A novel small heat shock protein of Haliotis discus hannai: characterization, structure modeling, and expression profiles under environmental stresses

Abstract

Small heat shock proteins (sHsps) are a class of chaperones with low molecular weight, feathered by a C-terminal α-crystallin domain (ACD). They participate in reestablishing the stability of partially denatured proteins and therefore contribute to cellular homeostasis. In this work, we identified a sHsp homolog (designated as sHsp19) from Haliotis discus hannai, an economically important farmed mollusk in East Asia. sHsp19 possesses a sHsp hallmark domain, which exhibits the typical fold of ACD as revealed by a three-dimensional model constructed through an iterative threading assembly refinement method. The amino acid sequence sHsp19 shares low identities with any other known sHsps, with percentages below 35 %. Besides, sHsp19 shows relatively distant phylogenetic relationships with sHsps of various mollusks, including two other identified sHsps of abalone subspecies. qRT-PCR analysis indicated that the expression of sHsp19 occurred in multiple tissues. Upon exposure to thermal, oxidative, and multiple toxic metal stresses, the level of sHsp19 mRNA was rapidly elevated in a persistent fashion, with the maximum increase up to 170.58-, 405.84-, and 361.96-fold, respectively. These results indicate sHsp is a novel sHsp that possesses the distinguishing structural feature of sHsps but has remote homologies with known sHsps. It is likely to be important in stress adaptation of abalone and may be applied as a bioindicator for monitoring pollution or detrimental changes of environment in abalone culture.

Introduction

Heat shock proteins (Hsps) are a large group of chaperones distributed in a great variety of organisms including animals, plants, and bacteria. Their main function is to promote protein folding and thereby prevent cellular accumulation of non-native proteins (Hartl and Hayer-Hartl 2002; Mymrikov et al. 2011). Hsps are divided into several families, including Hsp110, Hsp90, Hsp70, Hsp60, Hsp40, and small Hsps (sHsps) (Kampinga et al. 2009).

sHsps are the smallest members of the Hsp superfamily with molecular masses ranging mainly from 12 to 43 kDa. Compared to other Hsps, sHsps are highly diverse in their primary sequences except for a conserved C-terminal domain, which is known as the α-crystallin domain (ACD) and consists of 80–100 amino acid residues (Bakthisaran et al. 2015). sHsps can bind to denatured proteins as chaperones in an ATP-independent pattern, protecting them from aggregation to maintain cellular homeostasis. They form a pivotal cellular network to serve as a buffer system for stabilizing the partially unfolded proteins induced by diverse stress factors, such as temperature, heavy metals, organic solvents, reactive oxygen radicals, and so on (Mymrikov et al. 2011; Haslbeck and Vierling 2015). sHsps are known to participate in various physiological processes, such as cell proliferation and differentiation, development, promoting angiogenesis, cytoskeletal organization, apoptosis, and the immune response (Arrigo 2000; Mounier and Arrigo 2002; Kostenko and Moens 2009; Zhang et al. 2012b). In mollusks, a number of sHsps have been identified and reported to be responsive to diverse environmental stimuli or bacterial infections (Park et al. 2008; Zhang et al. 2010a, b, 2013; Bao et al. 2011; Wan et al. 2012; Li et al. 2013, 2015; You et al. 2014).

Pacific abalone Haliotis discus hannai is a commercially valuable mollusk species cultured mainly in China, Korea, and Japan (Li et al. 2012). In recent years, abalone culture has experienced increasing problems with environmental pollution. During the breeding process, the animal has to face multiple abiotic environmental stimuli including temperature variation, heavy metals, and oxidative stress (Nie and Wang 2004). Since the sHsp network plays a vital role in an animal’s survival strategy under stress conditions, knowledge regarding the abalone’s sHsps is necessary to understand the stress adaptation mechanisms of this mollusk. Animals usually possess multiple sHsps (Haslbeck and Vierling 2015), for example, humans have 10 sHsps and Caenorhabditis elegans has 16 sHsps (Bakthisaran et al. 2015). However, so far only two sHsps have been characterized from different abalone subspecies, i.e., the Hsp26 of Pacific abalone H. discus hannai (Park et al. 2008), and the Hsp20 of disk abalone Haliotis discus discus (Wan et al. 2012). The present work was performed to identify a novel sHsp homolog (sHsp19) from H. discus hannai. In addition, to assess the potential of sHsp19 serving as a novel bioindicator, we analyzed its expression profiles in response to multiple environmental stressors including heat shock, oxidative stress, and multiple heavy metal ions.

