Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Aug 1.
Published in final edited form as: Virology. 2016 May 11;495:63–70. doi: 10.1016/j.virol.2016.04.028

Lack of strong anti-viral immune gene stimulation in Torque Teno Sus Virus1 infected macrophage cells

P Singh 1, S Ramamoorthy 1
PMCID: PMC4912913  NIHMSID: NIHMS786779  PMID: 27179346

Abstract

While recent findings suggest that swine TTVs (TTSuVs) can act as primary or co-infecting pathogens, very little is known about viral immunity. To determine whether TTSuVs downregulate key host immune responses to facilitate their own survival, a swine macrophage cell line, 3D4/31, was used to over-express recombinant TTSuV1 viral particles or the ORF3 protein. Immune gene expression profiles were assessed by a quantitative PCR panel consisting of 22 immune genes, in cell samples collected at 6, 12, 24 and 48hrs post-transfection. Despite the upregulation of IFN-β and TLR9, interferon stimulated innate genes and pro-inflammatory genes were not upregulated in virally infected cells. The adaptive immune genes, IL-4 and IL-13, were significantly downregulated at 6hrs post-transfection. The ORF3 protein did not appear do not have a major immuno-suppressive effect, nor did it stimulate anti-viral immunity. Data from this study warrants further investigation into the mechanisms of TTV related immuno-pathogenesis.

Keywords: porcine, qPCR, gene expression, Torque Teno Viruses, ORF3, TTSuV1, Swine, cytokine

1. Introduction

Since their discovery in the mid 90’s as a possible cause of transfusion transmitted hepatitis (Nishizawa et al., 1997), Torque Teno Viruses (TTV’s) were found to infect several mammals including humans, chimpanzees, dogs and pigs at high rates of prevalence (Okamoto, 2009a, b). They are also environmental contaminants of water sources (Griffin et al., 2008), hospital settings (Carducci et al., 2011) and have been detected in pork products (Jimenez-Melsio et al., 2013) and some human and animal drugs (Kekarainen et al., 2009). Several epidemiological studies have established the association of TTVs with a wide range of human diseases including auto-immune disorders, respiratory diseases, hepatic and nervous disorders (Kakalacheva et al., 2011; Maggi et al., 2003; Okamoto, 2009a; Piaggio et al., 2009). However, the detection of DNA or correlation does not necessarily imply causation. In contrast to the abundance of literature which epidemiologically links TTV to various diseases, there is very little information on the possible mechanisms of pathogenesis or the host-pathogen interaction. In swine, we previously showed that the prevalence of swine torque teno viruses (TTSuVs) is about 85–90% in pigs affected with the porcine respiratory disease complex, while the baseline prevalence rate was only about 55% (Rammohan et al., 2012). Experimental infection of gnotobiotic pigs with TTSuV1 results in nephritic, lung and kidney lesions (Krakowka and Ellis, 2008). When TTSuV1 was coinfected in conjunction with porcine circovirus strain 2 (PCV2) or the porcine reproductive and respiratory disease syndrome virus (PRRSV), the clinical signs induced by the coinfecting viruses were enhanced (Ellis et al., 2008; Krakowka et al., 2008).

The lack of a reliable cell culture system is a major road block for studies targeting the molecular pathogenesis of TTVs (Kekarainen and Segales, 2012). Since high loads of viral DNA have been detected in the immune cells of infected pigs (Lee et al., 2014) and as primary cultures of PBMCs supported TTV replication, immune cells are a likely site of replication in natural infections (Mariscal et al., 2002; Yu et al., 2002). Recently, it was found that transfection of an infectious clone consisting of the dimerized TTSuV genome in mammalian cells, resulted in the production of viral particles, although induction of pathological lesions was not clearly evident when pigs were inoculated with the genomic DNA (Huang et al., 2012b).

The single-stranded, circular TTSuV genomes range from 2.6–2.8kb in size. They code for three recognized open reading frames, ORF1 (capsid), ORF2 and 3. The function or the role of these viral proteins in modulating host immunity is unknown. The human TTV ORF2 protein was previously shown to inhibit NFkB and pro-inflammatory cytokine signaling (Zheng et al., 2007). However, the function or virulence properties of ORF3 are not yet known. With the increasing interest in the use of swine for xenotransplantation (Scobie and Takeuchi, 2009) and the common presence of TTVs as environmental contaminants, a deeper understanding of whether TTVs can influence host immunity is warranted. Therefore, we have tested the hypothesis that TTVs successfully establish chronic infections by being predominantly immunosuppressive. This study is the first to broadly examine the effects of TTV infection in swine macrophage cells expressing recombinant TTSuV1 viral particles from transfected genomic DNA or the ORF3 protein, using a qPCR panel composed of 22 immune genes. The data generated is important for further hypothesis-driven studies to understand the molecular mechanisms by which TTVs are so successful in establishing ubiquitous, life-long infections.

2. Materials and methods

2.1. Cloning of the TTSuV1 genome and ORF3

The TTSuV1 genome was amplified from the bone marrow of a pig with clinical signs of respiratory disease. The amplified fragment was cloned into the pCR2.1 TA cloning vector (Thermofisher, Grand Island, NY) as described previously (manuscript under review). Briefly, opposing primers with a unique Ase I site, located in the UTR region of the genome were used to amplify the entire circular genome and clone it into a shuttle TA cloning vector. The sequence of the cloned genome was deposited in GenBank with the accession number KT037083. As the TTSuV1 ORF3 is reconstituted by splicing, the two fragments composing the gene were amplified separately from the cloned genome and fused by overlap extension PCR. Primers 5′CAGTCAAGCTTGCCACCATGCCGGAACACTGGGAGGAAGCC3′ and 5′TATTCACCTCCAAACAGCCATCGTCGCCGATAGTCA3′ were used to amplify the 5′ end and primers 5′GCGACGATGGCTGTTTGGAGGTGAATACCAACCCC3′ and 5′ACGTCTCGAGGCGTTTCTTTTGTTTTTTATTGAG3′ to amplify the 3′ end. To assemble the fragments, an assembly reaction consisting of PCR mix, 50ng of each amplified fragment, cycled at 45ºC without primers for 30 cycles was used. The entire gene was amplified using 5ul of the assembly reaction and the 5′ and 3′ primers in the PCR master mix (ReadyMix™ Taq PCR Reaction Mix, Sigma) at for 35 cycles at 45ºC. The product was directionally cloned into pcDNAV5His A (Thermofisher, Grand Island, NY) using the XhoI and HindIII enzymes. The integrity of the construct was verified by restriction digestion and sequencing.

