 15 min, and the genomic DNA was isolated using the DNeasy plant mini-gDNA isolation kit (Qiagen) as recommended by the supplier. The cefF gene (accession number M63809) was amplified by PCR using 5′GCATATGGCGGACACGCCCGTACC3′ (forward) and 5′CCCGGCTTGAATGCAACGACGAGCAT3′ (reverse) primers, 2 U Deep Vent DNA polymerase, 200 μM dNTPs, 10% dimethyl sulfoxide (DMSO), Deep Vent DNA polymerase buffer, 1 mM MgSO4, and water in a final reaction volume of 100 μl. The PCR conditions consisted of an initial denaturation for 5 min at 95°C followed by 24 cycles consisting of denaturation at 95°C for 40 s, annealing at 60°C for 1 min, and extension at 72°C for 5 min, with a final extension at 72°C for 15 min. The hydroxylase gene amplicons were purified with the Qiaex II gel extraction kit (Qiagen) and cloned into the pUC19 vector through blunt-end ligation using the SmaI restriction site with a standard cloning protocol (21), resulting in pOBTF. Subsequently, the hydroxylase gene fragment was released by restriction digestion with NdeI/EcoRI and ligated into similarly digested pET24a(+) vector to give the pOCPLF vector and transformed into competent E. coli BL21(DE3) cells.
Deacetylcephalosporin C synthase expression in E. coli.
A glycerol stock of recombinant E. coli BL21(DE3) was inoculated in 10 ml LB medium containing kanamycin (75 μg/ml) for overnight growth at 37°C at 220 rpm. The overnight culture was subcultured in 50 ml fresh LB medium and further cultivated at 37°C at 220 rpm. When the OD600 reached 0.6, 50 μl of 100 mM IPTG (isopropyl-β-d-thiogalactopyranoside) was added, and the cultivation was further continued for 4 h at 25°C. Subsequently, pellets at an OD of 3 were prepared, suspended in 200 μl resuspension buffer containing 50 mM Tris-HCl (pH 7.5), 0.1 mM dithiothreitol (DTT), 0.01 mM EDTA, 10% glycerol, and 50 mM glucose, and stored at −80°C until further use in activity measurements, SDS-PAGE analysis, and protein concentration determination.
Preparation of crude extract of deacetylcephalosporin C synthase from E. coli.
After thawing the expression cell pellets for 10 min at room temperature, 40 μl of Bugbuster reagent was added and incubated at 25°C for 30 min at 220 rpm in an orbital shaker to facilitate lysis. The crude lysate was centrifuged at 13,000 rpm for 10 min. The supernatant was collected for catalytic assay, protein concentration determination, and SDS-PAGE analysis of the soluble fraction; the pellet fraction was resuspended in 240 μl of resuspension buffer, and 30 μl of it was used in SDS-PAGE analysis to determine the extent of inclusion body formation. The protein concentration was determined by the Bradford method (22) using bovine serum albumin (BSA) as the standard. Samples for determination of expression profiles were denatured at 100°C and subjected to SDS-PAGE using standard protocols (21). Upon completion of electrophoresis, the gel was stained with Coomassie blue for the detection and analysis of the expression pattern of DACS.
Catalytic assay of deacetylcephalosporin C synthase.
A 30-μl aliquot of crude lysate was mixed with 30 μl of assay mix containing 710 mM Tris-HCl, 18 mM ascorbic acid, 90 mM 2-oxoglutaric acid, 0.2 mM FeSO4, and 1.125% CephG and incubated in a shaker at 25°C at 220 rpm. After 30 min, the reaction was quenched with 60 μl of absolute methanol and centrifuged at 13,000 rpm for 5 min. The supernatant was collected and used for analysis by high-pressure liquid chromatography (HPLC).
Monitoring and quantitation of deacetylcephalosporin C synthase activity by HPLC.
HPLC analysis was performed using either an Agilent Technologies 1200 series liquid chromatographic system or a Hitachi LaChrom Elite series liquid chromatographic system containing a C18 Xterra column (5 μm; 50 by 4.6 mm). The separation was effected under isocratic elution using 30% acetonitrile in 0.25% NaH2PO4 · H2O (pH 2.4) at a flow rate of 2.5 ml/min. The peak area was used for quantitative estimation and comparison studies using a reference standard.
Mutagenic cefF library creation. (i) Random mutagenesis.
The pOBTF vector was used as the template for error-prone PCR mutagenesis. The amplification was carried out with 20 pmol of 5′ATCGGTGCGGGCCTCTTCGCTATT3′ and 5′CTCACTCATTAGGCACCCCAGGCT3′ primers in a reaction mix containing 10% DMSO, Taq DNA polymerase buffer, 2.5 U Taq DNA polymerase enzyme, various concentrations of dNTPs, and water in a final reaction volume of 100 μl and amplified as described above. Three different mutagenesis reactions were employed in which dATP, dGTP, and dCTP were biased and maintained at 100 μM and the remaining complement of dNTPs were maintained at 500 μM, while the fourth variant had a dual bias of 50 μM (each) dATP and dTTP with their complementing dCTP and dGTP at 500 μM each. The amplicons were purified, subjected to restriction enzyme digestion by NdeI and EcoRI, ligated to similarly digested expression vector pET24a, and transformed into competent E. coli strain BL21(DE3). Recombinants were screened for inserts by colony PCR using 20 pmol of 5′GCATATGGCGGACACGCCCGTACC3′ and 5′CCCGGCTTGAATGCAACGACGAGCAT3′ primers in a reaction mix containing 10% DMSO, 10× Taq DNA polymerase buffer, 1 U Taq DNA polymerase enzyme, and 80 μM dNTPs in a total reaction volume of 50 μl using the PCR conditions described above. Alternately, the Genemorph II kit (GMK) was used for random mutagenesis with various template concentrations as recommended by supplier. Briefly, Mutazyme reaction buffer (5 μl), dNTP mix (supplied with the kit) (1 μl), 20 μM T7 forward primer (1.5 μl), 10 μM cefF reverse primer (5′TCTATGAATTCTCATCCGGCCTGCGGCTC3′, 2.5 μl), 100 to 400 ng of template DNA, Mutazyme II polymerase (1 μl), and DMSO (2 μl) were added to a PCR tube, and the reaction volume was made up to 50 μl with water. Mutagenic amplification was performed with an initial denaturation step at 95°C for 5 min followed by 30 cycles consisting of denaturation at 95°C for 45 s, annealing at 60°C for 40 s, and extension at 72°C for 80 s, with a final extension for 10 min at 72°C. The PCR product was purified and cloned into the pET24a(+) vector using standard ligation procedures and transformed into E. coli BL21(DE3). The recombinant clones were grown in LB medium in 96-well microtiter plates and stored as glycerol stocks until further use for expression and screening.