Material and methods

Animals

Adult H. discus hannai (3 years old, averaging 81.2 ± 5.6 mm in shell length) were purchased from an abalone farm (Jiaonan, Qingdao, China). They were kept in aerated seawater (20 ± 1 °C, pH 8.0 ± 0.1, salinity 30 ± 1 ‰) under a 12-h/12-h light/dark photoperiod and fed with Laminaria japonica daily. The animals were acclimatized for 7 days before experimental manipulation. No mortality was observed during the acclimation period and the experiments. Abalones were anesthetized by MS-222 (Sigma, St. Louis, MO, USA) before all experiments, which were conducted in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals promulgated by the State Science and Technology Commission of Shandong Province.

Sequence analysis, phylogenetic profiling, and structure modeling

A complementary DNA (cDNA) library of H. discus hannai was constructed in a previous work (Qiu et al. 2013a) and subjected to DNA sequencing. One clone was found to comprise the coding sequence of a sHsp homolog and the 5′- and 3′-untranslated regions (UTR). This gene was designated as sHsp19 and the sequence has been deposited in the GenBank database under the accession number KT966742. Sequence and phylogenetic analysis was conducted as previously reported (Qiu et al. 2013a). Protein structure prediction was performed with an iterative threading assembly refinement method (Roy et al. 2010).

sHsp19 expression in different tissues under normal physiological conditions

Adductor muscle, digestive gland, foot muscle, gill, hemocyte, and mantle were dissected aseptically from four abalones and immediately frozen in liquid nitrogen and stored at −80 °C. The total RNA was extracted from the tissues with the HP Total RNA kit (Omega Bio-tek, USA). To eliminate any possible DNA contamination, an additional on-membrane DNase I digestion step was included in the extraction, using the OBI DNase I digestion buffer (Omega Bio-tek, USA) according to the manufacturer’s instructions. The quality of the RNA was examined by the NanoDrop 2000 (Thermo scientific, USA) and by gel electrophoresis. The purified RNA was adjusted to 0.3 μg/μl with nuclease-free water. One microliter of total RNA was used for cDNA synthesis with the RevertAid™ Reverse Transcriptase (MBI Fermentas, Canada) according to manufacturer’s instructions. Quantitative real-time reverse transcriptase-PCR (qRT-PCR) was performed in an Eppendorf Mastercycler (Eppendorf, Hamburg, Germany) using the SYBR ExScript qRT-PCR Kit (Takara, Dalian, China). The reaction was performed in triplicate in a total volume of 20 μl containing 10 μl SYBR Premix buffer, 1 μl cDNA, 0.2 μl each of the primers, and 8.6 μl PCR-grade water. The PCR program was 95 °C for 30 s, followed by 40 cycles at 95 °C for 15 s, 59 °C for 15 s, and 72 °C for 30 s. Negative control without cDNA was included in each assay. Melting curve analysis of amplification products was performed at the end of each PCR to confirm the specificity of the amplification. The PCR products were subjected to electrophoresis in 2 % agarose gels to verify the sizes of the amplicons. Elongation factor-1-α (EF1A) was used as an internal control for relative quantification (Qiu et al. 2013b). The experiment was repeated three times. The PCR primers for sHsp19 are Hd-sHsp19F (5′–GACACTTCCCGAGTATTTCATC–3′) and Hd-sHsp19R (5′–TCGTCAGGACACCATCTTTAG–3′). The primers for elongation factor-1-α are EF1AF (5′-TGCTGTCTGATCGTTGCCT-3′) and EF1AR (5′-GCTGTCCATCTTGTTGATTCCA-3′). The Ct values were analyzed with the 2^−ΔΔCT method (Livak and Schmittgen 2001). The data were presented as the relative expression levels of sHsp19 in different tissues compared to the lowest and expressed as means plus or minus standard errors of the means (SE).

sHsp19 expression in gill under environmental stresses

The messenger RNA (mRNA) levels sHsp19 were evaluated when abalones were exposed to three different challenges of abiotic environmental stresses. For the heat shock challenge, abalones were maintained at 28 °C for 1, 2, 4, 8, and 12 h. For the heavy metal challenge, abalones were subjected to 24-h exposure to CuSO₄, HgCl₂, and Pb(NO₃)₂ with final metal ion concentrations of 5, 25, and 125 μg/l in seawater. For the oxidative stress challenge, abalones were exposed to H₂O₂ with a final concentration of 1 mM in seawater for 3, 6, 12, 24, 48, and 72 h. After challenge, four abalones in each treatment were used for gill collection. Total RNA was extracted from the tissue and used for qRT-PCR was performed as described above with α-tubulin as an internal control (Qiu et al. 2013b). All experiments were repeated three times.

