Abstract
Premise of the study:
PCR amplification of the matK barcoding region is often difficult when dealing with multiple angiosperm families. We developed a primer cocktail to amplify this region efficiently across angiosperm diversity.
Methods and Results:
We developed 14 matK primers (seven forward, seven reverse) for multiplex PCR, using sequences available in GenBank for 178 taxa belonging to 123 genera in 41 families and 18 orders. Universality of these new multiplexed primers was tested with 53 specimens from 44 representative angiosperm families in 23 different orders. Our primers showed high PCR amplification and sequencing success.
Conclusions:
These results show that our newly developed primers are highly effective for multiplex PCR and can be employed in future barcode projects involving taxonomically diverse samples across angiosperms. Using multiplex primers for barcoding will reduce the cost and time needed for PCR amplification.
Keywords: degenerate primers, DNA barcoding, matK, multiplex PCR
The rapidly evolving and highly variable gene maturase K (matK; Hilu and Liang, 1997) has been recommended as a locus for DNA barcoding by the Consortium for the Barcode of Life (CBOL) Plant Working Group (Hollingsworth et al., 2009). Amplification and sequencing of the matK barcoding region is difficult due to high sequence variability in the primer binding sites (Hollingsworth et al., 2011). Currently, there are three popular matK primer pairs available to amplify approximately the same region of the gene: 390F and 1326R (Sun et al., 2001; Cuénoud et al., 2002), XF and 5R (Ford et al., 2009), and 1R_KIM and 3F_KIM (Hollingsworth et al., 2009; Jeanson et al., 2011). Kress et al. (2009) used these three primer pairs to amplify DNA barcodes from 296 shrub and tree species. These primer combinations showed amplification success in 85% and sequencing success in 69% of the species, proving that reliable amplification is possible across a range of plants, using several primer combinations. However, using more than one primer pair can be time consuming as well as costly and is often complex for large-scale projects (e.g., Heckenhauer et al., unpublished data).
Here, we report a set of universal primers that can be multiplexed in one PCR to amplify matK successfully in angiosperms and expedite high-throughput, rapid, automated, and cost-effective species identification. We present methods that enable efficient PCR amplification and sequencing of the matK barcode region.
METHODS AND RESULTS
Sequences of the matK gene from 178 taxa belonging to 123 genera and 41 families were obtained from GenBank (www.ncbi.nlm.nih.gov/genbank; Appendix S1 (58KB, docx) ) and aligned using the MAFFT plugin (Katoh and Standley, 2013) in Geneious (version 8.0.5; Kearse et al., 2012). Because primers were initially developed for a barcoding project dealing primarily with the tree flora of Southeast Asia, matK sequences of the most representative genera and families of dicots and monocots were used. The target DNA region was located between positions 383 and 1343 of the matK gene (with respect to Arabidopsis thaliana (L.) Heynh.) and includes the binding sites of the three commonly used matK primer pairs. Primers were designed at the most conserved regions, resulting in a fragment between positions 383 and 1256 (positions 414–1226, excluding the primer sequences). Forward primers are at a similar position to the 390F and XF primers, whereas the reverse primers are located downstream from the above-cited reverse primers to avoid a region of up to 11 adenine bases (e.g., Sterculia tragacantha Lindl. AY321178, positions 1257–1267), which could cause PCR and sequencing problems. To minimize primer degeneracy, aligned sequences were clustered into seven groups according to their genetic similarity in the MAFFT alignment, in which sequences are sorted according to their pairwise distances. Thus, for each cluster, primers with no more than five degenerate nucleotide positions were developed. Primers were developed manually considering primer properties (annealing temperature, 3′ and 5′ end stability) and primer secondary structures (cross dimers, dimers, hairpins) with the use of NetPrimer (PREMIER Biosoft International, Palo Alto, California, USA; www.premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html). Primers were designed at the same positions in the matK gene for the forward and reverse primers so that they could be multiplexed in a single PCR for each sample. Seven forward and seven reverse primers were developed. Because using more