Development and characterization of SSR markers for Aster savatieri (Asteraceae)

Abstract

Premise of the study:

Simple sequence repeat (SSR) markers were developed for Aster savatieri (Asteraceae) and the serpentine variety A. savatieri var. pygmaeus to re-evaluate their taxonomic status.

Methods and Results:

Using RNA-Seq data, 22 expressed sequence tag (EST)–SSR markers were developed. Polymorphisms were assessed in A. savatieri and in A. savatieri var. pygmaeus. The average number of alleles ranged from four to 15, and expected heterozygosity ranged from 0.417 to 0.870. Transferability was examined in six representative species of Japanese Aster and in Solidago virgaurea subsp. asiatica var. asiatica, a member of the tribe Astereae (Asteraceae); most of the loci were transferable to these examined species.

Conclusions:

These markers will be useful for genetic studies of variation in A. savatieri and other Aster species that occur in Japan.

Aster savatieri Makino (Asteraceae) is a perennial herb endemic to Japan (Makino, 1898). It grows in the understory of forests on the islands of Honshu, Shikoku, and Kyushu and is distinguishable from other Japanese congeners by the lack of pappus in its achene and its spring flowering habit (flowering of other species occurs from summer to fall). Aster savatieri var. pygmaeus Makino was originally recognized as a dwarf form occurring on Mt. Asama, in Mie Prefecture, Honshu, Japan (Makino, 1913). However, the taxonomic treatment of this variety is controversial. Dwarf forms have been reported from other localities in southwestern Honshu and Shikoku, and these were sometimes considered as var. pygmaeus (Makino, 1918; Kitamura, 1936). In contrast, Iwatsuki et al. (1995) considered var. pygmaeus to be a dwarf form endemic to serpentine areas in Aichi Prefecture, Mie Prefecture (= Mt. Asama), and Shikoku. Ploidy levels may be considered in taxonomic studies because differences in ploidy can affect plant size (Kondorosi et al., 2000; Tsukaya, 2013). Although few studies have examined ploidy levels in A. savatieri, a nonserpentine population of var. pygmaeus has been reported to be diploid and polymorphisms have often been found in western Honshu populations of A. savatieri (2n = 2x = 18, 2n = 3x = 27, 2n = 4x = 36; Huziwara, 1954; N. Ishikawa, T. Fukuda, S. Sakaguchi, and M. Ito, unpublished data). Therefore, the taxonomic discrimination of A. savatieri var. savatieri from A. savatieri var. pygmaeus requires analyses of the genetic relationships among serpentine and nonserpentine populations, as well as among populations with different ploidy levels.

Although eight simple sequence repeat (SSR) markers have been reported for A. amellus L. (Mayor and Naciri, 2007), only two polymorphic markers have been successfully amplified by PCR in A. savatieri (Y. Morishita and M. Ito, unpublished data). Thus, additional markers are needed to investigate the population divergence in greater detail. We developed 22 polymorphic expressed sequence tag (EST)–SSR markers for A. savatieri and evaluated their polymorphisms in, and transferability to, multiple species of Aster L. and a related genus.

METHODS AND RESULTS

Total RNA was extracted from A. savatieri (Appendix 1; Aichi population) and A. savatieri var. pygmaeus (Appendix 1; Kochi population) using the Agilent Plant RNA Isolation Mini Kit (Agilent Technologies, Santa Clara, California, USA). Normalized cDNA libraries of shoots and roots of A. savatieri were constructed and sequenced using the HiSeq 2000 system (Illumina, San Diego, California, USA). De novo assembly of 37,253,459 cleaned 100-bp reads using Trinity (Grabherr et al., 2011) produced 162,360 contigs (N50: 1678 bp). A cDNA library of A. savatieri var. pygmaeus inflorescences was constructed and sequenced using the Ion Torrent Personal Genome Machine (Thermo Fisher Scientific, Waltham, Massachusetts, USA). De novo assembly of 8,280,151 cleaned reads (≥400 bp) with CLC Genomics Workbench version 7.5.1 software (CLC bio, Aarhus, Denmark) produced 81,275 contigs (word size 43, bubble size 40, N50: 502 bp).