Statistical analysis

All statistical analyses were performed with the SPSS 15.0 software (SPSS Inc., Chicago, IL, USA). Analysis of variance (ANOVA) was used to assess the main effects of indicated treatments. Then the statistically significant differences between controls and treatments were calculated by t test (**P < 0.01).

Results and discussion

Sequence analysis, phylogenetic profiling, and structural modeling of sHsp19

The cDNA of sHsp19 contains a 5′-UTR of 248 bp, an ORF of 507 bp, and a 3′-UTR of 1356 bp with a putative polyadenylation signal (AATAAA) localized at 15 bp upstream of the poly-A tail. The deduced amino acid sequence of sHsp19 is composed of 168 residues and has a theoretical molecular mass of 19.1 kDa and a pI of 5.22. Domain prediction revealed that sHsp19 possesses an α-crystallin domain, located at the C-terminal of the sequence (residues 68–158) (Fig. 1).

Fig. 1.

Sequence analysis of sHsp19. In the cDNA sequence, the translation start and stop codons are shown in bold and the polyadenylation signal is boxed. In the amino acid sequence, the α-crystallin domain is underlined. The predicted residues on the putative dimer interface are marked by triangles

Amino acid sequence alignment indicated that sHsp19 shares low overall identities with known sHsps of human and mollusks, with identities ranging from 34.8 (Hsp22 isoform-1 of Venerupis philippinarum) to 14.9 % (Hsp24.1 of Mytilus galloprovincialis). Interestingly, sHsp19 also shares low identities with the two identified abalone sHsps, i.e., 24.7 % with HdHSP20 of disk abalone H. discus discus and 23.3 % with Hsp26 of H. discus hannai (Fig. 2). Phylogenetic analysis indicated sHsp19 is distantly divergent from other sHsps of mollusks, such as Argopecten irradians, Chlamys farreri, Crassostrea gigas (Zhang et al. 2012a), Meretrix meretrix, Tegillarca granosa, and V. philippinarum (Fig. 3). Notably, the phylogenetic tree also revealed unexpected high evolutionary divergence among sHsp19 and two other identified sHsps of abalones (Fig. 3).

Fig. 2.

Alignment of amino acid sequences of sHsp19 and representative sHsp homologs of human and mollusks. The Genbank accession numbers of the aligned sequences are as follows: Venerupis philippinarum isoform 1 (ACU83231), Sinonovacula constricta (AGM14597), Cyclina sinensis (AET13647), Meretrix meretrix (AFK80359), Crassostrea gigas (XP_011448781), Homo sapiens (NP_653218), Mytilus galloprovincialis Hsp22 (AEP02967), Venerupis philippinarum isoform 2 (ACU83232), Tegillarca granosa (HM125895), Haliotis discus discus (Wan et al. 2012), Haliotis discus hannai Hsp26 (EF472916), Chlamys farreri (AY362760), Argopecten irradians (EU277735), and Mytilus galloprovincialis Hsp24.1 (AEP02968)

Fig. 3.

Evolutionary relationships of sHsp homologs. The evolutionary history was inferred using the neighbor-joining method. The bootstrap consensus tree inferred from 1000 replicates is taken to represent the evolutionary history of the taxa analyzed. Branches corresponding to partitions reproduced in less than 50 % bootstrap replicates are collapsed. The evolutionary distances were computed using the JTT matrix-based method. Evolutionary analysis was conducted with MEGA6. A total of 18 sHsp sequences were subjected to analysis. Fifteen of them are the same as presented in Fig. 2. The other three sequences are as follows: Mus musculus (NP_034094), Danio rerio (NP_001002670), and Xenopus laevis (NP_001086479). The sequences of abalones are labeled by triangles

The three-dimensional structure predicted by threading modeling indicated that the N-terminal of sHsp19 is mainly composed of α-helices, and the C-terminal region forms a β-sandwich constituted by two anti-parallel sheets of three and four β-strands (Fig. 4). This β-sandwich fold is highly consistent with the structural feature of ACD domain of typical sHsps (Haslbeck and Vierling 2015).

