ABSTRACT
With the aim of optimizing the cloning of novel genes from a genomic pool containing many previously identified homologous genes, we designed a redundant exclusion PCR (RE-PCR) technique. In RE-PCR, a pair of generic amplification primers are combined with additional primers that are designed to specifically bind to redundant, unwanted genes that are a subset of those copied by the amplification primers. During RE-PCR, the specific primer blocks amplification of the full-length redundant gene. Using this method, we managed to clone a number of cry8 or cry9 toxin genes from a pool of Bacillus thuringiensis genomic DNA while excluding amplicons for cry9Da, cry9Ea, and cry9Eb. The method proved to be very efficient at increasing the number of rare genes in the resulting library. One such rare (and novel) cry8-like gene was expressed, and the encoded toxin was shown to be toxic to Anomala corpulenta.
IMPORTANCE Protein toxins from the bacterium Bacillus thuringiensis are being increasingly used as biopesticides against a wide range of insect pests, yet the search for new or improved toxins is becoming more difficult, as traditional methods for gene discovery routinely isolate previously identified clones. This paper describes an approach that we have developed to increase the success rate for novel toxin gene identification through reducing or eliminating the cloning of previously characterized genes.
INTRODUCTION
As a result of the proteinaceous insecticidal toxins produced by Bacillus thuringiensis (Bt), this bacterium has become a commercially successful biopesticide (1). Products based on Bt include formulations of the bacterium itself or the toxin expressed in an alternative host, in particular genetically modified crops (2). Despite the increasing use of these products, there remains a need to discover new toxins with desirable properties; such properties include an increased activity against a given target, activity against a new target pest, or the ability to control a pest that has developed resistance to an existing toxin. A number of different approaches can be used to identify novel toxins, with the traditional one being to screen strains for a desired activity and then isolate the active ingredient. In recent times molecular approaches have been increasingly used, including genome sequencing (3) and PCR techniques. The latter rely on there being conserved regions present in toxin gene families as well as the more variable regions that give toxins their individual characteristics (4). Improved PCR procedures have allowed the successful cloning of Bt toxin genes from complex DNA mixtures prepared from pooled samples (5, 6). A problem with this sort of approach, however, is the high ratio of known or undesired toxin genes in libraries made from these pooled samples, which has made the discovery of new genes increasingly difficult.
The B. thuringiensis Cry8 and Cry9 proteins have significantly different insecticidal spectra despite phylogenetic analyses indicating that they share high sequence similarity in domains I and II (7, 8). Cry8 proteins are toxic to Coleopteran insects, while Cry9 proteins have high activity to Lepidopteran insects (9–12); both are valuable toxins for insect pest management. This paper describes a procedure developed to analyze cry8 and cry9 genes in a DNA pool prepared from 2,000 Bt strains and used to efficiently clone novel isolates.
MATERIALS AND METHODS
Bacterial strains, plasmids, and growth conditions.
Bt strains were isolated from soil samples in China as described previously (6). Escherichia coli DH5α was used for standard transformations, while E. coli SCS110 [rpsL (Strr) thr leu endA thi-1 lacY galK galT ara tonA tsx dam dcm supE44 Δ(lac-proAB) (F′ traD36 proAB lacIqZΔM15)] was used to produce nonmethylated plasmid DNA for transformation of HD73−, a crystal-negative mutant strain of Bt.
The cloning vector pEB was constructed by inserting the pETblue-2 expression region into the StyI-BglII sites of pET-21b. Plasmid pSTK, containing the cry3Aa promoter and STAB-SD sequence, was constructed by Wang et al. (13) and used to express cry genes in HD73−.
E. coli was incubated at 37°C in LB medium (1% NaCl, 1% tryptone, and 0.5% yeast extract), and Bt strains were grown at 30°C on LB agar (1% NaCl, 1% tryptone, 0.5% yeast extract, and 1.3% to 1.5% agar). To select antibiotic-resistant E. coli and Bt strains, ampicillin and kanamycin were added to the culture medium at final concentrations of 100 μg/ml and 50 μg/ml, respectively. All of the cultures were incubated in a rotary shaker at 220 rpm.
Identification of cry8 and cry9 genes from pooled genomic DNA.
Pooled genomic DNA was prepared from 2,000 Bt strains as described by Li et al. (6) and used as the template for PCR. A pair of universal primers, cry_F and cry_R (Table 1), was designed based on an alignment of cry8 and cry9 holotype genes and was used to amplify the toxin-coding regions of these genes. A 50-μl PCR mixture contained 100 ng template DNA, 25 μl 2× PrimeSTAR master mix (TaKaRa, Dalian, China), and 0.2 μmol−l of each primer. The reaction consisted of an initial denaturation step at 94°C for 5 min, 30 cycles of 94°C for 1 min, 54°C for 1 min, and 72°C for 2 min 20 s, and final extension step at 72°C for 10 min. The resulting PCR product was purified using a DNA gel extraction kit (Axygen, Hangzhou, China) and ligated into the Ecl136II site of the pEB vector.
TABLE 1.