Microsatellite regions (≥10 dinucleotide repeats, ≥7 trinucleotide repeats) were searched using MSATCOMMANDER (Faircloth, 2008). Primer pairs with an optimal annealing temperature of 60 ± 2°C, a GC content of 30–70%, and a product size range of 100–500 bp were generated by Primer3 (Rozen and Skaletsky, 1999). We obtained 118 and 284 primer sets for A. savatieri and A. savatieri var. pygmaeus, respectively. Each of the 48 primer sets was selected from the two taxa based on the repeat numbers. For all loci, the forward primer was synthesized with one of three different M13 sequences (5′-CACGACGTTGTAAAACGAC-3′, 5′-TGTGGAATTGTGAGCGG-3′, or 5′-CTATAGGGCACGCGTGGT-3′) and the reverse primer was tagged with a PIG-tail (5′-GTTTCTT-3′). A similarity search of each contig against the National Center for Biotechnology Information (NCBI) nr database was conducted using the BLASTX algorithm. PCR reactions were performed using a QIAGEN Multiplex PCR Kit (QIAGEN, Hilden, Germany) in a 10-μL volume containing 5–10 ng DNA, 5 μL 2× Multiplex PCR Master Mix, 0.01 μM forward primer, 0.2 μM reverse primer, and 0.1 μM fluorescently labeled M13 primer. The PCR protocol was as follows: 95°C for 3 min; followed by 35 cycles of 95°C for 30 s, 57°C for 3 min, 68°C for 1 min; and a 20-min extension at 68°C. The PCR product was loaded with DNA Size Standard 600 (Beckman Coulter, Brea, California, USA) onto a GenomeLab GeXP Genetic Analysis System (Beckman Coulter), and fragment size was determined with CEQ fragment analysis software (Beckman Coulter).

For PCR amplification trials, we used two individuals from each of the two A. savatieri populations (Appendix 1; Aichi and Nagano populations) and the two A. savatieri var. pygmaeus populations (Appendix 1; Mie and Kochi populations). For the 22 primer pairs that showed clear peaks (Table 1), 24 individuals from each population (Aichi, Kyoto, and Mie) were evaluated for polymorphisms. All of the 24 individuals were considered to be diploid because no more than two alleles were found in any loci. We also confirmed the diploid status of these samples by microscopic chromosome counting of one individual from the Mie population, which showed that it was diploid (2n = 2x = 18). Flow cytometer (BD Biosciences, Franklin Lakes, New Jersey, USA) analyses of 10 individuals from each population revealed that all were diploid. Summary statistics were generated using GenAlEx 6.5 software (Peakall and Smouse, 2012), i.e., number of alleles per locus (A), expected heterozygosity (H_e), and observed heterozygosity (H_o). The significance of Hardy–Weinberg equilibrium and genotypic equilibrium was tested by 1000 randomizations with adjustment of the resulting P values through the Bonferroni correction using FSTAT 2.9.3 software (Goudet, 1995).

Table 1.

EST-SSR markers for Aster savatieri and A. savatieri var. pygmaeus.