2.2. Expression of the TTSuV1 ORF3 and viral particles from transfected genomic DNA in a swine macrophage cell line

The cloned TTSuV1 genome was excised from the shuttle plasmid by Ase I digestion and circularized with DNA ligase. The porcine macrophage cell line, 3D4/31 (ATCC CRL-2844) (Weingartl et al., 2002)was grown to 70% confluence in chamber slides (Lab-Tek™ II Chamber Slide™ System, Thermofisher, Grand Island, NY). Cultured cells were transfected with 400ng of the circularized genomic DNA using the Lipofectamine® LTX Reagent (Thermofisher, Grand Island, NY), following the manufacturer’s instructions. Similarly, 800ng of the ORF3 mammalian expression plasmid was transfected into the 70% confluent 3D4/31 cells. After incubation for 6, 12, 24 and 48hrs post-transfection which were the time points used for gene expression analysis, the cells were fixed in acetone: methanol (1:1) solution. The cells transfected with the genome were stained with a 1:100 dilution of a rabbit polyclonal anti-TTSuV1 antibody, (provided by Dr. X. J. Meng, Virginia Tech)(Huang et al., 2011). Cells that were transfected with the ORF3 construct were stained with a 1:500 dilution of commercial anti-V5 tag antibody (Thermofisher, Grand Island, NY), as ORF3-specific antibodies are not available. Stained slides were examined with a fluorescent microscope. The size of the ORF3 product was verified by western blotting with the anti-V5 antibody.

2.3. mRNA extraction and cDNA conversion

Swine macrophage 3D4/31 cells were grown to 70% confluence in 6 well plates and transfected as described above. Untransfected cells and cells transfected with the vector alone were used to generate the baseline data. Cells were harvested at 6, 12, 24 and 48hrs for RNA extraction using standard protocols (RNeasy Mini Kit Qiagen, Valencia, CA). The purity of the RNA was verified as the 260/280nm ratio. The absence of DNA contamination was assessed by a PCR amplification of the β-actin gene with the extracted RNA as the template. Conversion to cDNA was achieved using the iScript cDNA synthesis kit (Biorad, Hercules, CA), following manufacturer’s instructions. Following quantification with a nano-spectrophotometer, the RNA and cDNA were stored at −80ºC, until further use.

2.4. Differential expression analysis of immune genes

The fold changes in gene expression patterns between the controls and treated cells was assessed by the standard ΔΔCt method (Livak and Schmittgen). Untransfected cells and cells transfected with the empty V5His A vector were used as negative controls to arrive at baseline values for the cell transfected with the circularized viral genome and the ORF3 expression construct, respectively. Each transfection experiment was repeated twice with two technical replicates (total of 4 values). A panel of 22 immune genes and 5 housekeeping genes were examined, essentially as described previously (Dobrescu et al., 2014). The immune genes studied included IFN-α, IFN-β, Mx1, Mx2, OAS-1, PKR, RNaseL (innate immune genes), IFN-ɣ, IL-10,IL-13, IL-4 (adaptive immune genes), IL-1β, IL-6, NLRP3, TNF-α, TRAIL (inflammatory genes), SOCS-1, PD-1 (regulatory genes), TLR9, DAI-ZBP-1 ( DNA pattern recognition receptors) and β2M, HPRT,GAPDH,HPL-19,TBP-1 (house-keeping genes). Additionally, primers 5′-GTCTTCCTCCAGATCACAACT-3′ were used for the detection of PD-1. Cycling conditions included denaturation at 95°C for 3 min followed by 45 cycles of 95°C for 15 sec and 60°C for 40sec in the iTaq™ universal SYBR® Green super-mix (Biorad, Hercules, CA). Analysis of serial dilutions of DNA and a melt curve analysis were used to determine the efficiency and specificity of the reaction respectively.

As the average values of the standard deviations of the house keeping genes did not vary significantly between replicates, an average of all the five genes was used to calculate the fold change values by the ΔΔCt method.

2.5. ELISA for the detection of IL-10 and TNF-α

Cell culture supernatants were collected from 3D4/31 cells transfected with either the TTSuV1 genome or the ORF3 expression plasmid, as described above, and stored at −80ºC until use. Commercially available ELISA kits (Porcine TNF-α ELISA kit, ThermoScientific, Grand Island, NY and Swine IL-10 ELISA kit, Invitrogen, Carlsbad, CA) were used to assess the collected supernatants for IL-10 and TNF- α, according to the manufacturer’s instructions. Statistical significance was assessed by a Student T test. The average values of the negative control were deducted from the mean values of the treatments for graphical representation (Fig 6).

Fig 6.

Fig 6

Open in a new tab

Detection of IL-10 and TNF-α by ELISA: Cell culture supernatants collected from 3D4/31 cells transfected with the TTSuV1 genome (Left) or the ORF3 (Right) were assessed by commercial swine IL-10 and TNF-a ELISAs in duplicate. The mean values of the two replicates after subtraction of the mean negative control values from untransfected cells (Left) or cells transfected with the vector alone (Right) are presented for each treatment at 6, 12, 24 and 48hrs post-transfection. * p ≤ 0.05 (Student T test). Error bars indicate the standard deviation.