Homologues of cry9 and cry8 genes and design of universal amplification primers
| Primer and gene | Sequencea | Location | GenBank accession no. |
|---|---|---|---|
| cry_F | ATGAATCGAAATAATCAAAATGAATAT | ||
| cry9Bb1 | ATGAATCGAAATAATCAAAATGAATAT | 1–27 | AY758316.1 |
| cry9Ca1 | ATGAATCGAAATAATCAAAATGAATAT | 1–27 | Z37527.1 |
| cry9Da1 | ATGAATCGAAATAATCAAAATGAATAT | 1–27 | D85560.1 |
| cry9Db1 | ATGAATCGAAATcATCAAAATGAATAT | 1–27 | AY971349.1 |
| cry9Dc1 | ATGAATCGAAATAATCAAAATGAATAT | 1–27 | KC156683.1 |
| cry9Ea1 | ATGAATCGAAATAATCcAAATGAATAT | 1–27 | AB011496.1 |
| cry9Eb1 | ATGAAcCGAAATAATCAAAATGAtTAT | 1–27 | AX189653.1 |
| cry9Ec1 | ATGAATCGAAATAATCAAAATGAATAT | 1–27 | AF093107.2 |
| cry9Ed1 | ATGAATCGAAATAATCAAAATGAATAT | 1–27 | AY973867.1 |
| cry9Ee1 | ATGAATCGAAATAATCAAAATGAATAT | 1–27 | GQ249296.1 |
| cry9Fa1 | ATGAcTaGAAATAgACAAgATGAATAT | 1–27 | KC156692.1 |
| cry8Aa1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | U04364.1 |
| cry8Ab1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | EU044830.1 |
| cry8Ac1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | KC156662.1 |
| cry8Ad1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | KC156684.1 |
| cry8Ba1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | U04365.1 |
| cry8Bb1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | AX543924.1 |
| cry8Bc1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | AX543926.1 |
| cry8Ca1 | ATGAgTCgAAATAATCAAAATGAgTAT | 1–27 | U04366.1 |
| cry8Db1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | AB303980.1 |
| cry8Ea1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | AY329081.1 |
| cry8Fa1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | AY551093.1 |
| cry8Ga1 | ATGAgTCcgAATAATCAgAAcGAATAT | 1–27 | AY590188.1 |
| cry8Ha1 | ATGAaTCcgAATAATCAgAATGAATAT | 1–27 | AY897354.2 |
| cry8Ia1 | ATGAgTCcgAATAATCAgAATGAgTtT | 1–27 | EU381044.1 |
| cry8Ib1 | ATGAgcCcAAATAATCAAAATGAgTtT | 1–27 | GU325772.1 |
| cry8Ja1 | ATGAgTCcgAATAATCAgAATGAgTAT | 1–27 | EU625348.1 |
| cry8Ka1 | ATGAgTCcAAATAATCtAAATGAATAT | 1–27 | FJ422558.1 |
| cry8Kb1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | HM123758.1 |
| cry8Na1 | ATGAgTCcgAATAATCAAAAcGAATAT | 1–27 | HM640939.1 |
| cry8Pa1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | HQ388415.1 |
| cry8Qa1 | ATGAgTCcAAATAATCAAAATGAATAT | 1–27 | HQ441166.1 |
| cry8Ta1 | ATGAgTCaAAATAATCAAAATGAATAT | 1–27 | KC156673.1 |
| cry_R | GATAAGCAYGACACTAAATTTGC | ||
| cry9Bb1 | GCAAATTTAGTGTtATGCTTATC | 2110–2132 | AY758316.1 |
| cry9Ca1 | GCAAATTTAGTGTCATGCTTATC | 2092–2114 | Z37527.1 |
| cry9Da1 | GCAAATTTAGTGTCATGCTTATC | 2125–2147 | D85560.1 |
| cry9Db1 | GCAAATTTAGTGTCATGCTTATC | 2128–2150 | AY971349.1 |
| cry9Dc1 | GCAAATTTAGTGTCGTGCTTATC | 2125–2147 | KC156683.1 |
| cry9Ea1 | GCAAATTTAGTGTCGTGCTTATC | 2071–2093 | AB011496.1 |
| cry9Eb1 | GCAAATTTAGTGTCATGCTTATC | 2074–2096 | AX189653.1 |
| cry9Ec1 | GCAAATTTAGTGTCATGCTTATC | 2083–2105 | AF093107.2 |
| cry9Ed1 | GCAAATTTAGTGTCGTGCTTATC | 2083–2105 | AY973867.1 |
| cry9Ee1 | GCAAATTTAGTGTCGTGCTTATC | 2089–2111 | GQ249296.1 |
| cry9Fa1 | GCAAATTTAGTGTCATGCTTAaC | 2089–2111 | KC156692.1 |
| cry8Aa1 | GCAAAcTTAGTGgaATGCcTATC | 2104–2126 | U04364.1 |
| cry8Ab1 | GCAAAcTTAGTGgaATGCcTATC | 2122–2144 | EU044830.1 |
| cry8Ac1 | GCAAAcTTAGTGgaATGCcTATC | 2146–2168 | KC156662.1 |
| cry8Ad1 | GCcAAcTTAGTGgaATGCcTATC | 2104–2126 | KC156684.1 |
| cry8Ba1 | GCcAAcTTAGTGgaATGCcTATC | 2092–2114 | U04365.1 |
| cry8Bb1 | GCAAAcTTAGTGgaATGCcTATC | 2107–2129 | AX543924.1 |
| cry8Bc1 | GCAAAcTTAGTGgaATGCcTATC | 2119–2141 | AX543926.1 |
| cry8Ca1 | GCAAAcTTAaTagaATGCcTATC | 2095–2117 | U04366.1 |
| cry8Db1 | GCAAAcTTAGTagaATGCcTATC | 2137–2159 | AB303980.1 |
| cry8Ea1 | GCAAAcTTAGTGgaATGCcTATC | 2074–2096 | AY329081.1 |
| cry8Fa1 | GCAAAcTTAGTGgaATGCcTATC | 2104–2126 | AY551093.1 |
| cry8Ga1 | GCAAAcTTAGTagaATGCcTATC | 2087–2109 | AY590188.1 |
| cry8Ha1 | GCtAATTTAGTagaATGCcTATC | 2089–2111 | AY897354.2 |
| cry8Ia1 | GCAAATTTAaTtgaATGCgTATC | 2113–2135 | EU381044.1 |
| cry8Ib1 | GCAAATTTAaTtgaATGCgTATC | 2156–2138 | GU325772.1 |
| cry8Ja1 | GCAAAcTTAaTagaATGCcTATC | 2101–2123 | EU625348.1 |
| cry8Ka1 | GCAAAcTTAGTcgaATGCcTATC | 2086–2108 | FJ422558.1 |
| cry8Kb1 | GCcAAcTTAGTGgaATGCcTATC | 2092–2114 | HM123758.1 |
| cry8Na1 | GCAAAcTTAGTagaATGCcTATC | 2104–2126 | HM640939.1 |
| cry8Pa1 | GCAAAcTTAGTcgaATGCcTATC | 2095–2117 | HQ388415.1 |
| cry8Qa1 | GCAAAcTTAGTcgaATGCcTATC | 2119–2141 | HQ441166.1 |
| cry8Ta1 | GCAAATTTAaTtgaATGCgTATC | 2149–2171 | KC156673.1 |
Lowercase indicates bases that do not match those of the primer.