Locus	Primer sequences (5′–3′)a	Repeat motif	Allele size range (bp)	Fluorescent dye	BlastX top hit description	E-value	GenBank accession no.
Ast_comp41702_c0_seq1	F: TGTGGAATTGTGAGCGGTGGCCAACACAACGAAACGR: GTTTCTTCTGCTTCTTCATCACCACCC	(AAC)7	329–335	D3	PREDICTED: probable WRKY transcription factor 14 [Vitis vinifera]	5E-86	FX983032
Ast_comp53978_c4_seq1	F: CACGACGTTGTAAAACGACCAAAGTGTTGGTTCCGAGACCR: GTTTCTTTCATGGATGTCGCTGAACAAC	(AAG)7	197–203	D2	Polyphenol oxidase [Taraxacum officinale]	0.0	FX983033
Ast_comp54189_c0_seq15	F: TGTGGAATTGTGAGCGGATTCACAATGTCCAGCCAGCR: GTTTCTTATGTAGGTCGAAAGGGTGGC	(ACC)7	182	D3	Hypothetical protein PHAVU_006G115800g [Phaseolus vulgaris]	4E-12	FX983034
Ast_comp22325_c0_seq1	F: TGTGGAATTGTGAGCGGTGTGAATCGGTTGCATAGCCR: GTTTCTTCACCAGTCCAACACAAAGCC	(ACC)7	136–148	D3	PREDICTED: transcription factor HEC2-like [Sesamum indicum]	9E-75	FX983035
Ast_comp37017_c0_seq1	F: CACGACGTTGTAAAACGACTCAGATCCAACAGGCAAGTGR: GTTTCTTAAACCACCATGTCCCTGCC	(ACC)7	166–181	D2	PREDICTED: zinc finger CCCH domain-containing protein 14-like [Nelumbo nucifera]	9E-103	FX983036
Ast_comp36481_c0_seq1	F: CTATAGGGCACGCGTGGTGAGGTTCTTGAAGACTGCTGCR: GTTTCTTGCCCTCCCACTTCTACCTTC	(AGC)8	302–332	D4	S-adenosylmethionine synthase 2 [Cucumis melo]	0.0	FX983037
Ast_comp55030_c0_seq87	F: CACGACGTTGTAAAACGACTCACAAATCAAACCACCGGCR: GTTTCTTCCATGGAAGTATAGAGCGCG	(CCG)7	267–279	D2	PREDICTED: N(6)-adenine-specific DNA methyltransferase 2 isoform X1 [Nicotiana tomentosiformis]	2.00E-103	FX983038
Ast_comp41314_c0_seq1	F: CTATAGGGCACGCGTGGTAGACCACCCAGATCTCTTTGTCR: GTTTCTTTCGCACGGTTAGATTCTCAC	(AAC)7	159–210	D4	PREDICTED: uncharacterized protein LOC104099663 [Nicotiana tomentosiformis]	2E-37	FX983039
Ast_comp48897_c0_seq1	F: TGTGGAATTGTGAGCGGCACCAACATCATCCTCAGGGR: GTTTCTTAAATTGATGCCCACAACGCC	(AGC)7	190–220	D3	Predicted protein [Nematostella vectensis]	0.15	FX983040
Ast_comp51216_c2_seq2	F: CACGACGTTGTAAAACGACCGATTTGGCTCACTGGAACG	(AAC)7	350–374	D2	No significant similarity found.		FX983041
	R: GTTTCTTTCCCACTCGAACCAGGTTTC
Ast_comp50838_c2_seq2	F: CACGACGTTGTAAAACGACGTGCTGATCCGGTGTTCTTCR: GTTTCTTGCTTCAAAGGGTGGTTCAGG	(ACC)7	204–210	D2	PREDICTED: uncharacterized protein LOC105170415 [Sesamum indicum]	0.00002	FX983042
Ast_comp55875_c0_seq1	F: TGTGGAATTGTGAGCGGGCCCGAGCCTTTAATCCAACR: GTTTCTTTGTTCCACGCTCATCTCTCC	(CCG)7	167–191	D3	PREDICTED: probable prefoldin subunit 5 [Nicotiana tomentosiformis]	3E-79	FX983043
Ast_comp53959_c2_seq2	F: CACGACGTTGTAAAACGACGAAGAAGAAGGTGGTGTGGCR: GTTTCTTAGGCGGGTTCTCATTCTCTAC	(ATC)7	155–173	D2	Hypothetical protein PRUPE_ppa002546mg [Prunus persica]	2E-122	FX983044
Ast_comp46752_c1_seq1	F: CACGACGTTGTAAAACGACATACTCTCGGGTCTGCACAGR: GTTTCTTGGACTTTCCCTAGGCTTCCG	(AGG)7	181–199	D2	PREDICTED: UPF0503 protein At3g09070, chloroplastic-like [Solanum tuberosum]	9E-69	FX983045
Ast_33509	F: CACGACGTTGTAAAACGACTTTCATCATGGGCCTGTCACR: GTTTCTTTTTGCATCTTCTGGTGGCTC	(AAG)10	201–225	D2	Unnamed protein product [Vitis vinifera]	9.00E-14	FX983024
Ast_19559	F: CACGACGTTGTAAAACGACACGACGATGAACATAGCAGCR: GTTTCTTTACCACGCTCAGCCAGTATC	(ATC)12	220–235	D2	Hypothetical protein MIMGU_mgv1a003121mg [Erythranthe guttata]	1.00E-10	FX983025
Ast_44410	F: TGTGGAATTGTGAGCGGAGATCCAGAACCAACCACCG	(ATC)11	248–257	D3	No significant similarity found.		FX983026
	R: GTTTCTTACTTACGGTGTCAACAAACTTG
Ast_65237	F: CTATAGGGCACGCGTGGTAGGGTCGATACTACTGTGGC	(AC)11	213–221	D4	No significant similarity found.		FX983027
	R: GTTTCTTCATTCACCCAAAGCCCGTAC
Ast_47436	F: CACGACGTTGTAAAACGACGGTCTTTCTCCCTCCTTTGAAGR: GTTTCTTGGTATCTCCTGTTTCTGCGG	(AAG)11	131–185	D2	PREDICTED: heat shock cognate 71 kDa protein-like [Amphimedon queenslandica]	3.00E-04	FX983028
Ast_34501	F: CACGACGTTGTAAAACGACGGGTGCATCAGAATCCGTACR: GTTTCTTTGGCGGTAATCTAGGTGTCC	(AAC)10	292–307	D2	PREDICTED: uncharacterized protein LOC104095266 [Nicotiana tomentosiformis]	0.23	FX983029
Ast_59032	F: CACGACGTTGTAAAACGACTTGTTAATGGCGGGCATCTC	(AGC)11	247–253	D2	No significant similarity found.		FX983030
	R: GTTTCTTGCGACGACTGCAGAATTGG
Ast_26109	F: CACGACGTTGTAAAACGACCGTGAGTCAAACCCGAGAACR: GTTTCTTCGCCTTCAAATCCTCCAACTC	(AC)11	462–498	D2	PREDICTED: interactor of constitutive active ROPs 2 [Vitis vinifera]	3.00E-146	FX983031
	R: GTTTCTTCGCCTTCAAATCCTCCAACTC