3. Results and discussion

Despite the chronic nature of TTV infections, the ubiquitous presence of TTVs and their extensive epidemiological association with various diseases, very little is known about the possible immuno-pathogenesis of TTV’s (Kekarainen and Segales, 2012; Spandole et al., 2015). Macrophages are important in mediating antigen presentation, phagocytosis and in the stimulation of innate immune responses. The 3D4/31 cells are immortalized swine alveolar macrophage cells (Weingartl et al., 2002), which have been used by others to study immune responses to pathogens and viral entry mechanisms (Misinzo et al., 2005; Pavlova et al., 2008; Zhou et al., 2014). Since it is likely that TTV’s replicate in immune cells in natural infections (Maggi et al., 2001), 3D4/31 cells are a convenient in vitro model system for studying how TTSuV1 interacts with host macrophages. The lack of a reliable cell culture system is a major limitation in studying TTV’s at the molecular level (Kekarainen and Segales, 2012). Transfection of pig kidney (PK-15) cells with the circularized genome of TTSuVs, results in the production of viral particles but not sustained infectivity in serial passages (Huang et al., 2012b). However, our rationale for the use of the concatemerized viral genome to generate viral particles in macrophage cells is that the information generated will mimic that from natural infections where a composite regulation of host immunity by viral DNA, RNA intermediates as well as all the three characterized viral proteins occurs. Antibodies to the TTSuV1 ORF1 and 2 have been detected in natural infections (Chen et al., 2013; Huang et al., 2012a), indicating that they are produced during viral replication. However, there is no published information about the function of ORF3 or its role in pathogenesis. Therefore, this study is the first to determine whether infection of macrophage cells with TTSuV viral particles produced by transfection of the genome or the expression of the ORF3 protein can result in the differential regulation of key host immune genes.

3.1. Expression of TTSuV1 viral particles and ORF3

Confirming others findings that transfection of cells with the circularized genome results in the production of viral particles (Huang et al., 2012b); TTSuV1 was detected in transfected cells using the polyclonal, rabbit anti-ORF1 antibody. Substantial nuclear fluorescence, which is typical of DNA viruses, was detected at 6, 12, 24 and 48hrs. Similarly, expression of the ORF3 was detected in the nucleus, as previously described (Kakkola et al., 2009; Martinez-Guino et al., 2011) at all the 4 time points tested (Fig 1). Approximately 65% of cells were successfully transfected for both constructs, thus obviating concerns about dose effects on gene regulation. The ORF3 protein banded at approximately 23Kd on western blot analysis, as expected (data not shown).

Fig 1.

Fig 1

Open in a new tab

Expression of TTSuV1 viral particles and TTSuV1 ORF3 protein. Immuno- fluorescent images of the porcine macrophage 3D4/31 cell line transfected with the TTSuV1 genome (left) or the ORF3 expression construct (right). Production of viral particles was detected with a rabbit-polyclonal TTSuV1-ORF1 specific antibody while the expression of the ORF3 protein was detected with a commercial anti-V5 tag monoclonal antibody. Apple green nuclear fluorescence is indicative of the production of viral particles and the expression of ORF3 protein. Untransfected cells showed no reactivity (data not shown).

3.2. Expression of type I interferons and interferon stimulated innate genes

The type I interferons play an important role in orchestrating the initial anti-viral state and the innate immune response. Previously, a TTV encoded miRNA was found to inhibit interferon production via the JAK-STAT pathway (Kincaid et al., 2013). Likewise, the expression of IFN-α expression was only transiently upregulated by the VP at 12hrs, while ORF3 had no effect on type I interferon expression. Although IFN- β expression was more consistently upregulated at 12, 24 and 48hrs by the VP produced by transfection (Table 1), the interferon induced innate genes were not correspondingly upregulated, indicating that viral interference with the downstream signaling of IFN-α and β could be responsible for the block. In fact, three of the interferon stimulated genes, Mx1, Mx2 and RNase L were significantly downregulated by the VP and ORF3 at different time points. While commonly associated with the anti-viral response to RNA viruses (Silverman, 2007), recent evidence shows that OAS-1, RNaseL and PKR also provide anti-viral activity in DNA viral infections such as those caused by polyoma (Hersh et al., 1984), pox (Diaz-Guerra et al., 1997) and herpes viruses(Khabar et al., 2000). The single and double stranded RNA intermediates which are produced during the DNA viral life cycle are believed to stimulate these genes (Sadler and Williams, 2008). Similarly, the Mx1 and 2 proteins prevent trafficking within cells by binding to viral proteins and are GTP’ases. The hepatitis B virus is a DNA virus, which is also restricted by MxA activity (Gordien et al., 2001; Kane et al., 2013).

Table 1.

Regulation of type I interferons and interferon stimulated innate genes

Gene Time Point
6hrs 12hrs 24hrs 48hrs
VP* ORF3 VP* ORF3 VP* ORF3 VP* ORF3
Type I Interferons
IFN-α NS NS 5.73 ±3.05 NS NS NS NS NS
IFN-β NS NS 11.33 ±3.31 NS 7.68 ±3.43 NS 7.35 ±2.25 NS
Interferon Stimulated Innate Genes
Mx1 −2.44 ±0.48 NS NS −10.64 ±3.66 −5.89 ±3.32 NS NS NS
Mx2 NS NS NS NS NS NS −7.33 ±2.28 12.07 ±3.00
OAS-1 NS NS NS −4.59 ±2.04 NS NS −3.34 ±1.00 NS
PKR NS NS NS NS NS NS NS NS
RNaseL −31.68 ±3.64 NS NS NS NS −3.96 ±2.22 NS NS
Open in a new tab
*