The cry9 and cry8 genes in the pooled DNA were classified by PCR-restriction fragment length polymorphism (RFLP) analysis. Genes were amplified from library clones using cry_F and cry_R, digested with HinfI, and then profiled by 2% agarose gel electrophoresis. Clones with different RFLP profiles were selected for sequencing.
Redundant exclusion PCR (RE-PCR).
Primers RE9Da_F and RE9Ea/b_F (Table 2) were designed to specifically hybridize to cry9Da, and to cry9Ea/cry9Eb, respectively. Test reactions were performed in a 20-μl total volume containing 10 ng of cry9Ea and cry9Eb or cry9Da-encoding plasmid DNA, 0.2 μmol liter−l primer RE9Da_F or RE9Ea/b_F, 0.2 μmol liter−l primer cry_F and/or cry_R, and 10 μl 2× PrimeSTAR master mix. PCR consisted of an initial denaturation step at 94°C for 5 min, 30 cycles of 94°C for 1 min, 54°C for 1 min, and 72°C for 2 min 20 s, and a final extension step at 72°C for 10 min.
TABLE 2.
Homologues of cry9 and cry8 genes and design of redundant exclusion primers
| Primer or gene | Sequence | Location | GenBank accession no. |
|---|---|---|---|
| RE9Da_F | AGGATATACACAGCAAGGTATACC AGC | ||
| cry9Bb1 | --AACGAA------CTTTGTTA------ | 1346–1359 | AY758316.1 |
| cry9Ca1 | --GACTTC----TCCTGCTAATGG-AGG | 1323–1343 | Z37527.1 |
| cry9Da1 | AGGATATACACAGCAAGGTATACC-AGC | 1347–1373 | D85560.1 |
| cry9Db1 | -GGACAAA---ATAACGTTCTTCC-ACA | 1366–1388 | AY971349.1 |
| cry9Dc1 | -GGACAAA---ATAACGTTTTGCC-ACC | 1366–1388 | KC156683.1 |
| cry9Ea1 | --CACCAA----TGCAGCTAATAC-GTG | 1335–1355 | AB011496.1 |
| cry9Eb1 | --CACCTC----AGCCCCTAATAC-GTG | 1335–1355 | AX189653.1 |
| cry9Ec1 | --CATTTC----TCCTGCTAATGC-AGG | 1332–1352 | AF093107.2 |
| cry9Ed1 | --CATTTC----TCCTGCTAATGC-AGG | 1332–1352 | AY973867.1 |
| cry9Ee1 | --GACTCA----ACCTTCTACTGG-AGG | 1332–1352 | GQ249296.1 |
| cry9Fa1 | --GTCAAC-----CCACCTAATTC-TGG | 1345–1364 | KC156692.1 |
| cry8Aa1 | TATATTCAAAAACACATACAGCTCTCCA | 1346–1373 | U04364.1 |
| cry8Ab1 | TTTATTCTAAAACACATACAACTGGAGA | 1349–1376 | EU044830.1 |
| cry8Ac1 | TTTATTCTAAAACATATACAACTCCAAA | 1349–1376 | KC156662.1 |
| cry8Ad1 | TTTATTCAAAAACACATACAACTCCATA | 1343–1370 | KC156684.1 |
| cry8Ba1 | AACGTATAAACCAGCTTCCAAAGATATT | 1347–1374 | U04365.1 |
| cry8Bb1 | AAAGTATAATCCAGTTTCCAAAGATATT | 1347–1374 | AX543924.1 |
| cry8Bc1 | AAAGTATAATCCGGTTTCCAAAGATATT | 1347–1374 | AX543926.1 |
| cry8Ca1 | CTTAT-TCGAAGCCAAAACAATTC-GCG | 1322–1347 | U04366.1 |
| cry8Db1 | CGTACTCAAAACCACATACAACTATGCA | 1352–1379 | AB303980.1 |
| cry8Ea1 | CCTATAAT-----CCTG-GATCTGAAGG | 1328–1379 | AY329081.1 |
| cry8Fa1 | CTCATTTTTTCTGATAG-TACGGGAGGG | 1330–1357 | AY551093.1 |
| cry8Ga1 | GGTATCAAAAAGAATCTA-ATGTC-CCA | 1322–1347 | AY590188.1 |
| cry8Ha1 | TGGATACGATATAGCGTTTAGCGAAA-- | 1332–1357 | AY897354.2 |
| cry8Ia1 | TAATTATGAACCTCCAGGCATATCCA-A | 1329–1355 | EU381044.1 |
| cry8Ib1 | TGAATATGATCTTCAACTTTTGTCTA-A | 1332–1358 | GU325772.1 |
| cry8Ja1 | TTTACCTATAATCCTGGATCTGAA-GGT | 1324–1350 | EU625348.1 |
| cry8Ka1 | ATGAAAAAT-----TATCGAACTT---- | 1328–1346 | FJ422558.1 |