^aForward and reverse primer sequence (with tag sequence).

Twenty-two primer pairs were polymorphic; A ranged from four to 15 alleles, while H_e and H_o ranged from 0.417 to 0.870 and 0.174 to 0.690, respectively (Table 2). No significant departures from Hardy–Weinberg equilibrium were detected for any of the populations or loci after correcting for multiple tests (nominal level of significance: 0.05). No significant genotypic equilibrium was detected for any pair of loci. We examined the transferability of these primers to six representative Japanese Aster species and Solidago virgaurea L. subsp. asiatica Kitam. ex H. Hara var. asiatica Nakai ex H. Hara, a member of the tribe Astereae (Asteraceae). The Aster species were selected to cover the main lineages of Japanese Aster (Table 3; Appendix 1; Ito et al., 1998). The Solidago L. species was included to assess the general applicability of the primers. The PCR protocol was as follows: 95°C for 3 min; 40 cycles of 95°C for 30 s, 57.5°C for 3 min (with reductions of 0.1°C per cycle), 68°C for 1 min; with a 20-min extension at 68°C. Of the 22 EST-SSR primer pairs tested, 14–20 and 16 loci were successfully amplified in the six Aster species and S. virgaurea subsp. asiatica var. asiatica, respectively (Table 3, Appendix 1). Thus, most of the loci were transferable to the examined species.

Table 2.

Characteristics of the 22 polymorphic EST-SSR markers for Aster savatieri and A. savatieri var. pygmaeus.

	A. savatieri
	Aichi population (N = 24)			Kyoto population (N = 24)			A. savatieri var. pygmaeus (Mie population) (N = 24)			All (N = 72)
Locus	A	He	Ho	A	He	Ho	A	He	Ho	A	He	Ho
Ast_comp41702_c0_seq1	2	0.080	0.083	6	0.800	0.750	3	0.119	0.125	6	0.707	0.319
Ast_comp53978_c4_seq1	3	0.385	0.417	4	0.490	0.524	2	0.478	0.542	4	0.633	0.493
Ast_comp54189_c0_seq15	1	0.000	0.000	4	0.580	0.542	2	0.080	0.000	4	0.417	0.181
Ast_comp22325_c0_seq1	2	0.469	0.500	5	0.468	0.458	2	0.153	0.167	6	0.607	0.375
Ast_comp37017_c0_seq1	5	0.659	0.708	5	0.493	0.375	3	0.559	0.458	7	0.758	0.514
Ast_comp36481_c0_seq1	3	0.612	0.500	6	0.700	0.583	3	0.405	0.458	7	0.741	0.514
Ast_comp55030_c0_seq87	2	0.041	0.042	7	0.740	0.714	2	0.041	0.042	8	0.679	0.246
Ast_comp41314_c0_seq1	5	0.654	0.458	10	0.857	0.625	6	0.655	0.667	13	0.858	0.583
Ast_comp48897_c0_seq1	5	0.722	0.333	11	0.828	0.500	4	0.650	0.167	13	0.870	0.333
Ast_comp51216_c2_seq2	2	0.478	0.542	10	0.774	0.429	3	0.569	0.583	10	0.658	0.522
Ast_comp50838_c2_seq2	2	0.444	0.333	8	0.741	0.783	2	0.117	0.125	11	0.666	0.408
Ast_comp55875_c0_seq1	2	0.353	0.375	6	0.715	0.792	3	0.559	0.417	11	0.848	0.528
Ast_comp53959_c2_seq2	3	0.226	0.167	5	0.642	0.304	3	0.471	0.083	8	0.789	0.183
Ast_comp46752_c1_seq1	4	0.609	0.333	4	0.560	0.522	4	0.617	0.458	9	0.837	0.437
Ast_33509	7	0.798	0.833	10	0.811	0.750	4	0.556	0.458	13	0.851	0.681
Ast_19559	4	0.606	0.542	4	0.430	0.417	3	0.288	0.333	6	0.696	0.431
Ast_44410	2	0.478	0.708	3	0.553	0.609	3	0.226	0.250	5	0.479	0.521
Ast_65237	4	0.630	0.667	9	0.820	0.667	3	0.525	0.542	15	0.868	0.625
Ast_47436	3	0.478	0.042	7	0.654	0.048	7	0.647	0.417	14	0.861	0.174
Ast_34501	5	0.749	0.875	7	0.787	0.739	6	0.423	0.292	10	0.793	0.634
Ast_59032	2	0.080	0.083	7	0.794	0.750	3	0.392	0.417	7	0.579	0.417
Ast_26109	6	0.718	0.625	6	0.721	0.609	9	0.813	0.833	14	0.859	0.690
Average	3.4	0.467	0.417	6.5	0.680	0.568	3.6	0.425	0.356	9.1	0.730	0.446