(ii) Rational combination of mutations.
Site-directed mutagenesis to create variants with combinations of mutations was carried out by using the megaprimer PCR strategy (23). Briefly, oligonucleotides carrying mutations were added to template DNA along with dNTPs, Vent DNA polymerase, 10× Vent DNA polymerase buffer, DMSO, and water in a total reaction volume of 50 μl. The final amounts of dNTPs, primers, Deep Vent DNA polymerase, polymerization buffer, and DMSO were 0.15 mM, 0.2 pM, 0.02 U, 1×, and 10%, respectively. Thermal cycling of putative mutagenic templates consisted of initial denaturation at 95°C for 5 min followed by 30 cycles of denaturation at 95°C for 40 s, annealing at 60°C for 30 s, and elongation at 72°C for 2 min, with a final extension at 72°C for 15 min. Once the amplification was complete, the PCR product was purified and subjected to megaprimer PCR. The procedure consists of mixing 10 μl of template DNA (70 ng), 12 μl of megaprimer (170 ng), 1.5 μl of 5 mM dNTP mix, 3.5 μl of 25 mM MgCl2, 1 μl of Kapa polymerase, 10 μl of 5× Kapa GC buffer, and 12 μl of water in a reaction volume of 50 μl. The final concentrations of the dNTPs and MgCl2 are 150 μM and 1.75 mM, respectively. Upon mixing of the reaction components, amplification was carried out by maintaining the mixture at 68°C for 10 s and then denaturation at 95°C for 5 min, followed by 25 cycles of denaturation at 98°C for 20 s, annealing for 30 s at 65°C, and elongation at 68°C for 6 min, with a final extension at 68°C for 20 min. Subsequently, the PCR product was purified, digested with DpnI restriction enzyme for 2 h at 37°C, and used for transforming competent E. coli BL21(DE3). After overnight incubation at 37°C, putative mutant clones were inoculated in LB, plasmids were isolated from overnight culture and subjected to restriction digestion using standard molecular biology protocols to identify the mutant clones, and the positive clones were stored as glycerol stocks at −80°C.
Expression of the mutagenic cefF library of clones.
Glycerol stocks of the putative mutant cefF library of clones were inoculated in 96-well plates and expressed in deep-well blocks as described earlier. Upon completion of expression, the cell pellets were harvested by centrifugation in an Eppendorf microplate centrifuge at 4,000 rpm for 10 min at 4°C and were stored at −80°C until further use for activity measurements.
Screening of mutant deacetylcephalosporin C synthase enzyme library.
After thawing expression pellets at room temperature for 10 min, 150 μl of 50 mM Tris (pH 7.5) and 15 μl of Bugbuster reagent were added to each well, and the block was left in an orbital shaker for 20 min at room temperature at 260 rpm to facilitate the release of enzyme. After cell lysis, 30 μl of the lysate from each well of the deep-well block was transferred to a new plate, and 30 μl of assay mixture containing 90 mM CephG, 137 mM 2-oxoglutaric acid, 68 mM ascorbic acid, and 5 mM FeSO4 was added. After mixing the reaction components thoroughly, the assay plate was left in an orbital shaker for 3 h at room temperature at 260 rpm. The reaction was quenched with the addition of 60 ml of 100% methanol in each well, the mixture was centrifuged for 10 min at 4,000 rpm in a microplate centrifuge, and the supernatant was used for estimation of product concentration by HPLC. The mutant clones with improved activity were subjected to reconfirmation by activity measurements from shake flask expression experiments, and the identities of the mutations were confirmed by DNA sequencing.
Preparation of variants of deacetylcephalosporin C synthase enzyme for process reaction.
Native and selected mutant variants of DACS were expressed in LB medium at larger volumes as described above. About 20 g of cell pellets of variants of DACS, including native hydroxylase, in separate experiments, was suspended in 50 ml of buffer containing 50 mM phosphate and 0.6 M NaCl. After stirring the suspension for 30 min at 4°C, 40 mg of lysozyme was added and stirred for another 30 min at 4°C. The contents were sonicated with a Labsonic M ultrasonic processor, using a titanium probe of 10 mm in diameter, with a cycle of 0.6 s and amplitude of 70% for 30 min in 3 cycles of 10 min each with constant stirring at 4°C. After sonication, 2.5 ml of 10% polyethyleneimine (PEI) was added and stirred for 2 h at 4°C, and the mixture was centrifuged at 13,000 rpm for 30 min. The protein concentration in the supernatant was estimated using the Bradford method, and the soluble enzyme was stored at −80°C until further use in process reactions.
Purification of mutants of deacetylcephalosporin C synthase enzyme.