| cry8Kb1 | ATGAAAAAT-----CATCGAACTT---- | 1328–1346 | HM123758.1 |
| cry8Na1 | TCTATCTTGTGGGGTG-----GTG-C-- | 1354–1373 | HM640939.1 |
| cry8Pa1 | AGTGTATAAGCCGGTTTCCAAAGATATT | 1341–1368 | HQ388415.1 |
| cry8Qa1 | CTCACTTTCTCTGATAGTACGGGCGGAA | 1327–1354 | HQ441166.1 |
| cry8Ta1 | CGTATAGTAAAACCCATACAGCTATACA | 1346–1373 | KC156673.1 |
| RE9Ea/b_F | GAAAT CACCAA TGCAGCTAATAC GT | ||
| cry9Bb1 | AACTC--------AACGAA------CTTTGTTA---- | 1341–1359 | AY758316.1 |
| cry9Ca1 | GGTAC--------GACTTC----TCCTGCTAATGG-AG | 1318–1342 | Z37527.1 |
| cry9Da1 | GGGATT---TCAGGATATACACAGCAAGGTATACC-AG | 1339–1372 | D85560.1 |
| cry9Db1 | CGTATG---TC-GGACAAA---ATAACGTTCTTCC-AC | 1358–1379 | AY971349.1 |
| cry9Dc1 | CGTATG---TC-GGACAAA---ATAACGTTTTGCC-AC | 1358–1379 | KC156683.1 |
| cry9Ea1 | GAAAT--------CACCAA----TGCAGCTAATAC-GT | 1330–1354 | AB011496.1 |
| cry9Eb1 | GAAAT--------CACCTC----AGCCCCTAATAC-GT | 1330–1354 | AX189653.1 |
| cry9Ec1 | GGTAC--------CATTTC----TCCTGCTAATGC-AG | 1327–1351 | AF093107.2 |
| cry9Ed1 | GGTAC--------CATTTC----TCCTGCTAATGC-AG | 1327–1351 | AY973867.1 |
| cry9Ee1 | GGCAC--------GACTCA----ACCTTCTACTGG-AG | 1327–1351 | GQ249296.1 |
| cry9Fa1 | AGTGTT-------GTCAAC-----CCACCTAATTC-TG | 1363–1387 | KC156692.1 |
| cry8Aa1 | AACAGCGTATTTATATTCAAAAACACATACAGCTCTCC | 1335–1372 | U04364.1 |
| cry8Ab1 | ATCATCTCATCTTTATTCTAAAACACATACAACTGGAG | 1338–1375 | EU044830.1 |
| cry8Ac1 | ATCAACTCAACTTTATTCTAAAACATATACAACTCCAA | 1338–1375 | KC156662.1 |
| cry8Ad1 | ATCATATTATTTTTATTCAAAAACACATACAACTCCAT | 1332–1369 | KC156684.1 |
| cry8Ba1 | AAGACG---TTAACGTATAAACCAGCTTCCAAAGATAT | 1339–1373 | U04365.1 |
| cry8Bb1 | AAGACG---TTAAAGTATAATCCAGTTTCCAAAGATAT | 1339–1373 | AX543924.1 |
| cry8Bc1 | AAGACG---TTAAAGTATAATCCGGTTTCCAAAGATAT | 1339–1373 | AX543926.1 |
| cry8Ca1 | AAAAA-----ACTTAT-TCGAAGCCAAAACAATTC-GC | 1316–1347 | U04366.1 |
| cry8Db1 | GGTTTT----ACGTACTCAAAACCACATACAACTATGC | 1345–1378 | AB303980.1 |
| cry8Ea1 | AACATT---TACCTATAAT-----CCTG-GATCTGAAG | 1320–1348 | AY329081.1 |
| cry8Fa1 | TGCACACA-CCCTCATTTTTTCTGATAG-TACGGGAGG | 1320–1355 | AY551093.1 |
| cry8Ga1 | GACCTT---TAGGTATCAAAAAGAATCTA-ATGTC-CC | 1314–1347 | AY590188.1 |
| cry8Ha1 | GGGATTGATGTTGGATACGATATAGCGTTTAGCGAAA- | 1321–1357 | AY897354.2 |
| cry8Ia1 | GGGAA----TTTAATTATGAACCTCCAGGCATATCCA- | 1322–1344 | EU381044.1 |
| cry8Ib1 | TAGAT----TATGAATATGATCTTCAACTTTTGTCTA- | 1325–1357 | GU325772.1 |
| cry8Ja1 | AACAAC----ATTTACCTATAATCCTGGATCTGAA-GG | 1317–1349 | EU625348.1 |
| cry8Ka1 | GAGTTACATGTATGAAAAAT-----TATCGAACTT--- | 1317–1346 | FJ422558.1 |
| cry8Kb1 | GAGTTACAGGTATGAAAAAT-----CATCGAACTT--- | 1317–1346 | HM123758.1 |
| cry8Na1 | GGCCAC---GTTCTATCTTGTGGGGTG-----GTG-C- | 1346–1373 | HM640939.1 |
| cry8Pa1 | AAG------TTAGTGTATAAGCCGGTTTCCAAAGATAT | 1336–1367 | HQ388415.1 |
| cry8Qa1 | TGCCCCCA-ATCTCACTTTCTCTGATAGTACGGGCGGA | 1317–1353 | HQ441166.1 |
| cry8Ta1 | TGGCTCCCTTACGTATAGTAAAACCCATACAGCTATAC | 1335–1372 | KC156673.1 |
Expression of the cry8-like gene.