Note: A = number of alleles per locus; H_e = expected heterozygosity; H_o = observed heterozygosity; N = number of individuals genotyped.

Table 3.

Transferability of the 22 EST-SSR markers for Japanese Aster and Solidago species.

Locus	A. ageratoides var. ageratoides (N = 3)a	A. glehnii var. hondoensis (N = 2)b	A. hispidus var. tubulosus (N = 2)b,c	A. rugulosus (N = 6)a	A. scaber (N = 3)b	A. sohayakiensis (N = 2)b	S. virgaurea subsp. asiatica var. asiatica (N = 4)a	A. savatieri (Nagano population) (N = 2)b,d	A. savatieri var. pygmaeus (Kochi population) (N = 2)b,d
Ast_comp41702_c0_seq1	—	+	+	—	+	—	+	+	—
Ast_comp53978_c4_seq1	—	+	—	+	+	—	+	+	+
Ast_comp54189_c0_seq15	+	NG	NG	+	—	+	NG	+	—
Ast_comp22325_c0_seq1	NG	—	+	—	—	—	—	+	—
Ast_comp37017_c0_seq1	+	+	+	+	+	—	+	—	+
Ast_comp36481_c0_seq1	+	—	+	—	+	—	+	+	+
Ast_comp55030_c0_seq87	+	+	+	+	+	—	NG	—	+
Ast_comp41314_c0_seq1	NG	—	NG	NG	NG	NG	+	—	+
Ast_comp48897_c0_seq1	+	NG	+	NG	+	+	NG	+	+
Ast_comp51216_c2_seq2	+	—	+	+	+	+	NG	+	+
Ast_comp50838_c2_seq2	NG	—	—	+	—	+	+	NG	—
Ast_comp55875_c0_seq1	—	+	NG	—	—	NG	+	+	+
Ast_comp53959_c2_seq2	—	NG	+	+	—	NG	+	—	+
Ast_comp46752_c1_seq1	—	+	—	+	+	+	+	—	+
Ast_33509	+	+	+	—	+	—	—	+	+
Ast_19559	—	NG	NG	+	+	NG	+	+	+
Ast_44410	—	NG	NG	+	+	+	NG	+	+
Ast_65237	+	+	+	+	+	+	+	+	+
Ast_47436	NG	NG	NG	NG	NG	NG	NG	—	—
Ast_34501	+	NG	+	+	—	+	+	—	—
Ast_59032	+	NG	+	+	—	—	+	—	+
Ast_26109	+	—	NG	—	+	—	+	+	+
No. of successfully amplified loci	18	14	15	19	20	17	16	21	22

Note: — = monomorphic (only one allele was detected); + = polymorphic (more than one allele was detected); NG = no signal or nonspecific amplification was detected in PCR amplification.

^aIndividuals originated from more than one population.

^bIndividuals originated from a single population.

^cPutative tetraploid.

^dSamples used for initial PCR amplification trials.