About 8 g of recombinant E. coli BL21(DE3) cell pellets of variants of DACS, in separate experiments, were suspended in 80 ml of resuspension buffer containing 50 mM Tris-HCl (pH 8.0), 0.01 mM EDTA, 1 mM DTT, 10% glucose, and 10% glycerol. After complete suspension, 10 mg of lysozyme was added and stirred for a further 30 min. The contents were sonicated as described above for 20 min in 2 cycles of 10 min each with constant stirring at 4 to 8°C. After sonication, 400 μl of 10% streptomycin sulfate and 80 μl of 10% PEI were added to the sonicated mix and stirred for another 20 min. Subsequently, the entire mixture was centrifuged at 10,000 rpm for 30 min at 4°C. The supernatant obtained from the earlier step was transferred to an XK16/20 DEAE-Sepharose FF column equilibrated with buffer A containing 50 mM Tris-HCl (pH 8.0), 0.01 mM EDTA, and 1 mM DTT. After washing, bound protein was eluted with buffer B containing 50 mM Tris-HCl (pH 8.0), 0.01 mM EDTA, 1 mM DTT, and 1 M NaCl using stepwise gradients of 0 to 12%, 12 to 18%, 18 to 25%, 25 to 40%, and 40 to 100%. Fractions collected from the 12 to 18% and 18 to 25% gradients were pooled, diluted four times and loaded onto an XK16/20 Q Sepharose FF column equilibrated with buffer A. The bound protein was subsequently eluted using buffer B with stepwise gradients as described above. The DACS enzyme eluted from the 18 to 25% gradient was concentrated using Amicon Ultra-15 centrifugal filter units, and the concentrated protein solution was injected into a Superdex 75pg gel filtration column equilibrated with buffer A. Fractions containing active protein were pooled, concentrated using Amicon Ultra-15 centrifugal filter units, and subjected to gel filtration again using the Superdex 75pg column. To this, glycerol was added to a final concentration of 10% and stored.
Determination of kinetic parameters of mutants of deacetylcephalosporin C synthase.
The kinetics parameters (Km and kcat) were determined using three independent experiments for both wild-type deacetylcephalosporin C synthase and selected mutants. Each experiment was conducted at substrate concentrations of 0.5, 1, 2, 3, 4, 5, 6, 8, and 10 mM using quantities of proteins specific to each variant enzyme in a total reaction volume of 300 μl. The consumption of substrate at all concentrations was less than 10% and displayed a linear reaction profile. All measurements were performed using 50 μl of a 6× stock solution of cofactors (30 mM 2-oxoglutarate, 15 mM ascorbate, 1.5 mM FeSO4, and 200 mM Tris-HCl [pH 7.8]) mixed with 100 mM CephG in volumes appropriate to obtain the desired substrate concentration, and water was added to make up the volume to 250 μl. The reaction was initiated by adding 50 μl of the enzyme solution and was carried out at 25°C by continuously mixing the reactants at 1,000 rpm using an Eppendorf Mixmate. The reaction was terminated at 15 min by the addition of an equal volume of 100% methanol. The reaction mix was vortexed, incubated for 5 min, and centrifuged at 13,000 rpm, and the supernatant was used for quantitative estimation by HPLC. The amount of product formed was estimated using a standard linear plot created using a DAG standard. The kinetic parameters were estimated by fitting experimental data using the Lineweaver-Burk double-reciprocal method.
Process-level biotransformation reaction of CephG to DAG by mutants of deacetylcephalosporin C synthase.
Amounts of 360 mg of CephG and 120 mg of NaHCO3 were mixed in 6 ml of demineralized (DM) water (pH ∼6.9) in a beaker. Upon complete dissolution of CephG, the cofactors 2-oxoglutaric acid, ascorbic acid, and FeSO4 were added to give final concentrations of 84 mM, 27 mM, and 0.3 mM, respectively, followed by the addition of a 1% concentration of the antifoaming agent poly propylene glycol (PPG) to control frothing. After stirring the mixture thoroughly, 158 mg of selected mutants of DACS enzyme were added to beakers, and the reaction volume was made up to 20 ml using DM water. The reaction pH was maintained at 6.8 at room temperature, and the progress of the reaction was monitored by HPLC at regular intervals until completion.
Process-level biotransformation of deacetylcephalosporin G to HACA by CefFGOS.
Upon completion of the biotransformation reaction of CephG to DAG by CefFGOS as described above, the pH of the solution was adjusted to 7.5 using 13% ammonia, and 60 units of recombinant PenG amidase from Alcaligenes faecalis was added to facilitate the hydrolysis of the phenylacetyl moiety. Quantitative monitoring and analysis of HACA formation were performed using HPLC. HACA was found to elute with a retention time of 0.3 min. Further refinement of quantitation of HACA was performed by a modification of the elution profile with an SS Intersil ODS-3V column(250 mm by 4.6 mm; 5 μm), using an elution buffer containing 0.14% tetra-n-butyl-ammonium hydrogen sulfate in 30% acetonitrile with a flow rate of 1 ml/min. DAG and HACA were found to elute at 12.6 and 3.2 min, respectively.
RESULTS AND DISCUSSION
Biotransformation of CephG by native deacetylcephalosporin C synthase.
The decaetylcephalosporin C synthase gene (cefF) from S. clauvuligerus was cloned in E. coli, and the recombinant clone was confirmed by restriction digestion of the isolated plasmid and by DNA sequencing. The enzyme was expressed in E. coli BL21(DE3), and the crude extract was assayed for its activity under standard assay conditions, except 1 mM CephG was used as the substrate (11). When the HPLC chromatogram was examined, no detectable peak could be observed, and this was further confirmed by spiking with the reference standard. As CephG was an unnatural substrate, the assay was repeated under higher substrate concentrationss of 2.5 mM, 5 mM, and 10 mM. Examination of chromatograms revealed the presence of a small peak corresponding to the retention time of the product (DAG) in assay samples containing 10 mM CephG. The observation of a barely detectable peak indicated negligible catalytic activity and hence poor affinity and activity toward the unnatural substrate CephG. Analysis by SDS-PAGE revealed that the native enzyme was found predominantly in inclusion bodies. The wild-type enzyme was found to be labile and lost activity rapidly, as no activity could be detected after 24 h when stored at 4°C.
High-throughput screening of the mutagenic enzyme library by HPLC.