To express the truncated cry8-like gene in Bt, a seamless assembly cloning method was used to fuse the truncated gene to DNA encoding the Cry8Ea C-terminal coding region. The primers designed to amplify these two sections, with appropriate overlaps, are listed in Table 3. A 10-μl reaction mix containing 20 ng pSTK plasmid (linearized with BamHI and SalI), 30 ng each of the PCR products, and 5 μl 2× Assembly master mix (Seamless Assembly Cloning kit; CloneSmarter, USA) was incubated at 50°C for 10 min. After transformation of E. coli DH5α, the resulting hybrid (hycry8) was sequenced using an automated DNA sequencer (ABI-3730XL; USA). The recombinant plasmid, isolated from E. coli, was used to transform SCS110 prior to introduction into Bt strain HD73− by electroporation. A single transformant was selected from LB plates containing kanamycin (50 μg/ml) and incubated until sporulation at 30°C. The spore-crystal mixture was washed and resuspended in sterile distilled water, and the suspension was examined by microscopy and SDS-PAGE analysis as described by Shu et al. (14). For proteolytic activation, the toxin crystals were solubilized in 50 mM Na2CO3 (pH 10) and then treated with chymotrypsin (10:1, wt/wt) in phosphate-buffered saline (PBS) and incubated at 37°C for 2 h.
TABLE 3.
Amplification primers
| Primer | Sequence (5′ to 3′) |
|---|---|
| hycry8_F | TGGTGGACAGCAAATGGGTCGGGATCCGATGAATCGAAATAATC |
| hycry8_R | CATTTGGATACAAATCATCCGATAAGCATGACACTAAATTTGCCGC |
| hycry8Ea_F | GGATGATTTGTATCCAAATG |
| hycry8Ea_R | CTCGAGTGCGGCCGCAAGCTTGTCGACTTACTCTACGTCAACAATC |
Insect bioassay.
The insecticidal activity of the spore-crystal mix from the recombinant Bt strain was tested against larvae of 15-day-old Anomala corpulenta, 5-day-old Holotrichia parallela, and 5-day-old Holotrichia oblita. The bioassay diet for these scarab larvae was prepared as described by Yu et al. (15). For initial screening, we used a concentration of 1.0 × 108 CFU g−1soil. Further assays were performed with samples showing toxicity to any of the pests in order to determine 50% lethal concentrations (LC50s). Bioassays were repeated at least twice, and LC50s were calculated using probit analysis.
RESULTS
Identification of cry8 and cry9 genes from pooled genomic DNA.
A library of 2.1-kb PCR products encoding the active portions of cry8/9 toxin genes (Fig. 1A, lane 1), produced from the pooled genomic DNA using primers cry_F and cry_R, was created and subjected to PCR-RFLP analysis. Two hundred clones were tested, and four distinct profile types were detected (Fig. 1B, lanes 1 to 4). Representatives of these were sequenced, and this indicated that the four profiles belonged to cry9Da (100% identity to cry9Da4, accession number GQ249297.1), cry9Ea (99% identity to cry9Ea9, accession number JN651495.1), cry9Eb (99% identity to cry9Eb2, accession number GQ249298.1), and a new cry8-like (86% identity to cry8Ab1, accession number EU044830.1). Figure 2 (solid bars) shows the relative frequencies of these four profiles; 70% of the clones matched the cry9Ea profile, while 5% matched the cry8-like profile.
FIG 1.
PCR product restriction fragment length polymorphism profiles of cloned genes. (A) Lane 1, PCR product from pooled genomic DNA and cry_F/cry_R primers; lane 2, PCR product from pooled genomic DNA and cry_F/cry_R and REcry9Da_F/REcry9Ea/b_F primers; lane 3, PCR product from pooled genomic DNA and REcry9Da_F/cry_R primers; lane 4, PCR product from pooled genomic DNA and REcry9Ea/b_F and cry_R primers; lane 5, PCR product from cry9Ea and cry9Eb template and cry_F/cry_R primers; lane 6, PCR product from cry9Ea and cry9Eb template and cry_F/cry_R and REcry9Ea/b_F primers; lane 7, PCR product from cry9Da template and cry_F/cry_R primers; lane 8, PCR product from cry9Da template and cry_F/cry_R and REcry9Da_F primers; lane M, molecular size marker (DL5000). (B) Lanes 1 to 7, RFLP profiles of cloned cry9Eb, cry9Da, cry9Ea, cry8-like, cry8Fa, cry8Ab-like, and cry8Ea genes, respectively; lane M, molecular size marker (DL2000).
FIG 2.
Proportions of clones in the genomic libraries. The solid bars represent clones isolated from the normal library, while the open bars represent those from the redundant exclusion library.
RE primer PCR.