Virus particle

3.3. Differential regulation of cytosolic DNA sensors

While cytosolic DNA sensors are not as well explored as the RNA sensors, TLR9 and DAI/ZBP-1 are known to play a role in DNA viral infections (Hemmi et al., 2000; Takaoka et al., 2007; Triantafilou et al., 2014). The signaling pathways of TLR-9 and DAI/ZBP-1 involve the sensing of non-methylated CpG motifs in microbial DNA, the engagement of IRF3 or 7 and NFκb, culminating in the production of type I interferons and pro-inflammatory cytokines. The high levels of TLR9 transcripts detected upon transfection with the viral genomic DNA and ORF3 DNA indicate that TLR9 is most likely involved in sensing TTSuV1 DNA. The DNA encoding ORF3 appears to play a significant role in this mechanism as the pattern of TLR9 expression was consistent in the cells expressing the ORF3 protein alone as well as in cells infected with the VPs. Supporting this premise, 6 and 2 CpG islands which are larger than 100bps were predicted by the Methprimer tool (Li and Dahiya, 2002) in the entire viral genome and the 477bp ORF3 gene respectively. However, the rapid shut down of the initial upregulation of the TLR9 response at the subsequent time points corresponds to the lack of the interferon stimulated gene response and pro-inflammatory cytokine response (Table 1, Fig 3). A more detailed characterization of the mechanisms involved in the viral regulation of TLR9 expression is warranted but not within the scope of this study. Infection of macrophage cells with VP’s produced by transfection or over-expression of the ORF3 protein did not influence, the expression levels of DAI-ZBP-1, indicating a possible lack of the involvement of this sensor in TTSuV1 infection of macrophage cells.

Fig 3.

Fig 3

Open in a new tab

Regulation of pro-inflammatory cytokines: The expression of IL1-β, IL-6, NLRP3, TNF-α and TRAIL in swine macrophages transfected with the TTSuV1 viral genome (left) and the ORF3 expression plasmid (right) at 6, 12, 24 and 48hrs is depicted. The mean fold change values for four replicates as calculated by the ΔΔCt method are shown.

3.4. Expression of pro-inflammatory cytokines

Similar to the type I interferons and the interferon stimulated innate genes, the induction of a strong pro-inflammatory response in macrophages is important for early inhibition of viral dissemination (Baroja-Mazo et al., 2014; Zoja et al., 1991). However, in TTSuV1 infected macrophages only IL-6 transcripts were transiently upregulated at 12hrs post-transfection, indicating that avoidance of the stimulation of the inflammatory response is a possible mechanism by which TTSuV1 achieves efficient replication. Although in cells transfected with the ORF3 alone, NLRP3 and TNF-α transcripts were upregulated at 48hrs post-transfection, the pattern did not correlate with data from the cells infected with the viral particles generated in cells transfected with the genome (Fig 3). Therefore, the possible pro-inflammatory effect of ORF3 could be suppressed in the context of the entire viral particle. At the protein level, TNF-α was detected by ELISA at the corresponding time points but the values were not statistically significant (Fig 6). Previously published findings show that the TTV ORF2 suppresses IL-6 production (Zheng et al., 2007). While IL-6 was not significantly downregulated in cells infected with the VPs in this study (and presumably expressing the ORF2 protein), IL-6 was only transiently upregulated at 12hrs post-transfection. The actual expression of ORF2 from the circularized genome could not be confirmed due the lack of a specific antibody.

3.5. Immune regulatory genes

Upregulation of IL-10 (Darwich et al., 2008; Ng and Oldstone, 2014), PD-1 and SOCS-1 are common in several chronic viral infections. Monocyte and macrophage cells express IL-10, PD-1 and SOCS-1 to negatively regulate the T cell response by downregulating IL-12 and its downstream signaling. In chronic viral infections like hepatitis C viral infections, PD-1 and SOCS1 are simultaneously upregulated and interact physically in co-immunoprecipitation studies. The hepatitis C virus core protein is believed to mediate the signaling (Ma et al., 2011; Yao et al., 2007; Zhang et al., 2011). Similarly, in herpes simplex viral infections, PD-1 and SOCS-1 act synergistically and are co-expressed (Channappanavar et al., 2012; Mahller et al., 2008). In this study, the performance of the qPCR assay for PD-1 was optimal, as a single peak was obtained in the melt curve analysis and the reaction efficiency was 94%. However, while we hypothesized that IL-10, PD-1 and SOCS-1 will be upregulated in cells infected with TTSuV1, there was no significant regulation of IL-10 except for a transient increase at 24hrs in cells infected with the viral particles, while SOCS-1 and PD-1 were significantly down regulated at 6hrs in cells infected with the virus (Fig 4). However, their negative regulation did not correlate with a strong antiviral response. While data from this study indicates that the IL-10, PD-1 or SOCS1 associated mechanisms may be associated with the viral immuno-pathogenesis, it is possible that the expression patterns of these markers of chronic infection could change at time points that extend beyond those examined in this study. Although PD-1 was upregulated by ORF3 at 48hrs, the same pattern was not evident in the context of the virally infected cells.

Fig 4.

Fig 4

Open in a new tab

Differential expression of regulatory immune genes: Expression of SOCS-1 or PD-1 in macrophage cells transfected with the TTSuV1 viral genome (left) and the ORF3 protein (right), shown as the average value of four replicates, calculated by the ΔΔCt method, at 6, 12, 24 and 48hrs post-transfection.