The challenge in modifying multiple parameters of DACS, such as catalytic efficiency, stability, and solubilization, required the generation and screening of a large library of putative mutant clones. This necessitated first the development of a rapid method for the detection of DAG in mutant clones. The initial method of detecting the formation of DAG at 260 nm involved a linear gradient elution profile consisting of mobile phase A (6.25 mM ammonium acetate [pH 3.2]) and mobile phase B (80% methanol, 20% mobile phase A) at a flow rate of 1 ml/min in a Symmetry C18 column (75 by 4.6 mm; 3.5 μm) with a run time of 30 min. DAG and CephG were found to elute with retention times of 8.2 and 12.5 min, respectively. In order to reduce the run time and facilitate rapid screening of a large number of clones, the column length was reduced to 50 mm, elution profiles were altered to isocratic conditions with a modified buffer based on acetonitrile and phosphate, and the flow rate was increased to 2.5 ml/min as described in Materials and Methods. This led to a reduction in the run time from 30 min to 1.8 min, with substantial resolution between DAG and CephG, eluting at 0.55 and 1.1 min, respectively (see Fig. S1 in the supplemental material). This rapid method was found to be effective in screening the large number of clones generated.
Evolution of mutant deacetylcephalosporin C synthase enzymes. (i) Random mutagenesis by biasing dNTPs concentrations.
cefF was subjected to random mutagenesis by biasing dNTP concentrations and using error-prone Taq DNA polymerase in the first round of evolution as described in Materials and Methods. The assay duration was extended for 3 h in order to detect putative mutant enzymes with enhanced stability. Screening of approximately 20,000 clones in equal proportion and further confirmation by activity analysis using normalized cell pellets led to identification of point mutation isolates, such as P72L, T90A, V150A, P186L, V221A, V221T, M229V, T273A, A311V, Y38C T90A, and E16G T90A T304A. A model of the wild-type DACS structure was produced by MODELLER using the structure of DAOCS (Fig. 2A) as obtained through the ModBase database (24). The structure as such available in ModBase server is an apo structure. The Fe(II) atom was transferred into the DACS model at its corresponding coordinate position consistent with the template DAOCS crystal structure (PDB ID 1UOB), with the help of SwissPDBViewer v 4.0.2 software (25). The model structures of DACS were also produced using SwissPDBViewer. The spatial organization and binding sites for substrate and cosubstrate have been mapped and appear to be highly conserved between DAOCS and DACS (Fig. 2B). T90 is located in a highly conserved region at positions 91 to 96 of DAOCS, DACS, and DAOCS/DACS, tentatively designated the N-terminal region (11) (see Fig. S3 in the supplemental material) and was identified repeatedly under multiple PCR conditions. P72, located in close proximity to the Arg75/76 residues (suggested to be involved in substrate recognition) and A311, is located in the C-terminal region implicated in enhanced catalysis as deduced from functional analysis of a structural analogue of DAOCS (12). As a result, these three sites were combined by site-directed mutagenesis for further evolution. When the combination isolates were expressed and assayed, one of the mutant isolates, denoted the CefFTM mutant, was found to show 2.3-fold-enhanced activity for biotransformation of CephG in relation to the wild type. Table 1 lists representative mutants with the lower and upper limits of relative activity observed during each round of evolution, while the detailed list is included in Table S1 in the supplemental material.
FIG 2.
Homology modeling of DACS structure and mapping of mutant positions. (A) Crystal structure of DAOCS as obtained from PDB (PDB ID 1UOB). (B) Modeled structure and mapping of mutations in DACS. The N-terminal region (blue circle), C-terminal arm (green), and positions of the Arg75 and -6 residues are highlighted. The substrate CephG and the cosubstrate (αKG) are represented in stick models in magenta and pink, respectively. The Fe(II) is represented as sphere in red, and residues altered by mutations are denoted in stick models.
TABLE 1.
Representative list of DACS mutants and their relative activities
| Round of evolution (template) | Mutant | No. of mutations | Mutation(s) | Relative activity (fold)a |
|---|---|---|---|---|
| 1 (CefFW/cefFW) | W5 | 1 | V221T | 1.2 |
| W1 | 1 | P72L | 1.3 | |
| W3 | 1 | P186L | 1.5 | |
| W10 | 3 | E16G T90A T304A | 2.1 | |
| W11 | 2 | T90A+P72Lb | 1.9 | |
| W12 | 2 | T90A+A311Vb | 2.1 | |
| W13 | 3 | T90A+P72L+A311V (CefFTM)b | 2.3 | |
| 2 (cefFTM) | TM2 | 5 | T90A+P72L+A311V+V206I+A210V | 2.6 |
| TM3 | 5 | T90A+P72L+A311V+P7L+A237V | 2.8 | |
| TM10 | 4 | T90A+P72L+A311V+R250L | 3.8 | |
| TM9 | 4 | T90A+P72L+A311V+F195L | 4.1 | |
| TM15 | 5 | T90A+P72L+A311V+P7L+T273Ab | 3.4 | |
| TM13 | 6 | T90A+P72L+A311V+V206I+A210V+T273Ab | 3.6 | |
| TM23 | 6 | T90A+P72L+A311V+A40V+M229I+T273A (CefFM)b | 4.4 | |
| 3 (cefFM) | M7c | 7 | T90A+P72L+A311V+A40V+M229I+T273A+V221P | 5.3 |
| M9d | 7 | T90A+P72L+A311V+A40V+M229I+T273A+R182S | 5.8 | |
| M12 | 7 | T90A+P72L+A311V+A40V+M229I+T273A+S260G | 6.6 | |
| M13 | 7 | T90A+P72L+A311V+A40V+M229I+T273A+S251F | 7.5 | |
| M24 | 9 | T90A+P72L+A311V+A40V+M229I+T273A+M184I+I193V+F267Lb | 5.0 | |
| M26 | 8 | T90A+P72L+A311V+A40V+M229I+T273A+V171L+F267Lb | 8.0 | |
| M30 | 9 | T90A+P72L+A311V+A40V+M229I+T273A+V171L+R182W+F267L (CefFS)b | 10.0 | |
| 4 (cefFS) | S5 | 10 | T90A+P72L+A311V+A40V+M229I+T273A+V171L+R182W+F267L+V226I | 11.0 |
| S1 | 10 | T90A+P72L+A311V+A40V+M229I+T273A+V171L+R182W+F267L+N313D | 12.0 | |
| S2 | 10 | T90A+P72L+A311V+A40V+M229I+T273A+V171L+R182W+F267L+R91G | 13.0 | |
| S6 | 11 | T90A+P72L+A311V+A40V+M229I+T273A+V171L+R182W+F267L+A241V+V307A | 15.0 | |
| S17 | 12 | T90A+P72L+A311V+A40V+M229I+T273A+V171L+R182W+F267L+T96S+G255D+A280Sb | 13.0 | |
| S18 | 12 | T90A+P72L+A311V+A40V+M229I+T273A+V171L+R182W+F267L+T96S+A241V+V307Ab | 15.0 | |
| S15 | 12 | T90A+P72L+A311V+A40V+M229I+T273A+V171L+R182W+F267L+R91G+A241V+V307Ab | 17.0 | |
| 5 (cefFOS) | OS1 | 10 | T90A+P72L+A311V+A40V+M229I+T273A+V171L+R182W+F267L+G108D (CefFGOS) | 19.0 |
Fold enhancement in activity of the mutant variant DACS enzyme relative to the activity of the wild-type DACS enzyme.