Fig. 4.

Structure model of sHsp19. The model was generated by the I-TASSER server and presented as a solid ribbon using the discovery studio visualizer software

The sHsp protein family is composed of a number of highly diverse members, all of which possess the characteristic ACD domain (Edwards et al. 2011). In our work, both the domain architecture analysis and homology modeling indicated sHsp19 contains an ACD, the hallmark of sHsp family. Nevertheless, the primary sequence of sHsp19 exhibits low overall identities with other sHsps, including the other known homolog of H. discus hannai. In addition, phylogenetic profiling implied that sHsp19 has remote evolutionary relationships with other sHsps of various molluskan species, such as clams, mussels, oyster, scallops, and even abalone subspecies. Taken together, these observations suggest sHsp19 is a novel member of sHsp family.

sHsp19 expression under normal physiological conditions

qRT-PCR analysis indicated sHsp19 expression occurs in all six examined tissues under normal physiological conditions. The lowest expression of sHsp19 occurs in hemocyte. In comparison, sHsp19 expression was found increased in gill, mantle, adductor muscle, foot muscle, and digestive gland by 1.66-, 1.89-, 4.73-, 5.54-, and 23.44-fold, respectively (Fig. 5). Human sHsps have been categorized as class I and class II. Class I sHsps, i.e., HspB1 (Hsp27), HspB4 (αA-crystallin), HspB5 (αB-crystallin), HspB6 (Hsp20), and HspB8 (Hsp22), are distributed in various tissues, while class II sHsp expression is tissue-specific (Bakthisaran et al. 2015). In mollusks, most identified sHsps were detected in multiple tissues (Zhang et al. 2010a, b; Bao et al. 2011; Wan et al. 2012; Li et al. 2013). Our results indicated that sHsp19 is ubiquitously expressed in abalone tissues. In addition, sHsp19 mRNA was most abundant in digestive gland; this observation is consistent with the tissue distribution analysis of a hard clam (M. meretrix) sHsp (Li et al. 2013).

Fig. 5.

sHsp19 expression in abalone tissues under normal physiological conditions. sHsp19 expression in adductor muscle, digestive gland, foot muscle, gill, hemocyte, and mantle was determined by qRT-PCR. The data were analyzed with the mRNA level compared to that of elongation factor-1-α (the internal control) in each sample and presented relative to the lowest (means ± SE, N = 3)

sHsp19 expression in response to multiple environmental stimuli

Given that gill is the primary site exposed to external environments, this tissue was used for evaluating the expression variations of sHsp19 when abalones were challenged by different environmental stressors, i.e., high temperature, oxidative stress, and heavy metals, and the findings are presented below. The exposure of abalone to high temperature resulted in a rapid induction of sHsp19 expression, as a 1-h exposure significantly upregulated the expression. The maximum induction of sHsp19 occurred at a 4-h postexposure (170.58-fold). After 12 h of heat shock, the mRNA levels of sHsp19 remained significantly higher than the control group (Fig. 6). In mammals, the ubiquitously expressed class I sHsps (Hsp27, αB-crystallins, Hsp20, and Hsp22) are mostly heat-inducible and are pivotal chaperones participating in animals’ survival mechanism in detrimental environments (Bakthisaran et al. 2015). Some sHsp have been shown to be able to prevent thermal aggregation of various target proteins (Raman et al. 1995; Rajaraman et al. 1996, 2001). Moreover, multiple sHsp members have been reported to display enhanced chaperone activity at elevated temperatures (Bakthisaran et al. 2015), which benefit from increased exposure of hydrophobic residues caused by heat-induced conformational alteration (Das and Surewicz 1995; Raman and Rao 1997; Chowdary et al. 2004; Lelj-Garolla and Mauk 2006). In mollusks, the expression of a number of sHsps including Hsp26 of H. discus hannai and HdHSP20 of H. discus discus was experimentally reported to be heat-induced (Park et al. 2008; Wan et al. 2012). In addition, Escherichia coli producing HdHSP20 exhibited increased thermotolerance (Wan et al. 2012). In the present work, a rapid and intensive induction of sHsp19 expression was observed upon a relatively mild temperature elevation (28 °C). Although the actual role of sHsp19 in abalone’s survival strategy under unfavorable thermal conditions needs further study, it seems reasonable to speculate that sHsp is probably involved in coping with the heat-induced protein denaturation.