3.6. Expression of adaptive immune genes

Corresponding with the lack of strong innate immune responses, infection of macrophage cells with the TTSuV1 viral particle strongly suppressed IL-4 and IL-13 production at 6hrs post-transfection (Fig 5) and did not induce any significant upregulation of the other adaptive immune genes except for a transient increase of IL-10 at 12hrs. In the ELISA, low levels of IL-10 were detected at 6 and 12hrs post-transfection for the VP and at 12hrs post-transfection for the ORF3 treatment (Fig 6). While strong antibody responses to TTSuVs are detected in natural infections, the strength of the response does not appear to correlate with viral clearance [unpublished data]. Therefore, the suppression of IL-4 and IL-13, which have synergistic activity in pigs (Bautista et al., 2007), could have negative implications for the antibody mediated immunity against TTSuV’s. Similarly, the ORF3 did not appear to play a role in adaptive immunity as no significant regulation was detected except for a significant increase in IL-4 transcripts at 48hrs post-transfection (7.02±2.76). This increase was not reproduced in the context of infection with the entire virus and may therefore be suppressed in viral infections.

Fig 5.

Fig 5

Open in a new tab

Expression of adaptive immune genes: The average fold change values for IFN-γ, IL-10, IL-4 and IL-13 for four replicates of swine macrophage cells were transfected with the circularized TTSuV1 genome are shown. Differential gene expression was measured by the ΔΔCt method. Fold change values ≥2 were considered significant (solid bar). The differential gene expression was normalized to an average of 5 housekeeping genes. No significant changes were noted for cells transfected with the ORF3.

While this study is important in providing an initial in vitro characterization of immune gene regulation by TTSuV1 to detect the major trends in the mechanisms of immuno- pathogenesis, we acknowledge that the absence of an active and dynamic immune system, such as that which will be present in the live host, is a limitation in predicting how our results will translate to an in vivo system. Our future efforts will focus on studying TTV immunity in an in vivo swine model, where anamnestic responses or the lack thereof can also be characterized. Similarly, while it is widely acknowledged that gene expression patterns at the mRNA level may not always translate at the protein level, a recent study shows that a good correlation exists between gene and protein expression patterns for differentially expressed genes but not for genes unaffected by the treatment under the same experimental conditions (Koussounadis et al., 2015). Although detected at low levels, the fact that the patterns of protein expression as detected by the ELISA mimicked those of the mRNA expression data, further validates our findings. Protein stability in the cell culture supernatants and a low half-life could account for the low level of protein detection. Measurement of the protein expression levels of the other genes studied is not within the scope of this study and is limited by the availability of swine immune reagents.

In conclusion, infection of swine macrophage cells with TTSuV1 viral particles resulted in the induction of IFN-β but not IFN-α, but did not upregulate strong interferon induced innate gene expression, pro-inflammatory or adaptive immune genes. Our results support the hypothesis that the TTVs are able to successfully establish chronic infections a variety of mammalian hosts by evading the induction of a robust early, anti-viral response. Toll-like receptor 9 was upregulated by both viral infection and the ORF3 protein, indicating a possible role for TLR9 in the antiviral response. The ORF3 protein stimulated a pro-inflammatory response which was not sustained in the context of infection with the entire virion. In view of the high prevalence and ubiquitous nature of TTVs, our findings justify further detailed studies into the immuno-biology and possible pathogenesis of TTVs.

Fig 2.

Fig 2

Open in a new tab

Expression of DNA pattern recognition receptors: Expression of TLR9 and DAI-ZBP1 at 6, 12, 24 and 48hrs are shown for the viral particle (left) and ORF3 (right) as the average of four replicates. Fold changes were determined by the ΔΔCt method.

Highlights.

  • The influence of TTSuV1 and its ORF3 protein on host immune gene expression was studied

  • TLR9 was induced in the early time points, indicating a role in TTSuV1 immunity