To exclude known genes from the library, we relied on the fact that the high-fidelity polymerase that we used in our PCRs (PrimeSTAR GXL) lacks a 5′-3′ exonuclease activity, and so polymerization can be halted by the presence of a bound oligonucleotide. We designed primers that would specifically, and tightly, bind to particular cry8/9 genes and thus prevent amplification of the full PCR product by the primers. The primers RE9Da_F and RE9Ea/b_F (Tables 2 and 4) were designed to hybridize to variable regions in domain II of cry9Da and cry9Ea/9Eb, respectively. A number of PCRs were run to test these primers. When the two amplification primers and the two redundant exclusion (RE) primers were all included in a multiplex PCR (Fig. 1A, lane 2), two distinct bands were seen; the 2.1-kb band represents the full-length products amplified by cry_F and cry_R, while the approximately 750-bp band represents the fragment of the gene amplified by RE9Da_F/RE9Ea/b_F and cry_R. The source of this 750-bp band was confirmed in separate reactions involving just an RE primer and cry_R (Fig. 1A, lanes 3 and 4). To confirm that the RE primers could block amplification of the corresponding gene, pairs of reactions were performed using specific genes as templates. Figure 1A (lanes 5 to 8) shows that amplification of the full-length gene is completely (cry9Da [lane 8]) or mostly (cry9Ea/b [lane 6]) inhibited by the appropriate RE primer.
TABLE 4.
Primers and annealing temperatures
| Primer | Base content (%) |
Length (bp) | Melting temp (°C) | |||
|---|---|---|---|---|---|---|
| A | C | G | T | |||
| REDa_F | 40.7 | 22.2 | 22.2 | 14.8 | 27 | 62.0 |
| RE9Ea/b_F | 27.6 | 17.2 | 27.6 | 27.6 | 29 | 68.0 |
| cry_F | 55.6 | 7.4 | 11.1 | 25.9 | 27 | 57.7 |
| cry_R | 39.1 | 21.7 | 17.4 | 21.7 | 23 | 55.2 |
A new library was created from the 2.1-kb PCR product produced using cry_F and cry_R from pooled DNA but this time including the RE primers in the amplification reaction. A total of 200 clones were analyzed by PCR-RFLP, and this time five different profiles were obtained (Fig. 1B, lanes 3 to 7). Two of these profiles (cry9Ea and cry8-like) were the same as previously identified, while the other three corresponded to cry8Fa (99% identity to cry8Fa2, accession number HQ174208.1), cry8Ab-like (99% identity to cry8Ab1-like, accession number JF521572.1), and cry8Ea (99% identity to cry8Ea1, accession number AY329081.1). Although the cry9Ea profile was detected despite the presence of the corresponding RE primer, its frequency had dropped dramatically (Fig. 2, open bars). The cry9Da and cry9Eb profiles had successfully been excluded. In contrast, the frequency of the cry8-like profile rose significantly.
Expression of the novel cry8-like gene.
The cry_F and cry_R primers were designed to amplify the active toxin portion of the cry8/9 genes but not the region encoding the C-terminal crystallization domain (4). To express a complete toxin, we added this C-terminal region from a homologous gene, cry8Ea. Figure 3 shows the sequence of the Cry8-like toxin and the resulting hybrid (hyCry8). The hybrid gene was subcloned into pSTK and introduced into HD73− for expression. The hyCry8 protein was expressed well in this host (Fig. 4C, lane 2) and accumulated as spherical crystals (Fig. 4B). When the protoxin was treated with chymotrypsin (Fig. 4C, lane 3), a 60-kDa protein was obtained, as expected (16).
FIG 3.
Amino acid alignment of the Cry8Ab1, Cry8-like, hyCry8, and Cry8Ea proteins.
FIG 4.
Scanning electron microscopy (SEM) and SDS-PAGE analysis of spore-crystal mixtures. (A) Bt strain HD73−. (B) Bt strain expressing hyCry8. (C) SDS-PAGE. Lane M, protein marker; lane 1, HD73−; lane 2, hyCry8; lane 3, chymotrypsin-treated hybrid.
Insect bioassay.
To evaluate the toxicity of the hybrid protein, the spore-crystal mix of the recombinant Bt strain was tested for insecticidal activity on larvae of 15-day-stage A. corpulenta, 5-day-stage H. parallela, and 5-day-stage H. oblita. At a concentration of 1.0 × 108 CFU g−1 soil, the parent strain HD73− had no insecticidal activity against any of the three bioassayed insects. The strain expressing the hybrid was shown to be toxic to A. corpulenta larvae (Fig. 5) but not to H. parallela or H. oblita.
FIG 5.
Insecticidal activity of a spore-crystal mixture of the hybrid-expressing strain against A. corpulenta.
DISCUSSION
In recent years, many research projects have focused on cloning desired genes from complex DNA samples (metagenomic or pooled DNA) (5, 6, 17–19). In such samples, the distribution of gene homologues can be unequal, and it can be a difficult task to isolate rare forms. Here we have demonstrated the use of redundant exclusion PCR to remove unwanted homologues from a gene pool and thus increase the frequency of rare forms in an amplicon library.
Bt is an insect pathogen which during sporulation produces insecticidal proteins that accumulate in the mother cell and form intracellular parasporal crystals (1, 20). These crystals contain toxins, encoded by cry genes, which are noted for their specific insecticidal activity. Cry proteins have been expressed in crops to control agricultural pests (21, 22). Due to their commercial value, much research has focused on toxin gene discovery, and here we have demonstrated the use of an RE-PCR-based method that can identify new and rare cry gene homologues from a genomic DNA pool and have identified a novel toxin with activity against an economically important pest. The method relies on us being able to identify unique regions in redundant genes and would therefore exclude any otherwise novel genes that happened to share that region. Nonetheless, we have demonstrated that the principle works well, and alternative RE primers can always be designed in an attempt to overcome this potential limitation. The fact that some cry9Ea profiles could still be detected may represent the fact that this process is not 100% efficient and so there can be some background, which will be particularly noticeable for high-abundance genes. Alternatively, polymorphisms in the RE primer region could allow amplification of these variants.