Combination generated from the indicated round by site-directed mutagenesis.
Site saturation mutagenesis at position 221.
Site saturation mutagenesis at position 182.
(ii) Random mutagenesis by varying the template concentrations.
cefF is GC rich, and the mutational bias exhibited by Taq DNA polymerase could skew the representation of random mutant libraries and possibly reduce the size of the mutant collection. In order to disclose further mutations causing enhanced activity, the strategy was modified to gradually accumulate single mutations by varying the template concentrations, which was followed by sequential in vitro recombination of these single mutations (26, 27). Random mutagenesis with the GeneMorph II kit as recommended by the supplier by using the cefFTM template with amounts of 100, 200, and 400 ng each in three separate reactions was performed as described in Materials and Methods. Screening of the resulting mutant library of nearly 15,000 clones led to the disclosure of 13 additional mutations (P7L, A40V, T51M, F195L, V206I, A210V, V226I, M229I, M233I, A237V, R250L, E258K, and A273A) and generation of variants containing 1 or 2 mutagenic substitutions. Many of these mutations appeared to be located in and around the active site (Fig. 2B), and hence additional combinations containing 1 or 2 additional mutations were constructed by site-directed mutagenesis. In addition, in a parallel investigation, the T90 and V221 residues were subjected to site-directed saturation mutagenesis using cefFTM as the template and the 5′CCCAGGTGNNSAGAACCGGTTCCTACACGGACTACTC3′ and 5′GGCGTCCTCCACSNNCGGCAAGCTTACCAGTTC3′ oligonucleotides, respectively, to identify substitutions with improved activity. Activity analysis of this mutagenic enzyme library revealed 2.6- to 4.4-fold increases with reference to the wild-type enzyme (Table 1; see Table S1 in the supplemental material). The mutant variant with a 4.4-fold improvement in activity was denoted the CefFM mutant, and its corresponding gene served as the parent for the third round of evolution. As variation of the template concentration was found to disclose a significant number of beneficial mutations, this was maintained as the primary vehicle for random mutagenesis using the GeneMorph kit for further generation of a diverse mutagenic library in conjunction with site saturation and quantitative structure-activity relationship (QSAR) prediction-based site-directed mutagenesis. Random mutagenesis using 100 ng of cefFM template and screening of approximately 20,000 clones led to the disclosure of 13 novel mutations (E82D, V171L, V171M, A177V, R182S, M184I, I193V, E209Q, L236V, V249I, S260G, S251F, and F267L) in a collection of 11 mutant isolates (Table 1; see Table S1 in the supplemental material), and many of these residues were found to map in the active-site region. In addition, R182W, identified by QSAR-like predictions for enhanced activity, was subjected to saturation site-directed mutagenesis using cefFM as the template and the 5′ GGC CAT CCG SNN CGG CTC GTG CTC CGC GGA CCG GTG C3′ oligonucleotide, while V221P and V221H was introduced by site-directed mutagenesis. The V171L, I193V, R182W, and F267L mutations, located in the active-site region, were sequentially introduced by site-directed mutagenesis to generate additional variants. Activity measurements of these isolates showed an improvement ranging from 5.3- to 10-fold with respect to the wild type (Table 1; see Table S1 in the supplemental material). With a view to improving expression activity to a high level, the gene for a mutant with 10-fold-improved activity, named cefFS, was subjected to codon optimization, resulting in cefFOS. Both cefFS and cefFOS were used as templates for evolution of additional variants through random mutagenesis by using 200 ng of template in the next round. Screening of clones led to the development of 11 novel mutations (M53L, R91G, T96S, G108D, I149T, V226I, A241V, G255D, V307A, A311M, and N313D). Additional combinations with selected residues using site-directed mutagenesis led to the creation of variants with activity enhancement ranging from 11- to 19-fold (Table 1; see Table S1 in the supplemental material). The mutant isolate with the highest activity was designated CefFGOS.
Expression profiling and kinetic characterization.
In order to deduce the functional role of these mutations, cefFTM, cefFM, cefFS, cefFOS, and cefFGOS clones, along with cefFW (wild type), were expressed, and their crude extracts were prepared and analyzed by SDS-PAGE (see Fig. S2 in the supplemental material). SDS-PAGE analysis showed the presence of detectable amount of wild-type deacetylcephalosporin C synthase in the soluble fraction, while a majority of the expressed protein was found to be in inclusion bodies. The mutant variants showed increasing levels of solubilization with a corresponding reduction in inclusion body formation, suggesting that several mutations possibly enhanced folding of protein. It was also observed, as expected, that the total cellular expression of deacetylcephalosporin C synthase was much higher for cefFOS and cefFGOS. Determination of the total protein, activity, and relative activity (Table 2) of selected mutants further reinforced the SDS-PAGE observation. In these mutants, the relative activity had increased many fold but the enhancement in protein concentration was marginal. This may be because several mutations had altered the kinetic properties of the enzyme as well. Hence, the enzymes from these select variants were further purified to near homogeneity, and their kinetic parameters were determined. The results are presented in Table 3. It is observed that in addition to enhancement in the levels of expression and solubilization, the Km increased by 1.7-fold, while kcat increased by about 35-fold, for CefFGOS compared to CefFW (wild type). The increase in Km along with the increase in kcat can be attributed to the active-site enlargement, which causes the enzyme to release the product efficiently, coupled with weak substrate binding leading to high kcat and Km (28). The kinetic parameters Km, kcat, and kcat/Km reported in this study for deacetylcephalosporin C synthase correlate well with the reported values for deacetoxycephalosporin C synthase and its substrate analogue penicillin G (20).