  • IL-4 and IL-13 were significantly downregulated by the viral particle

  • ORF3 did not appear to play a major role in immuno-suppression

Acknowledgments

Swine tissue samples were provided by Dr. Neil Dyer, Director of the NDSU Veterinary Diagnostic lab. The anti-TTSuV1 ORF1 antibody was provided by Dr. X. J. Meng, Virginia Tech. We acknowledge Marvin Ssemadaali’s for technical help and proof-reading the manuscript. This project was funded by NIH P30 GM103332 from the National Institute of General Medicine (NIGMS) and the NDSU Advance Forward Program (NSF HRD-0811239). Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NIH or NSF.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Baroja-Mazo A, Martin-Sanchez F, Gomez AI, Martinez CM, Amores-Iniesta J, Compan V, Barbera-Cremades M, Yague J, Ruiz-Ortiz E, Anton J, Bujan S, Couillin I, Brough D, Arostegui JI, Pelegrin P. The NLRP3 inflammasome is released as a particulate danger signal that amplifies the inflammatory response. Nature immunology. 2014;15:738–748. doi: 10.1038/ni.2919. [DOI] [PubMed] [Google Scholar]
  2. Bautista EM, Nfon C, Ferman GS, Golde WT. IL-13 replaces IL-4 in development of monocyte derived dendritic cells (MoDC) of swine. Veterinary immunology and immunopathology. 2007;115:56–67. doi: 10.1016/j.vetimm.2006.09.010. [DOI] [PubMed] [Google Scholar]
  3. Carducci A, Verani M, Lombardi R, Casini B, Privitera G. Environmental survey to assess viral contamination of air and surfaces in hospital settings. The Journal of hospital infection. 2011;77:242–247. doi: 10.1016/j.jhin.2010.10.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Channappanavar R, Twardy BS, Suvas S. Blocking of PDL-1 interaction enhances primary and secondary CD8 T cell response to herpes simplex virus-1 infection. PloS one. 2012;7:e39757. doi: 10.1371/journal.pone.0039757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Chen T, Vaisanen E, Mattila PS, Hedman K, Soderlund-Venermo M. Antigenic diversity and seroprevalences of Torque teno viruses in children and adults by ORF2-based immunoassays. The Journal of general virology. 2013;94:409–417. doi: 10.1099/vir.0.046862-0. [DOI] [PubMed] [Google Scholar]
  6. Darwich L, Segales J, Resendes A, Balasch M, Plana-Duran J, Mateu E. Transient correlation between viremia levels and IL-10 expression in pigs subclinically infected with porcine circovirus type 2 (PCV2) Research in veterinary science. 2008;84:194–198. doi: 10.1016/j.rvsc.2007.04.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Diaz-Guerra M, Rivas C, Esteban M. Inducible expression of the 2–5A synthetase/RNase L system results in inhibition of vaccinia virus replication. Virology. 1997;227:220–228. doi: 10.1006/viro.1996.8294. [DOI] [PubMed] [Google Scholar]
  8. Dobrescu I, Levast B, Lai K, Delgado-Ortega M, Walker S, Banman S, Townsend H, Simon G, Zhou Y, Gerdts V, Meurens F. In vitro and ex vivo analyses of co-infections with swine influenza and porcine reproductive and respiratory syndrome viruses. Veterinary microbiology. 2014;169:18–32. doi: 10.1016/j.vetmic.2013.11.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Ellis JA, Allan G, Krakowka S. Effect of coinfection with genogroup 1 porcine torque teno virus on porcine circovirus type 2-associated postweaning multisystemic wasting syndrome in gnotobiotic pigs. American journal of veterinary research. 2008;69:1608–1614. doi: 10.2460/ajvr.69.12.1608. [DOI] [PubMed] [Google Scholar]
  10. Gordien E, Rosmorduc O, Peltekian C, Garreau F, Brechot C, Kremsdorf D. Inhibition of hepatitis B virus replication by the interferon-inducible MxA protein. Journal of virology. 2001;75:2684–2691. doi: 10.1128/JVI.75.6.2684-2691.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Griffin JS, Plummer JD, Long SC. Torque teno virus: an improved indicator for viral pathogens in drinking waters. Virology journal. 2008;5:112. doi: 10.1186/1743-422X-5-112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K, Akira S. A Toll-like receptor recognizes bacterial DNA. Nature. 2000;408:740–745. doi: 10.1038/35047123. [DOI] [PubMed] [Google Scholar]
  13. Hersh CL, Brown RE, Roberts WK, Swyryd EA, Kerr IM, Stark GR. Simian virus 40-infected, interferon-treated cells contain 2′,5′-oligoadenylates which do not activate cleavage of RNA. The Journal of biological chemistry. 1984;259:1731–1737. [PubMed] [Google Scholar]
  14. Huang YW, Harrall KK, Dryman BA, Beach NM, Kenney SP, Opriessnig T, Vaughn EM, Roof MB, Meng XJ. Expression of the putative ORF1 capsid protein of Torque teno sus virus 2 (TTSuV2) and development of Western blot and ELISA serodiagnostic assays: correlation between TTSuV2 viral load and IgG antibody level in pigs. Virus research. 2011;158:79–88. doi: 10.1016/j.virusres.2011.03.013. [DOI] [PubMed] [Google Scholar]
  15. Huang YW, Harrall KK, Dryman BA, Opriessnig T, Vaughn EM, Roof MB, Meng XJ. Serological profile of torque teno sus virus species 1 (TTSuV1) in pigs and antigenic relationships between two TTSuV1 genotypes (1a and 1b), between two species (TTSuV1 and -2), and between porcine and human anelloviruses. Journal of virology. 2012a;86:10628–10639. doi: 10.1128/JVI.00176-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Huang YW, Patterson AR, Opriessnig T, Dryman BA, Gallei A, Harrall KK, Vaughn EM, Roof MB, Meng XJ. Rescue of a porcine anellovirus (torque teno sus virus 2) from cloned genomic DNA in pigs. Journal of virology. 2012b;86:6042–6054. doi: 10.1128/JVI.00175-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Jimenez-Melsio A, Pares S, Segales J, Kekarainen T. Detection of porcine anelloviruses in pork meat and human faeces. Virus research. 2013;178:522–524. doi: 10.1016/j.virusres.2013.09.035. [DOI] [PubMed] [Google Scholar]