primer combinations in a multiplex PCR reduces the probability of the most appropriate primers binding to the target region, only five forward and five reverse primers for the most frequent sequences in our alignment were multiplexed (Table 1: C_MATK_F/C_MATK_R). Primers were mixed in different ratios depending on their level of degeneration (Table 1). The remaining two forward and two reverse primers serve as spares for amplification of taxa that fail amplification using the previous five-primer combination. Primers were compared against the National Center for Biotechnology Information (NCBI) GenBank nucleotide reference database using the Mega BLAST algorithm (blast.ncbi.nlm.nih.gov/Blast.cgi). Table 2 shows BLAST results with no mismatches in forward or reverse primers at the family level. Thus, in studies where the species are identified to family level, primers can be combined accordingly in a multiplex PCR. To evaluate the universality of the primers, multiplex PCR was conducted on DNA of 54 species from 48 families, representing frequently occurring trees and palms (e.g., Arecaceae, Dipterocarpaceae, Euphorbiaceae) in Southeast Asia (Table 3), along with other taxa from other parts of the world to improve the coverage of angiosperms (e.g., Leontodon [Asteraceae], Tillandsia [Bromeliaceae], Helianthemum [Cistaceae], Polystachya [Orchidaceae]). Approximately 30 mg of silica gel–dried material (bark or leaves) was transferred into a 96-well plate, and genomic DNA was extracted using the DNeasy 96 Plant Kit (QIAGEN, Hilden, Germany). PCRs included 5 μL of 2× ReddyMix PCR Master Mix with 1.5 mM MgCl2 (#AB-0575/DC/LD/A; Thermo Fisher Scientific, Waltham, Massachusetts, USA), 0.1 μL of forward and reverse primer cocktail each at 50 μM (final concentration 0.5 μM), 1 μL of template DNA, and H2O up to a final volume of 10 μL. Thermocycler conditions were as follows: 95°C for 2 min; five cycles of 95°C for 25 s, 46°C for 35 s, and 70°C for 1 min; 35 cycles of 95°C for 25 s, 48°C for 35 s, and 70°C for 1 min; and a final extension at 72°C for 5 min. For samples that did not amplify using the above-mentioned protocol, the 2× Phusion Green HS II Hi-Fi PCR Master Mix with 1.5 mM MgCl2 (#F-566S, Thermo Fisher Scientific) was used with the following thermocycler conditions: 98°C for 30 s; five cycles of 98°C for 10 s, 53°C for 30 s, and 72°C for 30 s; 35 cycles of 98°C for 10 s, 55°C for 30 s, and 72°C for 30 s; and a final extension at 72°C for 5 min. PCR products were visualized on a 1.5% TAE agarose gel using ethidium bromide staining. After cleaning the PCR products with 1 μL exonuclease I and FastAP thermosensitive alkaline phosphatase mixture (7 units Exo I, 0.7 units FastAP; Thermo Fisher Scientific) at 37°C for 45 min and 85°C for 15 min, barcodes were Sanger sequenced with the BigDye Terminator Kit version 3.1 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Sequencing was carried out using an ABI 3730xL DNA Analyzer (Applied Biosystems, Foster City, California, USA) at the Department of Botany and Biodiversity Research, University of Vienna. Bidirectional sequences were assembled in Geneious and edited.
Table 1.
Primers developed for multiplex PCR used to amplify the matK barcoding region. The forward (C_MATK_F) and reverse (C_MATK_R) primer cocktail as well as the four additional primers are given with their proportions in the primer cocktail.
| Cocktail name/Primer name (Direction) | Proportion in primer cocktail | Primer sequence (5′–3′)a | Primer positionb |
| C_MATK_F | 383–413 | ||
| matK-413f-1 (Forward) | 2 | TAATTTACRATCAATTCATTCAATATTTCC | |
| matK-413f-2 (Forward) | 2 | TAATTTACGATCYATTCATTCAATATTTCC | |
| matK-413f-3 (Forward) | 1 | TAATTTACGATCAATTCATTCAACATTTCC | |
| matK-413f-4 (Forward) | 2 | TAATTTMCRATCAATTCATTCCATATTTCC | |
| matK-413f-5 (Forward) | 1 | TAATTTACGATCAATTCATTCACTATTTCC | |
| C_MATK_R | 1227–1256 | ||
| matK-1227r-1 (Reverse) | 3 | GARGAYCCRCTRTRATAATGAGAAAGATTT | |
| matK-1227r-2 (Reverse) | 1 | GAAGAYCCGCTATGATAATGAGAAAGGTTT | |
| matK-1227r-3 (Reverse) | 2 | GARGATCCRCTRTRATAATGAAAAAGATTT | |
| matK-1227r-4 (Reverse) | 2 | GARGATCCRCTRTRATAATGAGAAAAATTT | |
| matK-1227r-5 (Reverse) | 2 | GARGATCCRCTRTRATAATGAGAAATATTT | |
| Additional primers | |||
| matK-413f-6 (Forward) | 2 | TAATTTACGATCWATTCATTCMATTTTTCC | 383–413 |
| matK-413f-7 (Forward) | 1 | TAATTTACAATCMATTCATTCAATATTTTC | 383–413 |
| matK-1227r-6 (Reverse) | 2 | GARGATCCGCTRTAATAATGCGAAAGATTT | 1227–1256 |
| matK-1227r-7 (Reverse) | 2 | GARGATCCGCTATRATAATGATAAATATTT | 1227–1256 |
Ambiguous bases are set in boldface.