TABLE 2.
Expression and activity profile of wild-type and mutant DACSa
| Enzyme | Mutations | Activity (Ub/ml) | Protein concn (mg/ml) | Relative activity (fold)c |
|---|---|---|---|---|
| CefFW | None (wild type) | 0.020 | 0.777 | 1 |
| CefFTM | P72L+T90A+A311V | 0.045 | 1.058 | 2.3 |
| CefFM | CefFTM + A40V+M229I+T273A | 0.096 | 1.090 | 4.8 |
| CefFS | CefFM + V171L+R182W+F267L | 0.168 | 1.093 | 8.4 |
| CefFOS | CefFM + V171L+R182W+F267L | 0.258 | 1.100 | 12.9 |
| CefFGOS | CefFOS + G108D | 0.308 | 1.214 | 15.4 |
Mutant variants of DACS and the wild type were expressed, and their expression profile and activity were determined using crude extracts.
One unit of enzyme activity is defined as the amount of DACS required to cause the formation of 1 μmol of DAG per minute from CephG at 25°C and pH 7.
Fold enhancement in the activity of the mutant variant enzyme relative to the activity of the wild-type enzyme.
TABLE 3.
Kinetic parameters of DACS for the wild type and mutants
| Enzyme | Km (mM)a | kcat (s−1)a | kcat/Km (M−1 s−1) | Relative kcat/Km (%)b |
|---|---|---|---|---|
| CefFW (wild type) | 2.58 ± 0.20 | 0.055 ± 0.005 | 21.4 | 100 |
| CefFTM | 2.58 ± 0.11 | 0.122 ± 0.007 | 47.3 | 222 |
| CefFM | 4.64 ± 0.28 | 0.326 ± 0.002 | 70.33 | 330 |
| CefFS | 7.24 ± 0.68 | 1.805 ± 0.08 | 249.3 | 1166 |
| CefFOS | 9.20 ± 0.71 | 2.302 ± 0.049 | 250.2 | 1,170 |
| CefFGOS | 4.41 ± 0.14 | 1.899 ± 0.01 | 430.6 | 2,022 |
Mean ± standard error from three independent experiments.
Percentage of the kcat/Km value of the mutant DACS enzyme relative to the kcat/Km value of the wild-type DACS enzyme.
Mapping of mutations and their mechanistic implications.
Mapping analysis of mutations in deacetylcephalosporin C synthase indicates that majority of mutations (65%) are located in a conformationally flexible nonstructural region (12, 13, 14) (Fig. 2B). Alignment of amino acid mutations identified in this study by Clustal W (29) with DAOCS and DAOCS/DACS revealed that 11 (Y38C, R91N, T96S, G108D, I193V, F195L, M233I, A237V, G255D, T273A, and T304G) of the 44 residues in DACS have been mutated to residues found in native DAOCS (see Fig. S3B in the supplemental material), while 5 (V150A, F195L, V221T, G255D, and T304G) of the 44 residues have been mutated into native DAOCS/DACS (see Fig. S3C in the supplemental material) and three of the mutations (F195L, G255D, and T304G) remain common between the DAOCS, DACS, and DAOCS/DACS enzymes. When cefE, cefF, and cefEF were expressed under identical conditions in E. coli and compared, it was found that the level of soluble expression was highest for cefEF, while cefE had the lowest level of expression (unpublished data). This suggests that 11 of the 44 mutations are likely to enhance the activity of the deacetylcephalosporin C synthase enzyme. This again correlates with their location within the vicinity of the putative active site, except for G255 and V150, which could affect folding and hence enhance soluble expression. The V307A, A311M, A311V, and N313D mutations lie in the C-terminal arm of deacetylcephalosporin C synthase, and the C-terminal region has been implicated in various roles, such as enclosure of the active site, a shelter for reactive intermediates, forming a “lid” over the active site, and binding and/or orienting the penicillin substrate during catalysis in case of deacetoxycephalosporin C synthase (12). The T304G mutation creates the highly conserved IGGNY C-terminal sequence (postitions 304 to 307) and was previously identified to be part of the hinge section (positions 299 to 302 in DAOCS) and suggested to facilitate movement of the C-terminal arm during catalysis (13). Sequence comparison of DAOCS, DACS, and DAOCS/DACS reveals a conserved stretch of residues spanning the region from position 75 to 105 (see Fig. S3A in the supplemental material), designated the N-terminal region, and its functional significance remains unknown (11). Site-directed mutagenesis studies of mutation of Arg74 (Arg75 in DACS) of DAOCS to hydrophobic residue Ile or hydrophilic Gln (i.e., R74I or R74Q) show uncoupling of 2-oxoglutarate and penicillin N/penicillin G oxidation, although differentially, hence suggesting a role for substrate recognition and selection (12). The P72L, E82D, T90A, T90G, T90D, R91G, R91N, T96S, and G108D mutations are mapped as part of the N-terminal region (Fig. 2B). The evolution of enhancement in catalytic efficiency was found to be incremental except in the case of single point mutations such as R91G and G108D, where the enhancement was found to be substantial, and these are found to map in the N-terminal region, thereby strengthening the possibility for a role in substrate recognition and selection. Closer scrutiny of the mapping of the A177V, R182W/S, M184I, P186L, I193V, V221A, V226I, M229I, and V249I residues suggests that they are located in the immediate vicinity of the putative active site as deduced from our model. The F195 and F267 (β11) residues, located in β sheets 6 and 11, respectively, are an integral part of the active site, and F267 is located within one of the most highly conserved stretches of the deacetylcephalosporin C synthase sequence, containing R262 (see Fig. S3A in the supplemental material). Invariably, all of these residues carry either an isoleucine or leucine mutation, which possibly shifts the putative active site of deacetylcephalosporin C synthase from a smaller and mildly polar environment to an enlarged hydrophobic environment. M180/R258 in DAOCS (M184/R262 in DACS) is known to form a binding packet for highly polar 2-oxoglutarate during the catalysis by DAOCS (14). Substitution of adjacent residues by hydrophobic residues might retard the binding of 2-oxoglutarate while facilitating the binding and departure of the hydrophobic and bulky substrate CephG and thus can rationalize the observed increase in Km and kcat. Coupling/decoupling studies of 2-oxoglutarate and substrate and their kinetics can lead to further dissection of functional roles of these residues.