The toxin that we identified by this method is closely related to other Cry8 toxins, and comparison of the active toxin region with all toxins in the nomenclature reveals that the closest match is to Cry8Ab1, with 79% identity. This level of identity is sufficient to consider the toxin novel; studies have shown that just a few amino acid differences in a toxin can determine not only whether or not it is toxic but also to which insect it has toxicity (23). This conclusion is supported by our bioassay data: the variant that we have isolated shows activity against A. corpulenta but not against H. oblita or H. parallela. This contrasts with the case for the following toxins: Cry8N, which showed activity against H. parallela but not against A. corpulenta or H. oblita (24); Cry8Ga, which has activity against the two Holotrichia species but not A. corpulenta (12); Cry8Ab, which has activity against the two Holotrichia species (25); and Cry8Fa and another Cry8-like protein, which have activity against none or all of these three species, respectively (10, 11). Thus, on both the sequence and insect specificity levels, this newly described toxin has novel attributes which have potential not only for the control of these insects but also for the understanding of specificity determination. It should be noted that our bioassays were conducted on a hybrid toxin in which the C-terminal region was provided by another toxin. While the C-terminal regions of the larger Cry toxins are known to be important for toxin expression/packaging (26) and may influence toxicity (27), there is no convincing evidence that they influence specificity, and thus we believe that it is reasonable to attribute the observed activity to the newly cloned portion of the toxin.
In conclusion, the RE-PCR-based approach developed in this study was able to effectively exclude undesired homologue genes but to clone low-frequency genes from a complex DNA sample. It is particularly applicable to families of homologous genes where there are known areas with variation that can be used for the design of the RE primers, and the method should be suitable for other samples such as metagenomic DNA.
ACKNOWLEDGMENT
We declare that we have no competing interests.
REFERENCES
- 1.Bravo A, Likitvivatanavong S, Gill SS, Soberon M. 2011. Bacillus thuringiensis: a story of a successful bioinsecticide. Insect Biochem Mol Biol 41:423–431. doi: 10.1016/j.ibmb.2011.02.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Sanahuja G, Banakar R, Twyman RM, Capell T, Christou P. 2011. Bacillus thuringiensis: a century of research, development and commercial applications. Plant Biotechnol J 9:283–300. doi: 10.1111/j.1467-7652.2011.00595.x. [DOI] [PubMed] [Google Scholar]
- 3.Ye W, Zhu L, Liu Y, Crickmore N, Peng D, Ruan L, Sun M. 2012. Mining new crystal protein genes from Bacillus thuringiensis on the basis of mixed plasmid-enriched genome sequencing and a computational pipeline. Appl Environ Microbiol 78:4795–4801. doi: 10.1128/AEM.00340-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Schnepf E, Crickmore N, Rie JV, Lereclus D, Baum J, Feitelson J, Zeigler DR, Dean DH. 1998. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol Mol Biol Rev 62:775–806. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Shu C, Zhang J, Chen G, Liang G, He K, Crickmore N, Huang D, Zhang J, Song F. 2013. Use of a pooled clone method to isolate a novel Bacillus thuringiensis Cry2A toxin with activity against Ostrinia furnacalis. J Invertebr Pathol 114:31–33. doi: 10.1016/j.jip.2013.05.005. [DOI] [PubMed] [Google Scholar]
- 6.Li Y, Shu C, Zhang X, Crickmore N, Liang G, Jiang X, Liu R, Song F, Zhang J. 2014. Mining rare and ubiquitous toxin genes from a large collection of Bacillus thuringiensis strains. J Invertebr Pathol 122:6–9. doi: 10.1016/j.jip.2014.07.006. [DOI] [PubMed] [Google Scholar]
- 7.Bravo A. 1997. Phylogenetic relationships of Bacillus thuringiensis delta-endotoxin family proteins and their functional domains. J Bacteriol 179:2793–2801. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.de Maagd RA, Bravo A, Crickmore N. 2001. How Bacillus thuringiensis has evolved specific toxins to colonize the insect world. Trends Genet 17:193–199. doi: 10.1016/S0168-9525(01)02237-5. [DOI] [PubMed] [Google Scholar]
- 9.Shu C, Su H, Zhang J, He K, Huang D, Song F. 2013. Characterization of cry9Da4, cry9Eb2, and cry9Ee1 genes from Bacillus thuringiensis strain T03B001. Appl Microbiol Biotechnol 97:9705–9713. doi: 10.1007/s00253-013-4781-5. [DOI] [PubMed] [Google Scholar]
- 10.Bi Y, Zhang Y, Shu C, Crickmore N, Wang Q, Du L, Song F, Zhang J. 2015. Genomic sequencing identifies novel Bacillus thuringiensis Vip1/Vip2 binary and Cry8 toxins that have high toxicity to Scarabaeoidea larvae. Appl Microbiol Biotechnol 99:753–760. doi: 10.1007/s00253-014-5966-2. [DOI] [PubMed] [Google Scholar]