Primer position is given for Arabidopsis thaliana (GenBank accession no. AF144378.1).
Table 2.
Recommended use of primers for different families, based on BLAST matches with no mismatches.a
| Order | Family | Appropriate forward primer | Appropriate reverse primer |
| Alismanthales | Alismataceae | matK-413f-2 | matK-1227r-1, matK-1227r-3 |
| Araceae | matK-413f-2, matK-413f-5 | matK-1227r-1 | |
| Apiales | Araliaceae | matK-413f-2, matK-413f-5 | matK-1227r-1, matK-1227r-4 |
| Apiaceae | matK-413f-7 | matK-1227r-1, matK-1227r-5 | |
| Aquifoliales | Aquifoliaceae | matK-413f-1 | matK-1227r-1, matK-1227r-3 |
| Cardiopteridaceae (Gonocaryum minus) | matK-413f-1 | matK-1227r-1, matK-1227r-3 | |
| Stemonuraceae | matK-413f-1 | matK-1227r-1, matK-1227r-3 | |
| Arecales | Arecaceae (Arecaceae sp.) | matK-413f-2 | matK-1227r-1, matK-1227r-3 |
| Asparagales | Amaryllidaceae | matK-413f-6 | matK-1227r-1, matK-1227r-3 |
| Asparagaceae | matK-413f-6 | matK-1227r-1, matK-1227r-4, | |
| matK-1227r-5 | |||
| Hyacinthaceae | matK-413f-6 | matK-1227r-1, matK-1227r-3 | |
| Iridaceae | matK-413f-6 | matK-1227r-1, matK-1227r-3, | |
| matK-1227r-5 | |||
| Orchidaceae (Polystachya humbertii) | matK-413f-1, matK-413f-2, | matK-1227r-1, matK-1227r-2, | |
| matK-413f-3, matK-413f-6 | matK-1227r-3 | ||
| Tecophilaeaceae | matK-413f-6 | matK-1227r-1 | |
| Xanthorrhoeaceae | matK-413f-6 | matK-1227r-1, matK-1227r-5 | |
| Asterales | Asteraceae (Leontodon hispidus) | matK-413f-1 | matK-1227r-1, matK-1227r-2, |
| matK-1227r-3, matK-1227r-4, | |||
| matK-1227r-5 | |||
| Campanulaceae | matK-413f-2 | matK-1227r-1,matK-1227r-5 | |
| Goodeniaceae | matK-413f-4 | matK-1227r-1 | |
| Austrobaileyales | Austrobaileyaceae | matK-413f-2 | matK-1227r-2 |
| Schisandraceae | matK-413f-2 | matK-1227r-2 | |
| Trimeniaceae | matK-413f-2 | matK-1227r-2 | |
| Berberidopsidales | Berberidopsidaceae | matK-413f-1 | matK-1227r-1 |
| Boraginales | Boraginaceae | matK-413f-1, matK-413f-4 | matK-1227r-1, matK-1227r-3, |
| matK-1227r-5 | |||
| Ehretiaceae | matK-413f-1 | matK-1227r-1 | |
| Brassicales | Brassicaceae | matK-413f-1, matK-413f-4, matK-413f-6 | matK-1227r-1, matK-1227r-5 |
| Capparaceae | matK-413f-1 | matK-1227r-1 | |
| Caricaeae | matK-413f-1 | matK-1227r-1 | |
| Cleomaceae | matK-413f-1, matK-413f-3, | matK-1227r-1, matK-1227r-2, | |
| matK-413f-4, matK-413f-7 | matK-1227r-4, matK-1227r-5 | ||
| Moringaceae | matK-413f-1 | matK-1227r-1, matK-1227r-5 | |
| Resedaceae | matK-413f-1 | matK-1227r-1 | |
| Bruniales | Brunelliaceae | matK-413f-1 | matK-1227r-1 |
| Buxales | Bucaceae | matK-413f-1 | matK-1227r-1 |
| Caryophyllales | Amaranthaceae | matK-413f-1 | matK-1227r-1 |
| Cactaceae | matK-413f-1 | matK-1227r-1 | |
| Polygonaceae | matK-413f-1 | matK-1227r-1, matK-1227r-2, | |
| matK-1227r-5 | |||
| Simmondsiaceae | matK-413f-1 | matK-1227r-3 | |
| Tamaricaceae | matK-413f-1 | matK-1227r-1 | |
| Celastrales | Celastraceae | matK-413f-1, matK-413f-4, | matK-1227r-1, matK-1227r-2, |