Biotransformation of CephG to DAG to HACA and industrial utility of CefFGOS.
To assess the potential for application as an industrial biocatalyst, the CefFTM, CefFM, CefFS, CefFOS, and CefFGOS mutants along with CefFW were evaluated for biotransformation of 1.8% CephG, and the resulting data are presented in Table 4. It is observed that the CefFOS and CefFGOS variants could convert 100% of the substrate in 150 and 90 min, respectively, which demonstrates the potential for large-scale transformations (Fig. 3A). When the concentration of CephG was doubled to 3.6%, CefFGOS was found to transform equally well. Upon completion of the transformation, the pH of the transformation mixture of CefFGOS was adjusted to 7.5 using ammonia, the phenylacetyl moiety was hydrolyzed by PenG amidase, and the results were analyzed by HPLC. HACA was found to elute with a retention time of 0.3 min, and the reaction was nearing completion in about 30 min, with a basal level of residual DAG seen (Fig. 3B). In contrast to native enzyme, the CefFGOS enzyme variant was found to be stable for 7 days at 4 to 8°C without loss of any catalytic activity, thus removing an additional impediment towards development of an alternate process for the production of HACA and 7ACA.
TABLE 4.
Process-level bioconversion of CephG by wild-type DACS and mutants
| Enzyme | Reaction time (min) | Conversion (%) |
|---|---|---|
| CefFW (wild type) | 240 | 4.9 |
| CefFTM | 240 | 20.4 |
| CefFM | 240 | 34.0 |
| CefFS | 240 | 87.6 |
| CefFOS | 150 | 100 |
| CefFGOS | 90 | 100 |
FIG 3.
Process-level biotransformation of CephG to HACA by CefFGOS. (A) CephG (1.8%) was treated with CefFGOS and analyzed by HPLC. The elution profile illustrates complete bioconversion of CephG into DAG, with its retention time marked at its peak. (B) HPLC elution profile illustrating near-complete bioconversion of DAG formed in the previous reaction into HACA by PenG amidase.
Future directions.
In this study, numerous deacetylcephalosporin C synthase mutants were identified, and one of the selected variants, CefFGOS, showed increased activity for conversion of CephG to deacetylcephalosporin G. This mutant is likely to play an important role in the commercialization of a novel route for HACA manufacture. Mapping of mutations led to identification of potential residues and regions for further directional alteration that can enhance catalytic activity significantly, thus simplifying commercial scalability. In an equally significant development, localization of mutations and deduction of their possible role in catalytic activity have led to the disclosure of critical regions involved in catalysis and the putative active site. Further characterization using molecular, biochemical, and structural studies can facilitate fundamental understanding of mechanism of catalysis, particularly pertaining to the choice of substrates, the process of their selection, and regulation of the catalytic activity, in the near future.
Supplementary Material
ACKNOWLEDGMENTS
This work was supported by Orchid Chemicals & Pharmaceuticals Ltd., Chennai, India.
We thank K. B. Ramachandran, IIT Chennai, for critical reading of the manuscript.
Funding Statement
The research work was done as part of in-house research activity supported by the organization.
Footnotes
Supplemental material for this article may be found at http://dx.doi.org/10.1128/AEM.00174-16.
REFERENCES
- 1.Elander RP. 2003. Industrial production of β-lactam antibiotics. Appl Microbiol Biotechnol 61:385–392. doi: 10.1007/s00253-003-1274-y. [DOI] [PubMed] [Google Scholar]
- 2.Brakhage AA. 1998. Molecular regulation of β-lactam biosynthesis in filamentous fungi. Microbiol Mol Biol Rev 62:547–585. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Salehpour P, Reza RY, Hajmohammadi R. 2012. Determination of optimal operation conditions for production of cephalosporin G from penicillin G potassium. Org Process Res Dev 16:1507–1512. doi: 10.1021/op300076q. [DOI] [Google Scholar]
- 4.Bianchi D, Bortolo R, Golini P, Cesti P. 1998. Enzymatic transformation of cephalosporin C to 7-ACA by simultaneous action of immobilized d-amino acid oxidase and glutaryl-7-ACA acylase. Appl Biochem Biotechnol 73:257–268. doi: 10.1007/BF02785660. [DOI] [Google Scholar]
- 5.Pollegioni L, Rosini E, Molla G. 2013. Cephalosporin C acylase: dream and (/or) reality. Appl Microbiol Biotechnol 97:2341–2355. doi: 10.1007/s00253-013-4741-0. [DOI] [PubMed] [Google Scholar]
- 6.Conti G, Pollegioni L, Molla G, Rosini E. 2014. Strategic manipulation of an industrial biocatalyst-evolution of a cephalosporin C acylase. FEBS J 281:2443–2455. doi: 10.1111/febs.12798. [DOI] [PubMed] [Google Scholar]
- 7.Aharonowitz Y, Cohen G, Martin JF. 1992. Penicillin and cephalosporin biosynthetic genes: structure, organization, regulation and evolution. Annu Rev Microbiol 46:461–495. doi: 10.1146/annurev.mi.46.100192.002333. [DOI] [PubMed] [Google Scholar]