- 11.Shu C, Yu H, Wang R, Fen S, Su X, Huang D, Zhang J, Song F. 2009. Characterization of two novel cry8 genes from Bacillus thuringiensis strain BT185. Curr Microbiol 58:389–392. doi: 10.1007/s00284-008-9338-y. [DOI] [PubMed] [Google Scholar]
- 12.Shu C, Yan G, Wang R, Jie Z, Feng S, Huang D, Song F. 2009. Characterization of a novel cry8 gene specific to Melolonthidae pests: Holotrichia oblita and Holotrichia parallela. Appl Microbiol Biotechnol 84:701–707. doi: 10.1007/s00253-009-1971-2. [DOI] [PubMed] [Google Scholar]
- 13.Wang G, Zhang J, Song F, Wu J, Feng S, Huang D. 2006. Engineered Bacillus thuringiensis GO33A with broad insecticidal activity against lepidopteran and coleopteran pests. Appl Microbiol Biotechnol 72:924–930. doi: 10.1007/s00253-006-0390-x. [DOI] [PubMed] [Google Scholar]
- 14.Shu C, Liu R, Wang R, Zhang J, Feng S, Huang D, Song F. 2007. Improving toxicity of Bacillus thuringiensis strain contains the cry8Ca gene specific to Anomala corpulenta larvae. Curr Microbiol 55:492–496. doi: 10.1007/s00284-007-9018-3. [DOI] [PubMed] [Google Scholar]
- 15.Yu H, Zhang J, Huang D, Gao JG, Song F. 2006. Characterization of Bacillus thuringiensis strain Bt185 toxic to the Asian cockchafer: Holotrichia parallela. Curr Microbiol 53:13–17. doi: 10.1007/s00284-005-0097-8. [DOI] [PubMed] [Google Scholar]
- 16.Bulla LA Jr, Bechtel DB, Kramer KJ, Shethna YI, Aronson AI, Fitz-James PC. 1980. Ultrastructure, physiology, and biochemistry of Bacillus thuringiensis. Crit Rev Microbiol 8:147–204. doi: 10.3109/10408418009081124. [DOI] [PubMed] [Google Scholar]
- 17.Owen JG, Zachary CP, Smith AG, Ternei MA, Calle PY, Reddy BVB, Daniel M, Brady SF. 2015. Multiplexed metagenome mining using short DNA sequence tags facilitates targeted discovery of epoxyketone proteasome inhibitors. Proc Natl Acad Sci U S A 112:4221–4226. doi: 10.1073/pnas.1501124112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Kampa A, Gagunashvili AN, Gulder TAM, Morinaka BI, Daolio C, Godejohann M, Miao VP, Piel J, Andresson Ó. 2013. Metagenomic natural product discovery in lichen provides evidence for a family of biosynthetic pathways in diverse symbioses. Proc Natl Acad Sci U S A 110:E3129–E3137. doi: 10.1073/pnas.1305867110. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Gong JS, Lu ZM, Li H, Zhou ZM, Shi JS, Xu ZH. 2013. Metagenomic technology and genome mining: emerging areas for exploring novel nitrilases. Appl Microbiol Biotechnol 97:6603–6611. doi: 10.1007/s00253-013-4932-8. [DOI] [PubMed] [Google Scholar]
- 20.Raymond B, Johnston PR, Christina NL, Didier L, Neil C. 2010. Bacillus thuringiensis: an impotent pathogen? Trends Microbiol 18:189–194. doi: 10.1016/j.tim.2010.02.006. [DOI] [PubMed] [Google Scholar]
- 21.Kumar S, Chandra A, Pandey KC. 2008. Bacillus thuringiensis (Bt) transgenic crop: an environment friendly insect-pest management strategy. J Environ Biol 29:641–653. [PubMed] [Google Scholar]
- 22.Bates SL, Zhao JZ, Roush RT, Shelton AM. 2005. Insect resistance management in GM crops: past, present and future. Nat Biotechnol 23:57–62. doi: 10.1038/nbt1056. [DOI] [PubMed] [Google Scholar]
- 23.Abdullah MA, Alzate O, Mohammad M, McNall RJ, Adang MJ, Dean DH. 2003. Introduction of Culex toxicity into Bacillus thuringiensis Cry4Ba by protein engineering. Appl Environ Microbiol 69:5343–5353. doi: 10.1128/AEM.69.9.5343-5353.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Li H, Liu R, Shu C, Zhang Q, Zhao S, Shao G, Zhang X, Gao J. 2014. Characterization of one novel cry8 gene from Bacillus thuringiensis strain Q52-7. World J Microbiol Biotechnol 30:3075–3080. doi: 10.1007/s11274-014-1734-9. [DOI] [PubMed] [Google Scholar]
- 25.Zhang Y, Zheng G, Tan J, Li C, Cheng L. 2013. Cloning and characterization of a novel cry8Ab1 gene from Bacillus thuringiensis strain B-JJX with specific toxicity to scarabaeid (Coleoptera: Scarabaeidae) larvae. Microbiol Res 168:512–517. doi: 10.1016/j.micres.2013.03.003. [DOI] [PubMed] [Google Scholar]
- 26.Evdokimov AG, Moshiri F, Sturman EJ, Rydel TJ, Zheng M, Seale JW, Franklin S. 2014. Structure of the full-length insecticidal protein Cry1Ac reveals intriguing details of toxin packaging into in vivo formed crystals. Protein Sci 23:1491–1497. doi: 10.1002/pro.2536. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Gomez I, Sanchez J, Munoz-Garay C, Matus V, Gill SS, Soberon M, Bravo A. 2014. Bacillus thuringiensis Cry1A toxins are versatile proteins with multiple modes of action: two distinct pre-pores are involved in toxicity. Biochem J 459:383–396. doi: 10.1042/BJ20131408. [DOI] [PMC free article] [PubMed] [Google Scholar]