| matK-413f-6 | matK-1227r-3, matK-1227r-4, | ||
| matK-1227r-5 | |||
| Lepidobotryaceae | matK-413f-1 | matK-1227r-5 | |
| Chloranthales | Chloranthaceae | matK-413f-2 | matK-1227r-1, matK-1227r-5 |
| Commelinales | Commelinaceae | matK-413f-2 | matK-1227r-1 |
| Haemodoraceae | matK-413f-2 | matK-1227r-1, matK-1227r-2, | |
| matK-1227r-5 | |||
| Cornales | Cornaceae (Alangium cf. javanicum, Mastixia sp.) | matK-413f-1, matK-413f-3 | matK-1227r-1, matK-1227r-3, |
| matK-1227r-4, matK-1227r-5 | |||
| Grubbiaceae | matK-413f-1 | matK-1227r-1 | |
| Hydrangeaceae | matK-413f-1 | matK-1227r-1, matK-1227r-4 | |
| Loasaceae | matK-413f-1, matK-413f-7 | matK-1227r-1, matK-1227r-4 | |
| Crossosomatales | Stachyuraceae | matK-413f-1 | matK-1227r-1 |
| Staphyleaceae | matK-413f-1 | matK-1227r-1, matK-1227r-5 | |
| Strasburgeriaceae | matK-413f-1 | matK-1227r-1 | |
| Cucurbitales | Anisophylleaceae (Anisophyllea sp.) | matK-413f-1, matK-413f-6 | matK-1227r-1 |
| Begoniaceae | matK-413f-1, matK-413f-6 | matK-1227r-1 | |
| Coriariaceae | matK-413f-2 | matK-1227r-1 | |
| Cucurbitaceae | matK-413f-2 | matK-1227r-1, matK-1227r-3, | |
| matK-1227r-4, matK-1227r-5 | |||
| Datiscaceae | matK-413f-1 | matK-1227r-1 | |
| Tetramelaceae | matK-413f-1 | matK-1227r-3, matK-1227r-5 | |
| Dipsacales | Adoxaceae | matK-413f-4 | matK-1227r-1 |
| Caprifoliaceae | matK-413f-1, matK-413f-5 | matK-1227r-1 | |
| Ericales | Ebenaceae (Diospyros sp.) | matK-413f-1 | matK-1227r-1, matK-1227r-3, |
| matK-1227r-6 | |||
| Ericaceae | matK-413f-1, matK-413f-4 | matK-1227r-1, matK-1227r-5 | |
| Lecythidaceae (Barringtonia curranii) | matK-413f-5 | matK-1227r-1 | |
| Pentaphylacaceae | matK-413f-1 | matK-1227r-1 | |
| Primulaceae (Ardisia sp.) | matK-413f-1, matK-413f-2 | matK-1227r-3, matK-1227r-1, | |
| matK-1227r-5, matK-1227r-7 | |||
| Styracaceae | matK-413f-1 | matK-1227r-1 | |
| Symplocaceae (Symplocos crassipes) | matK-413f-1 | matK-1227r-1 | |
| Theaceae | matK-413f-1 | matK-1227r-4 | |
| Escalloniales | Escalloniaceae | matK-413f-1 | matK-1227r-1 |
| Fabales | Fabaceae (Fordia splendidissima) | matK-413f-1, matK-413f-2, | matK-1227r-1, matK-1227r-3, |
| matK-413f-4, matK-413f-6, | matK-1227r-5 | ||
| matK-413f-7 | |||
| Polygalaceae (Xanthophyllum beccarianum) | matK-413f-1, matK-413f-2 | matK-1227r-1 | |
| Fagales | Betulaceae | matK-413f-2 | matK-1227r-1 |
| Casuarinaceae | matK-413f-2 | matK-1227r-1 | |
| Fagaceae (Lithocarpus sp.) | matK-413f-2 | matK-1227r-1, matK-1227r-3, | |
| matK-1227r-5 | |||
| Juglandaceae | matK-413f-1 | matK-1227r-1, matK-1227r-6 | |
| Garryales | Garryaceae | matK-413f-1 | matK-1227r-1, matK-1227r-4, |
| matK-1227r-6 | |||
| Gentianales | Apocynaceae (Tabernaemontana sp.) | matK-413f-1, matK-413f-3, | matK-1227r-1, matK-1227r-2, |
| matK-413f-4, matK-413f-5, | matK-1227r-6 | ||
| matK-413f-6 | |||
| Loganiaceae | matK-413f-1 | matK-1227r-1, matK-1227r-5 | |
| Rubiaceae (Urophyllum sp., Psychotria sp.) | matK-413f-1, matK-413f-5 | matK-1227r-1, matK-1227r-2 | |