- 8.Hewitson KS, Granatino N, Welford RWD, Mcdonough MA, Schofield CJ. 2005. Oxidation by 2-oxoglutarate oxygenases: non-haem iron systems in catalysis and signaling. Philos Trans R Soc A 363:807–828. doi: 10.1098/rsta.2004.1540. [DOI] [PubMed] [Google Scholar]
- 9.Jensen SE, Westlake DWS, Wolf S. 1985. Deacetoxycephalosporin C synthetase and deacetoxycephalosporin C hydroxylase are two separate enzymes in Streptomyces clavuligerus. J Antibiot 2:263–265. [DOI] [PubMed] [Google Scholar]
- 10.Kovacevic S, Miller JR. 1991. Cloning and sequencing of the β-lactam hydroxylase gene (cefF) from Streptomyces clavuligerus: gene duplication may have led to separate hydroxylase and expandase activities in the Actinomycetes. J Bacteriol 173:398–400. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Baker BJ, Dotzlaf JE, Yeh WK. 1991. Deacetoxycephalosporin C hydroxylase of Streptomyces clavuligerus. J Biol Chem 266:5087–5093. [PubMed] [Google Scholar]
- 12.Öster LM, van Scheltinga AC, Valegård K, Hose AM, Dubus A, Hajdu J, Andersson I. 2004. Conformational flexibility of the C terminus with implications for substrate binding and catalysis revealed in a new crystal form of deacetoxycephalosporin C synthase. J Mol Biol 343:157–171. doi: 10.1016/j.jmb.2004.07.049. [DOI] [PubMed] [Google Scholar]
- 13.Lloyd MD, Lee HJ, Harlos K, Zhang ZH, Baldwin JE, Schofield CJ, Charnock JM, Garner CD, Hara T, van Scheltinga ACT, Valegard K, Viklund JAC, Hajdu J, Andersson I, Danielsson Å, Bhikhabhai R. 1999. Studies on the active site of deacetoxycephalosporin C synthase. J Mol Biol 287:943–960. doi: 10.1006/jmbi.1999.2594. [DOI] [PubMed] [Google Scholar]
- 14.Lee H-J, Lloyd MD, Harlos K, Clifton IJ, Baldwin JE, Schofield CJ. 2001. Kinetic and crystallographic studies on deacetoxycephalosporin C synthase (DAOCS). J Mol Biol 308:937–948. doi: 10.1006/jmbi.2001.4649. [DOI] [PubMed] [Google Scholar]
- 15.Lee HJ, Schofield Lloyd MD. 2002. Active site mutations of recombinant deacetoxycephalosporin C synthase. Biochem Biophys Res Commun 292:66–70. [DOI] [PubMed] [Google Scholar]
- 16.Schofield CJ, Zhang Z. 1999. Structural and mechanistic studies on 2-oxoglutarate-dependent oxygenases and related enzymes. Curr Opin Struct Biol 9:722–731. doi: 10.1016/S0959-440X(99)00036-6. [DOI] [PubMed] [Google Scholar]
- 17.Wei C-L, Yang Y-B, Wang W-C, Liu W-C, Hsu J-S, Tsai Y-C. 2003. Engineering Streptomyces clavuligerus deacetoxycephalosproin C synthase for optimal ring expansion activity toward penicillin G. Appl Environ Microbiol 69:2306–2312. doi: 10.1128/AEM.69.4.2306-2312.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Chin HS, Sim J, Sim TS. 2001. Mutation of N304 to leucine in Streptomyces clavuligerus deacetoxycephalosporn C synthase creates an enzyme with increased penicillin analogue conversion. Biochem Biophys Res Commun 287:507–513. doi: 10.1006/bbrc.2001.5552. [DOI] [PubMed] [Google Scholar]
- 19.Hsu JS, Yang YB, Deng CH, Wei CL, Liaw SH, Tsai YC. 2004. Family shuffling of expandase genes to enhance substrate specificity for penicillin G. Appl Environ Microbiol 70:6257–6263. doi: 10.1128/AEM.70.10.6257-6263.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Wei C-L, Yang Y-B, Deng C-H, Liu W-C, Hsu J-S, Lin Y-C, Liaw S-H, Tsai Y-C. 2005. Directed evolution of Streptomyces clavuligerus deacetoxycephalosporin C synthase for enhancement of penicillin G expansion. Appl Environ Microbiol 71:8873–8880. doi: 10.1128/AEM.71.12.8873-8880.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning: a laboratory manual, 2nd ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. [Google Scholar]
- 22.Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. doi: 10.1016/0003-2697(76)90527-3. [DOI] [PubMed] [Google Scholar]
- 23.Barik S. 1996. Site-directed mutagenesis in vitro by megaprimer PCR. Methods Mol Biol 57:203–215. [DOI] [PubMed] [Google Scholar]
- 24.Kazlauskas R, Lutz S. 2009. Engineering enzymes by ‘intelligent’ design. Curr Opin Chem Biol 13:1–2. doi: 10.1016/j.cbpa.2009.02.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Tracewell CA, Arnold FH. 2009. Directed enzyme evolution: climbing fitness peaks one amino acid at a time. Curr Opin Chem Biol 13:3–9. doi: 10.1016/j.cbpa.2009.01.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Pieper U, Webb BM, Barkan DT, Schneidman DD, Schlessinger A, Braberg H, Yang Z, Meng EC, Pettersen EF, Huang CC, Datta RS, Sampathkumar P, Madhusudhan MS, Sjolander K, Ferrin TE, Burley SK, Andrej Sali A. 2011. MODBASE, a database of annotated comparative protein structure models and associated resources. Nucleic Acids Res 39:465–474. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Guex N, Peitsch MC. 1997. SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling. Electrophoresis 18:2714–2723. doi: 10.1002/elps.1150181505. [DOI] [PubMed] [Google Scholar]
- 28.Chen J, Chen H, Shi Y, Hu F, Lao X, Gao X, Zheng H, Yao W. 2013. Probing the effects of the non-active-site mutation Y229W in New Delhi metallo-β-lactamase-1 by site-directed mutagenesis, kinetic studies and molecular dynamic simulations. PLoS One doi: 10.1371/journal.pone.0082080. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.