  18. Kakalacheva K, Munz C, Lunemann JD. Viral triggers of multiple sclerosis. Biochim Biophys Acta. 2011;1812:132–140. doi: 10.1016/j.bbadis.2010.06.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Kakkola L, Hedman K, Qiu J, Pintel D, Soderlund-Venermo M. Replication of and protein synthesis by TT viruses. Current topics in microbiology and immunology. 2009;331:53–64. doi: 10.1007/978-3-540-70972-5_4. [DOI] [PubMed] [Google Scholar]
  20. Kane M, Yadav SS, Bitzegeio J, Kutluay SB, Zang T, Wilson SJ, Schoggins JW, Rice CM, Yamashita M, Hatziioannou T, Bieniasz PD. MX2 is an interferon-induced inhibitor of HIV-1 infection. Nature. 2013;502:563–566. doi: 10.1038/nature12653. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Kekarainen T, Martinez-Guino L, Segales J. Swine torque teno virus detection in pig commercial vaccines, enzymes for laboratory use and human drugs containing components of porcine origin. The Journal of general virology. 2009;90:648–653. doi: 10.1099/vir.0.006841-0. [DOI] [PubMed] [Google Scholar]
  22. Kekarainen T, Segales J. Torque teno sus virus in pigs: an emerging pathogen? Transboundary and emerging diseases. 2012;59(Suppl 1):103–108. doi: 10.1111/j.1865-1682.2011.01289.x. [DOI] [PubMed] [Google Scholar]
  23. Khabar KS, Dhalla M, Siddiqui Y, Zhou A, Al-Ahdal MN, Der SD, Silverman RH, Williams BR. Effect of deficiency of the double-stranded RNA-dependent protein kinase, PKR, on antiviral resistance in the presence or absence of ribonuclease L: HSV-1 replication is particularly sensitive to deficiency of the major IFN-mediated enzymes. Journal of interferon & cytokine research : the official journal of the International Society for Interferon and Cytokine Research. 2000;20:653–659. doi: 10.1089/107999000414835. [DOI] [PubMed] [Google Scholar]
  24. Kincaid RP, Burke JM, Cox JC, de Villiers EM, Sullivan CS. A human torque teno virus encodes a microRNA that inhibits interferon signaling. PLoS pathogens. 2013;9:e1003818. doi: 10.1371/journal.ppat.1003818. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  25. Koussounadis A, Langdon SP, Um IH, Harrison DJ, Smith VA. Relationship between differentially expressed mRNA and mRNA-protein correlations in a xenograft model system. Scientific reports. 2015;5:10775. doi: 10.1038/srep10775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Krakowka S, Ellis JA. Evaluation of the effects of porcine genogroup 1 torque teno virus in gnotobiotic swine. American journal of veterinary research. 2008;69:1623–1629. doi: 10.2460/ajvr.69.12.1623. [DOI] [PubMed] [Google Scholar]
  27. Krakowka S, Hartunian C, Hamberg A, Shoup D, Rings M, Zhang Y, Allan G, Ellis JA. Evaluation of induction of porcine dermatitis and nephropathy syndrome in gnotobiotic pigs with negative results for porcine circovirus type 2. American journal of veterinary research. 2008;69:1615–1622. doi: 10.2460/ajvr.69.12.1615. [DOI] [PubMed] [Google Scholar]
  28. Lee Y, Lin CM, Jeng CR, Pang VF. Detection of torque teno sus virus 1 and 2 in porcine tissues by in situ hybridization using multi-strained pooled probes. Veterinary microbiology. 2014;172:390–399. doi: 10.1016/j.vetmic.2014.06.002. [DOI] [PubMed] [Google Scholar]
  29. Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics. 2002;18:1427–1431. doi: 10.1093/bioinformatics/18.11.1427. [DOI] [PubMed] [Google Scholar]
  30. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
  31. Ma CJ, Ni L, Zhang Y, Zhang CL, Wu XY, Atia AN, Thayer P, Moorman JP, Yao ZQ. PD-1 negatively regulates interleukin-12 expression by limiting STAT-1 phosphorylation in monocytes/macrophages during chronic hepatitis C virus infection. Immunology. 2011;132:421–431. doi: 10.1111/j.1365-2567.2010.03382.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Maggi F, Fornai C, Zaccaro L, Morrica A, Vatteroni ML, Isola P, Marchi S, Ricchiuti A, Pistello M, Bendinelli M. TT virus (TTV) loads associated with different peripheral blood cell types and evidence for TTV replication in activated mononuclear cells. Journal of medical virology. 2001;64:190–194. doi: 10.1002/jmv.1035. [DOI] [PubMed] [Google Scholar]
  33. Maggi F, Pifferi M, Tempestini E, Fornai C, Lanini L, Andreoli E, Vatteroni M, Presciuttini S, Pietrobelli A, Boner A, Pistello M, Bendinelli M. TT virus loads and lymphocyte subpopulations in children with acute respiratory diseases. Journal of virology. 2003;77:9081–9083. doi: 10.1128/JVI.77.16.9081-9083.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mahller YY, Sakthivel B, Baird WH, Aronow BJ, Hsu YH, Cripe TP, Mehrian-Shai R. Molecular analysis of human cancer cells infected by an oncolytic HSV-1 reveals multiple upregulated cellular genes and a role for SOCS1 in virus replication. Cancer gene therapy. 2008;15:733–741. doi: 10.1038/cgt.2008.40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Mariscal LF, Lopez-Alcorocho JM, Rodriguez-Inigo E, Ortiz-Movilla N, de Lucas S, Bartolome J, Carreno V. TT virus replicates in stimulated but not in nonstimulated peripheral blood mononuclear cells. Virology. 2002;301:121–129. doi: 10.1006/viro.2002.1545. [DOI] [PubMed] [Google Scholar]
  36. Martinez-Guino L, Ballester M, Segales J, Kekarainen T. Expression profile and subcellular localization of Torque teno sus virus proteins. The Journal of general virology. 2011;92:2446–2457. doi: 10.1099/vir.0.033134-0. [DOI] [PubMed] [Google Scholar]
  37. Misinzo G, Meerts P, Bublot M, Mast J, Weingartl HM, Nauwynck HJ. Binding and entry characteristics of porcine circovirus 2 in cells of the porcine monocytic line 3D4/31. The Journal of general virology. 2005;86:2057–2068. doi: 10.1099/vir.0.80652-0. [DOI] [PubMed] [Google Scholar]