| Geraniales | Geraniaceae | matK-413f-1, matK-413f-6 | matK-1227r-1 |
| Melianthaceae | matK-413f-1, matK-413f-6 | matK-1227r-1 | |
| Gunnerales | Gunneraceae | matK-413f-1, matK-413f-2 | matK-1227r-1 |
| Huerteales | Dipentodontaceae | matK-413f-1 | matK-1227r-1 |
| Gerrardinaceae | matK-413f-1 | matK-1227r-1 | |
| Tapisciaceae | matK-413f-1 | matK-1227r-1, matK-1227r-5 | |
| Icacinales | Icacinaceae | matK-413f-1 | matK-1227r-1, matK-1227r-3 |
| Lamiales | Acanthaceae | matK-413f-1 | matK-1227r-1, matK-1227r-2, |
| matK-1227r-4, matK-1227r-5 | |||
| Gesneriaceae | matK-413f-1 | matK-1227r-1, matK-1227r-2, | |
| matK-1227r-5 | |||
| Lamiaceae (Teijsmanniodendron sp.) | matK-413f-1 | matK-1227r-1, matK-1227r-2, | |
| matK-1227r-5 | |||
| Lentibulariaceae | matK-413f-1 | matK-1227r-1 | |
| Myrsinaceae | matK-413f-1 | matK-1227r-1 | |
| Oleaceae | matK-413f-1 | matK-1227r-1, matK-1227r-2, | |
| matK-1227r-3, matK-1227r-4 | |||
| Orobanchaceae | matK-413f-1 | matK-1227r-1, matK-1227r-3, | |
| matK-1227r-4 | |||
| Laurales | Hernandiaceae | matK-413f-2 | matK-1227r-1 |
| Lauraceae (Litsea sarawacensis) | matK-413f-2 | matK-1227r-1, matK-1227r-3 | |
| Siparunaceae | matK-413f-2 | matK-1227r-3 | |
| Liliales | Smilacaceae | matK-413f-2 | matK-1227r-1, matK-1227r-5 |
| Magnoliales | Annonaceae | matK-413f-2 | matK-1227r-1, matK-1227r-4, |
| matK-1227r-5 | |||
| Degeneriaceae | matK-413f-2 | matK-1227r-1 | |
| Eupomatiaceae | matK-413f-2 | matK-1227r-1 | |
| Himantandraceae | matK-413f-2 | matK-1227r-1 | |
| Magnoliaceae (Magnolia sp.) | matK-413f-2, matK-413f-6 | matK-1227r-1 | |
| Myristicaceae | matK-413f-2, matK-413f-4 | matK-1227r-1, matK-1227r-5 | |
| Malpighiales | Clusiaceae (Garcinia sp.) | matK-413f-1 | matK-1227r-1, matK-1227r-3, |
| matK-1227r-4, matK-1227r-5 | |||
| Euphorbiaceae | matK-413f-1 | matK-1227r-1, matK-1227r-3, | |
| (Antidesma sp., Drypetes sp., Koilodepas sp., Macaranga hosei, Mallotus sp.) | matK-1227r-4, matK-1227r-5 | ||
| Linaceae | matK-413f-1 | matK-1227r-1 | |
| Passifloraceae | matK-413f-1 | matK-1227r-1 | |
| Phyllanthaceae | matK-413f-1, matK-413f-2, | matK-1227r-1 | |
| matK-413f-7 | |||
| Putranjivaceae | matK-413f-1 | matK-1227r-5 | Rhizophoraceae |
| matK-413f-5 | matK-1227r-1, matK-1227r-3 | Salicaceae | |
| matK-413f-1 | matK-1227r-1, matK-1227r-5 | Violaceae (Rinorea sp.) | |
| matK-413f-1 | matK-1227r-1, matK-1227r-6 | Malvales | |
| Elaeocarpaceae | matK-413f-1 | ||
| matK-1227r-1 | Malvaceae (Durio griffithii, Leptonychia sp., Sterculia sp.) | matK-413f-1 | matK-1227r-1 |
| Myrtales | Lythraceae | matK-413f-1, matK-413f-5 | matK-1227r-1, matK-1227r-3 |
| Melastomataceae | matK-413f-7 | matK-1227r-1, matK-1227r-4 | |
| Myrtaceae (Syzygium sp.) | matK-413f-1, matL-413f-4, | matK-1227r-1, matK-1227r-3, | |
| matK-413f-6 | matK-1227r-4, matK-1227r-5 | ||
| Onagraceae | matK-413f-3 | matK-1227r-1 | |
| Oxalidales | Brunelliaceae | matK-413f-1 | |
| Cunoniaceae | matK-413f-1 | matK-1227r-1 | |
| Huaceae | matK-413f-6 | matK-1227r-1 | |