Fig. 6.

sHsp19 expression in response to high temperature. Pacific abalones were subjected to heat shock at 28 °C. sHsp19 expression in gill was determined by qRT-PCR at various time points. The mRNA level of sHsp19 was normalized to that of α-tubulin. Data are shown as means ± SE (N = 3). **P < 0.01

The oxidative stress induced by H₂O₂ promoted significant upregulation of sHsp19 expression, with the maximum induction (405.84-fold) occurring 3 h after H₂O₂ treatment, then the expression levels declined in a time-dependent manner (Fig. 7). A number of lines of evidence have pointed out mammalian sHsps could facilitate cell viability under conditions of oxidative stress (Mymrikov et al. 2011). For instance, Hsp27 could provide cellular protection against oxidative stress via multiple mechanisms, including decrease of ROS level via increasing reduced glutathione (Arrigo 2007); enhanced proteasome-dependent degradation of oxidized proteins (Arrigo et al. 2005); protecting the cytoskeleton components from oxidative damage (Dalle-Donne et al. 2001). However, the functionality of sHsps in molluskan defense mechanism against oxidative stress is currently unknown. It was mentioned in a proteomic study that the protein level of a sHsp homolog in Perna viridis was induced by H₂O₂ treatment (Leung et al. 2011), which seems to be the only report to date regarding molluskan sHsp under oxidative pressure. In the present work, we observed quick and persistent elevation of sHsp19 mRNA upon H₂O₂ stimulation, suggesting a possible significant role of this protein in abalone’s survival under oxidative environment.

Fig. 7.

sHsp19 expression in response to oxidative stress. Pacific abalones were subjected to H₂O₂ treatment. sHsp19 expression in gill was determined by qRT-PCR at various time points. The mRNA level of sHsp19 was normalized to that of α-tubulin. Data are shown as means ± SE (N = 3). **P < 0.01

Exposure of the abalone to heavy metals (Cu, Hg, and Pb ions, respectively) enhanced the expression sHsp19 in a dose-dependent manner. Of the three heavy metal stressors, sHsp19 was more sensitive to Hg²⁺ stimulation (maximum 361.96-fold upregulation); the maximum upregulation induced by Cu²⁺ and Pb²⁺ was 93.75- and 77.89-fold, respectively (Fig. 8). In mammals, sHsp have been implicated in association with toxic heavy metal ion-induced pathological processes (Bakthisaran et al. 2015). For instance, Cu²⁺-binding αA- and αB-crystallin were reported to exhibit redox silencing properties and confer cytoprotectivity (Ahmad et al. 2008). In mollusks, transcriptional enhancement of sHsps upon heavy metal stimulation was documented in a number of species, such as A. irradians (Zhang et al. 2010a), H. discus discus (Wan et al. 2012), M. meretrix (Li et al. 2013), M. galloprovincialis (You et al. 2014), Sinonovacula constricta (Zhang et al. 2013), and V. philippinarum (Li et al. 2010). In our work, an intensive transcriptional induction of sHsp19 was observed upon administration of Cu²⁺, Hg²⁺, and Pb²⁺, respectively, pointing toward a likely involvement of sHsp19 in the abalone’s detoxification process against heavy metal pollutants.

Fig. 8.

sHsp19 expression in response to toxic metal ions. Pacific abalones were treated with Cu²⁺, Hg²⁺, and Pb²⁺, respectively. sHsp19 expression in gill was determined by qRT-PCR at various time points. The mRNA level of sHsp19 was normalized to that of α-tubulin. Data are shown as means ± SE (N = 3). **P < 0.01

Conclusions

In summary, in this report we identified a sHsp homolog (sHsp19) from H. discus hannai. sHsp19 was identified as a novel sHsp by the analyses of its domain architecture, sequence homology, phylogenetic origin, and structural feature, in comparison with other known sHsps. The expression of sHsp19 was ubiquitous in different tissues and was found to increase rapidly to multiple environmental stimuli including thermal, oxidative, and heavy metal stressors. Therefore, sHsp19 is likely involved in abalone’s defense mechanisms against environmental stress induced damage and may serve as a useful bioindicator for environmental monitoring in abalone culture and in marine ecotoxicological studies.