  38. Ng CT, Oldstone MB. IL-10: achieving balance during persistent viral infection. Current topics in microbiology and immunology. 2014;380:129–144. doi: 10.1007/978-3-662-43492-5_6. [DOI] [PubMed] [Google Scholar]
  39. Nishizawa T, Okamoto H, Konishi K, Yoshizawa H, Miyakawa Y, Mayumi M. A novel DNA virus (TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology. Biochem Biophys Res Commun. 1997;241:92–97. doi: 10.1006/bbrc.1997.7765. [DOI] [PubMed] [Google Scholar]
  40. Okamoto H. History of discoveries and pathogenicity of TT viruses. Current topics in microbiology and immunology. 2009a;331:1–20. doi: 10.1007/978-3-540-70972-5_1. [DOI] [PubMed] [Google Scholar]
  41. Okamoto H. TT viruses in animals. Current topics in microbiology and immunology. 2009b;331:35–52. doi: 10.1007/978-3-540-70972-5_3. [DOI] [PubMed] [Google Scholar]
  42. Pavlova B, Volf J, Alexa P, Rychlik I, Matiasovic J, Faldyna M. Cytokine mRNA expression in porcine cell lines stimulated by enterotoxigenic Escherichia coli. Veterinary microbiology. 2008;132:105–110. doi: 10.1016/j.vetmic.2008.04.024. [DOI] [PubMed] [Google Scholar]
  43. Piaggio F, Dodi F, Bottino G, Andorno E, Gentile R, Ferrari C, Barabino G, Giannone A, Immordino G, Miggino M, Magoni Rossi A, Moraglia E, Gasloli G, Gelli M, Ferrante R, Morelli N, Casaccia M, Valente U. Torque Teno Virus--cause of viral liver disease following liver transplantation: a case report. Transplant Proc. 2009;41:1378–1379. doi: 10.1016/j.transproceed.2009.03.047. [DOI] [PubMed] [Google Scholar]
  44. Rammohan L, Xue L, Wang C, Chittick W, Ganesan S, Ramamoorthy S. Increased prevalence of torque teno viruses in porcine respiratory disease complex affected pigs. Veterinary microbiology. 2012;157:61–68. doi: 10.1016/j.vetmic.2011.12.013. [DOI] [PubMed] [Google Scholar]
  45. Sadler AJ, Williams BR. Interferon-inducible antiviral effectors. Nature reviews Immunology. 2008;8:559–568. doi: 10.1038/nri2314. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Scobie L, Takeuchi Y. Porcine endogenous retrovirus and other viruses in xenotransplantation. Curr Opin Organ Transplant. 2009;14:175–179. doi: 10.1097/mot.0b013e328327984d. [DOI] [PubMed] [Google Scholar]
  47. Silverman RH. Viral encounters with 2′,5′-oligoadenylate synthetase and RNase L during the interferon antiviral response. Journal of virology. 2007;81:12720–12729. doi: 10.1128/JVI.01471-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Spandole S, Cimponeriu D, Berca LM, Mihaescu G. Human anelloviruses: an update of molecular, epidemiological and clinical aspects. Archives of virology. 2015;160:893–908. doi: 10.1007/s00705-015-2363-9. [DOI] [PubMed] [Google Scholar]
  49. Takaoka A, Wang Z, Choi MK, Yanai H, Negishi H, Ban T, Lu Y, Miyagishi M, Kodama T, Honda K, Ohba Y, Taniguchi T. DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response. Nature. 2007;448:501–505. doi: 10.1038/nature06013. [DOI] [PubMed] [Google Scholar]
  50. Triantafilou K, Eryilmazlar D, Triantafilou M. Herpes simplex virus 2-induced activation in vaginal cells involves Toll-like receptors 2 and 9 and DNA sensors DAI and IFI16. American journal of obstetrics and gynecology. 2014;210:122 e121–122 e110. doi: 10.1016/j.ajog.2013.09.034. [DOI] [PubMed] [Google Scholar]
  51. Weingartl HM, Sabara M, Pasick J, van Moorlehem E, Babiuk L. Continuous porcine cell lines developed from alveolar macrophages: partial characterization and virus susceptibility. J Virol Methods. 2002;104:203–216. doi: 10.1016/S0166-0934(02)00085-X. [DOI] [PMC free article] [PubMed] [Google Scholar]
  52. Yao ZQ, King E, Prayther D, Yin D, Moorman J. T cell dysfunction by hepatitis C virus core protein involves PD-1/PDL-1 signaling. Viral immunology. 2007;20:276–287. doi: 10.1089/vim.2006.0096. [DOI] [PubMed] [Google Scholar]
  53. Yu Q, Shiramizu B, Nerurkar VR, Hu N, Shikuma CM, Melish ME, Cascio K, Imrie A, Lu Y, Yanagihara R. TT virus: preferential distribution in CD19(+) peripheral blood mononuclear cells and lack of viral integration. Journal of medical virology. 2002;66:276–284. doi: 10.1002/jmv.2142. [DOI] [PubMed] [Google Scholar]
  54. Zhang Y, Ma CJ, Ni L, Zhang CL, Wu XY, Kumaraguru U, Li CF, Moorman JP, Yao ZQ. Cross-talk between programmed death-1 and suppressor of cytokine signaling-1 in inhibition of IL-12 production by monocytes/macrophages in hepatitis C virus infection. Journal of immunology. 2011;186:3093–3103. doi: 10.4049/jimmunol.1002006. [DOI] [PubMed] [Google Scholar]
  55. Zheng H, Ye L, Fang X, Li B, Wang Y, Xiang X, Kong L, Wang W, Zeng Y, Ye L, Wu Z, She Y, Zhou X. Torque teno virus (SANBAN isolate) ORF2 protein suppresses NF-kappaB pathways via interaction with IkappaB kinases. Journal of virology. 2007;81:11917–11924. doi: 10.1128/JVI.01101-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Zhou S, He X, Xu C, Zhang B, Feng S, Zou Y, Li J, Liao M. The outer membrane protein P2 (OmpP2) of Haemophilus parasuis induces proinflammatory cytokine mRNA expression in porcine alveolar macrophages. Veterinary journal (London, England : 1997) 2014;199:461–464. doi: 10.1016/j.tvjl.2013.12.010. [DOI] [PubMed] [Google Scholar]
  57. Zoja C, Wang JM, Bettoni S, Sironi M, Renzi D, Chiaffarino F, Abboud HE, Van Damme J, Mantovani A, Remuzzi G, et al. Interleukin-1 beta and tumor necrosis factor-alpha induce gene expression and production of leukocyte chemotactic factors, colony-stimulating factors, and interleukin-6 in human mesangial cells. The American journal of pathology. 1991;138:991–1003. [PMC free article] [PubMed] [Google Scholar]

RESOURCES