| Pandanales | Cyclanthaceae | matK-413f-2 | matK-1227r-1 |
| Pandanaceae | matK-413f-2 | matK-1227r-1 | |
| Paracryphiales | Paracryphiaceae | matK-413f-1 | matK-1227r-1 |
| Piperales | Aristolochiaceae | matK-413f-2 | matK-1227r-1, matK-1227r-5 |
| Piperaceae | matK-413f-2 | matK-1227r-3 | |
| Saururaceae | matK-413f-2 | matK-1227r-1 | |
| Poales | Bromeliaceae (Tillandsia cf. caloura) | matK-413f-2, matK-413f-6 | matK-1227r-1, matK-1227r-3 |
| Typhaceae | matK-413f-2 | matK-1227r-1, matK-1227r-3 | |
| Proteales | Nelumbonaceae | matK-413f-1 | matK-1227r-1 |
| Platanaceae | matK-413f-1 | matK-1227r-1 | |
| Proteaceae | matK-413f-1, matK-413f-2, | matK-1227r-1, matK-1227r-3, | |
| matK-413f-3 | matK-1227r-4, matK-1227r-5 | ||
| Ranunculales | Berberidaceae | matK-413f-3 | matK-1227r-1 |
| Eupteleaceae | matK-413f-1, matK-413f-2 | matK-1227r-1 | |
| Lardizabalaceae | matK-413f-1 | matK-1227r-1, matK-1227r-5 | |
| Papaveraceae | matK-413f-1, matK-413f-2, | matK-1227r-1, matK-1227r-3, | |
| matK-413f-3, matK-413f-5 | matK-1227r-5 | ||
| Ranunculaceae | matK-413f-4 | matK-1227r-1, matK-1227r-6, | |
| matK-1227r-4, matK-1227r-5 | |||
| Rosales | Cannabaceae (Gironniera nervosa) | matK-413f-1, matK-413f-3 | matK-1227r-1, matK-1227r-3 |
| Moraceae (Artocarpus elasticus) | matK-413f-1 | matK-1227r-3 | |
| Rhamnaceae (Ziziphus angustifolius) | matK-413f-1, matK-413f-7 | matK-1227r-1, matK-1227r-3 | |
| Rosaceae | matK-413f-1, matK-413f-2, | matK-1227r-1, matK-1227r-3, | |
| matK-413f-6 | matK-1227r-4, matK-1227r-5 | ||
| Ulmaceae | matK-413f-1 | matK-1227r-3 | |
| Urticaceae | matK-413f-1 | matK-1227r-3 | |
| Sabilales | Sabiaceae (Meliosma sumatrana) | matK-413f-1, matK-413f-2 | matK-1227r-1, matK-1227r-4 |
| Santalales | Loranthaceae | matK-413f-4 | matK-1227r-1, matK-1227r-4 |
| Opiliaceae | matK-413f-1, matK-413f-2 | matK-1227r-1 | |
| Santalaceae | matK-413f-1, matK-413f-2 | matK-1227r-1, matK-1227r-5 | |
| Schoepfiaceae | matK-413f-1 | matK-1227r-1, matK-1227r-4 | |
| Sapindales | Meliaceae (Aglaia sp.) | matK-413f-1, matK-413f-7 | matK-1227r-1, matK-1227r-5 |
| Rutaceae (Glycosmis macrantha) | matK-413f-1 | matK-1227r-1, matK-1227r-6, | |
| matK-1227r-5 | |||
| Sapindaceae (Lepisanthes sp.) | matK-413f-4 | matK-1227r-1, matK-1227r-3, | |
| matK-1227r-5 | |||
| Saxifragales | Cercidiphyllaceae | matK-413f-1, matK-413f-7 | matK-1227r-1 |
| Haloragaceae | matK-413f-1 | matK-1227r-1 | |
| Hamamelidaceae | matK-413f-1, matK-413f-5 | matK-1227r-1 | |
| Paeoniaceae | matK-413f-1 | matK-1227r-1 | |
| Saxifragaceae | matK-413f-1, matK-413f-4, | matK-1227r-1 | |
| matK-413f-5 | |||
| Solanales | Montiniaceae | matK-413f-1 | matK-1227r-1 |
| Solanaceae | matK-413f-1, matK-413f-3 | matK-1227r-3 | |
| Trochodendrales | Trochodendraceae | matK-413f-1, matK-413f-6 | matK-1227r-1 |
| Vitales | Vitaceae | matK-413f-1 | matK-1227r-1, matk-1227r-2, |
| matK-1227r-5 |
Species/genera in parentheses were successfully amplified in the family using the primer cocktail C_MATK_F/C_MATK_R.
Table 3.
Taxa used for primer testing.
| No.a | Order: Family | Species | GenBank accession no. |
| 1 | Laurales: Lauraceae | Litsea sarawacensis Gamble | KU519656 |
| 2 | Malphigiales: Euphorbiaceae | Antidesma L. | KU519677 |
| 3 | Magnoliales: Myristicaceae | Knema Lour. | KU519655 |
| 4 | Asparagales: Orchidaceae | Polystachya humbertii H. Perrier* | KU519659 |
| 5 | Arecales: Arecaceae | Arecaceae Bercht. & J. Presl | KU519652 |
| 6 | Poales: Bromeliaceae | Tillandsia cf. caloura Harms* | KU519653 |
| 7 | Dilleniales: Dilleniaceae | Dillenia suffruticosa Martelli | KU519692 |
| 8 | Malpighiales: Achariaceae | Hydnocarpus borneensis Sleumer | KU519671 |
| 9 | Malpighiales: Calophyllaceae | Kayea oblongifolia Ridl. | KU519679 |
| 10 | Malpighiales: Euphorbiaceae | Macaranga hosei King ex Hook. f. | KU519674 |
| 11 | Malpighiales: Euphorbiaceae | Koilodepas Hassk. | KU519675 |
| 12 | Malpighiales: Pandaceae | Galearia fulva Miq. | KU519670 |
| 13 | Gentianales: Apocynaceae | Tabernaemontana L. | KU519697 |
| 14 | Malpighiales: Violaceae | Rinorea Aubl. | KU519676 |
| 15 | Malpighiales: Clusiaceae | Garcinia L. | KU519698 |
| 16 | Malpighiales: Euphorbiaceae | Drypetes Vahl | KU519669 |
| 17 | Malpighiales: Ctenolophonaceae | Ctenolophon parvifolius Oliv. | KU519672 |
| 18 | Fabales: Fabaceae | Fordia splendidissima (Blume ex Miq.) Buijsen | KU519701 |
| 19 | Fabales: Polygalaceae | Xanthophyllum beccarianum Chodat | KU519700 |
| 20 | Rosales: Cannabaceae | Gironniera nervosa Planch. | KU519681 |
| 21 | Rosales: Moraceae | Artocarpus elasticus Reinw. | KU519682 |
| 22 | Rosales: Chrysobalanaceae | Atuna racemosa Raf. | KU519699 |
| 23 | Rosales: Rhamnaceae | Ziziphus angustifolia (Miq.) Hatus. ex Steenis | KU519680 |
| 24 | Curcurbitales: Anisophyllaceae | Anisophyllea R. Br. ex Sabine | KU519651 |
| 25 | Fagales: Fagaceae | Lithocarpus Blume | KU519693 |
| 26 | Sapindales: Anacardiaceae | Gluta laxiflora Ridl. | KU519684 |
| 27 | Sapindales: Meliaceae | Aglaia F. Allam. | KU519686 |
| 28 | Sapindales: Sapindaceae | Lepisanthes Blume | KU519685 |
| 29 | Sapindales: Rutaceae | Glycosmis Corrêa | KU519687 |
| 30, 31 | Malvales: Dipterocarpaceae | Dipterocarpus palembanicus Slooten | KU519691 |
| 32 | Malvales: Cistaceae | Helianthemum obscurum Pers.* | KU519702 |
| 33 | Malvales: Malvaceae | Leptonychia Turcz. | KU519688 |
| 34 | Malvales: Malvaceae | Durio griffithii Bakh. | KU519689 |
| 35 | Malvales: Malvaceae | Sterculia L. | KU519690 |
| 36 | Cornales: Cornaceae | Alangium cf. javanicum (Blume) Wangerin | KU519664 |
| 37 | Cornales: Cornaceae | Mastixia Blume | KU519663 |
| 38 | Sapindales: Anacardiaceae | Saurauia Willd. | KU519661 |
| 39 | Ericales: Ebenaceae | Diospyros L. | KU519660 |
| 40 | Ericales: Lecythidaceae | Barringtonia curranii Merr. | KU519662 |
| 41 | Ericales: Primulaceae | Ardisia Sw. | KU519667 |
| 42 | Ericales: Symplocaceae | Symplocos crassipes C. B. Clarke | KU519658 |
| 43 | Gentianales: Rubiaceae | Urophyllum Jack ex Wall. | KU519696 |
| 44 | Solanales: Convolvulaceae | Erycibe cf. glomerata Blume | KU519694 |
| 45 | Gentianales: Rubiaceae | Psychotria L. | KU519695 |
| 46 | Magnoliales: Magnoliaceae | Magnolia L. | KU519654 |
| 47 | Myrtales: Myrtaceae | Syzygium P. Browne ex Gaertn. | KU519678 |
| 48 | Sabiales: Sabiaceae | Meliosma sumatrana (Jack) Walp. | KU519657 |
| 49 | Malpighiales: Euphorbiaceae | Mallotus Lour. | KU519673 |
| 50 | Lamiales: Lamiaceae | Teijsmanniodendron Koord. | KU519668 |
| 51 | Santalales: Olacaceae | Strombosia ceylanica Gardner | KU519665 |
| 52 | Aquifoliales: Cardiopteridaceae | Gonocaryum minus Sleumer | KU519666 |
| 53 | Sapindales: Burseraceae | Dacryodes excelsa Vahl | KU519683 |
| 54 | Asterales: Asteraceae | Leontodon hispidus L.* | KU519703 |
* Species not found in Southeast Asia.
Number according to Fig. 1.
Using 2× ReddyMix PCR Master Mix, all samples could be amplified except for one sample with low-quality DNA (Fig. 1, slot 30). This sample was successfully amplified in a PCR with 2× Phusion Green HS II Hi-Fi PCR Master Mix (Fig. 1, slot 31). Overall, the newly designed degenerate primer cocktails were very effective (100%) in amplifying the target matK region, with a product of 813 bp in length in Arabidopsis thaliana. By multiplexing the primers in a single PCR, barcodes were recovered from all samples.
Fig. 1.
Images of PCR amplicons for representatives of 53 angiosperm families using multiplex PCR with the newly developed degenerate primers (matK-413f-1 to matK-413f-5, matK-1227r-1 to matK-1227r-5). Bands are approximately 900 bp. Most of the samples were amplified using 2× ReddyMix. Low-quality DNA samples (slot 30) that failed PCR could be amplified using 2× Phusion Green HS II Hi-Fi PCR Master Mix (slot 31). For detailed sample description, see Table 3. Ladder: GeneRuler 100 bp Plus DNA Ladder (#SM0321; Thermo Fisher Scientific, Waltham, Massachusetts, USA). N = negative control.
CONCLUSIONS
We developed 14 universal, partly degenerate primers suitable for DNA barcoding of angiosperms that may also be suitable for multiplexed amplicon sequencing approaches on next-generation sequencing platforms (e.g., fusion primers on the Illumina system, see Elbrecht and Leese, 2015). We confirmed the effectiveness of our multiplexed primers on 53 species from 44 different plant families. Amplification success for these multiplexed primers in the cross-transferability tests with plant families outside Southeast Asia extends their potential usefulness, especially for large-scale barcoding projects with a diverse composition of plant families. Furthermore, by improving the routine amplification of the matK barcode, the establishment of our multiplex PCR approach will reduce laboratory costs as well as potential laboratory errors.
Supplementary Material
LITERATURE CITED
- Cuénoud P., Savolainen V., Chatrou L. W., Powell M., Grayer R. J., Chase M. W. 2002. Molecular phylogenetics of Caryophyllales based on nuclear 18S rDNA and plastid rbcL, atpB, and matK DNA sequences. American Journal of Botany 89: 132–144. [DOI] [PubMed] [Google Scholar]
- Elbrecht V., Leese F. 2015. Can DNA-based ecosystem assessments quantify species abundance? Testing primer bias and biomass–sequence relationships with an innovative metabarcoding protocol. PLoS ONE 10: e0130324. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ford C. S., Ayres K. L., Toomey N., Haider N., Van Alphen Stahl J., Kelly L. J., Wikström N., et al. 2009. Selection of candidate coding DNA barcoding regions for use on land plants. Botanical Journal of the Linnean Society 159: 1–11. [Google Scholar]
- Hilu K. W., Liang H. 1997. The matK gene: Sequence variation and application in plant systematics. American Journal of Botany 84: 830–839. [PubMed] [Google Scholar]
- Hollingsworth P. M., Forrest L. L., Spouge J. L., Hajibabaei M., Ratnasingham S., van der Bank M., Chase M. W., et al. 2009. A DNA barcode for land plants. Proceedings of the National Academy of Sciences, USA 106: 12794–12797. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Hollingsworth P. M., Graham S. W., Little D. P. 2011. Choosing and using a plant DNA barcode. PLoS ONE 6: e1925. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Jeanson M. L., Labat J. N., Little D. P. 2011. DNA barcoding: A new tool for palm taxonomists? Annals of Botany 108: 1445–1451. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Katoh S., Standley D. M. 2013. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution 30: 772–780. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kearse M., Moir R., Wilson A., Stones-Havas S., Cheung M., Sturrock S., Bixton S., et al. 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28: 1647–1649. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kress W. J., Erickson D. L., Jones F. A., Swenson N. G., Perez R., Sanjur O., Bermingham E. 2009. Plant DNA barcodes and a community phylogeny of a tropical forest dynamics plot in Panama. Proceedings of the National Academy of Sciences, USA 106: 18621–18626. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Sun H., McLewin W., Fay M. F. 2001. Molecular phylogeny of Helleborus (Ranunculaceae), with an emphasis on the East Asian-Mediterranean disjunction. Taxon 50: 1001–1018. [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.