CONCLUSIONS

The 22 EST-SSR markers developed were substantially polymorphic within and between populations. Thus, these markers will be useful for investigations of intraspecific relationships among A. savatieri var. savatieri and A. savatieri var. pygmaeus populations occurring at serpentine and nonserpentine sites. Transferability analyses were conducted with six representative species of Japanese Aster and S. virgaurea subsp. asiatica var. asiatica, a member of the tribe Astereae (Asteraceae). Of the 32 Japanese Aster species, 20 are endemic to Japan and 11 are regarded as endangered (Iwatsuki et al., 1995; Ministry of the Environment, 2012). Thus, our markers should also prove useful in conservation-directed investigations of genetic variation in endangered Aster species that occur in Japan.

Appendix 1.

Voucher information for Aster and Solidago species used in this study.

Species	Population	Collection locality	Geographic coordinates (Altitude)	N	Voucher specimen accession no.a
Samples used for cDNA library construction
Aster savatieri	Aichi	Hasso, Inuyama, Aichi Prefec., Japan	35°21′38″N, 137°01′34″E	2	TI00010644
Aster savatieri var. pygmaeus	Kochi	Hidaka, Takaoka, Kochi Prefec., Japan	33°32′48″N, 133°20′54″E	6	TI00010646
Samples used for initial PCR amplification trials
Aster savatieri	Nagano	Togakushi, Nagano, Nagano Prefec., Japan	36°45′40″N, 138°04′09″E	2	TI00010645
Aster savatieri var. pygmaeus	Kochi	Hidaka, Takaoka, Kochi Prefec., Japan	33°32′48″N, 133°20′54″E	2	TI00010646
Samples used for initial PCR amplification trials and detailed evaluation for polymorphisms
Aster savatieri	Aichi	Hasso, Inuyama, Aichi Prefec., Japan	35°21′38″N, 137°01′34″E	24	TI00010644
Aster savatieri var. pygmaeus	Mie	Asama, Ise, Mie Prefec., Japan	34°27′34″N, 136°47′05″E	24	TI00010647
Samples used for detailed evaluation for polymorphisms
Aster savatieri	Kyoto	Ashiu, Miyama, Nantan, Kyoto Prefec., Japan	35°19′42″N, 135°43′42″E (528 m)	24	TI00010656
Samples used for transferability test
Aster ageratoides Turcz. var. ageratoides	Ashio	Ashio, Nikko, Tochigi Prefec., Japan	36°43′00″N, 139°29′07″E	2	TI00010648
Aster ageratoides var. ageratoides	Chugushi	Chugushi, Nikko, Tochigi Prefec., Japan	36°43′28″N, 139°29′09″E	1	TI00010649
Aster glehnii F. Schmidt var. hondoensis  Kitam.		Chugushi, Nikko, Tochigi Prefec., Japan	36°46′13″N, 139°27′17″E	2	TI00010654
Aster hispidus Thunb. var. tubulosus  K. Asano		Shimoina, Nagano Prefec., Japan	—b	2	TI00010650
Aster rugulosus Maxim.	Tsugeno	Tsugeno, Shinshiro, Aichi Prefec., Japan	34°51′37″N, 137°34′45″E	2	TI00010652
Aster rugulosus	NAGN-a83	Naganoyama, Shinshiro, Aichi Prefec., Japan	35°00′02″N, 137°27′18″E	1	NA
Aster rugulosus	Bibai	Nishibibai, Bibai, Hokkaido, Japan	43°19′30″N, 141°48′39″E	1	NA
Aster rugulosus	KAWM-GH2	Kawaminami, Koyu, Miyazaki Prefec., Japan	32°12′15″N, 131°31′40″E	1	NA
Aster rugulosus	KIBG-A5	Shigaraki, Koga, Shiga Prefec., Japan	34°56′35″N, 135°57′29″E	1	NA
Aster scaber Thunb.		Onan, Ochi, Shimane Prefec., Japan	34°55′30″N, 132°28′31″E	3	TI00010651
Aster sohayakiensis Koidz.		Wadagawa, Shingu, Wakayama Prefec., Japan	33°45′56″N, 135°50′14″E	2	TI00010653
Solidago virgaurea L. subsp. asiatica  Kitam. ex H. Hara var. asiatica  Nakai ex H. Hara	Serpentine soil	Mukawa, Yufutsu, Hokkaido, Japan	42°51′18″N, 142°15′22″E (168 m)	2	TI00010655
Solidago virgaurea subsp. asiatica  var. asiatica	Forest	Mukawa, Yufutsu, Hokkaido, Japan	42°51′26.9″N, 142°15′33.6″E (183 m)	2	NA

Note: N = number of individuals; NA = voucher unavailable.

^aVouchers deposited at the University of Tokyo (TI), Tokyo, Japan.

^bGPS data are not shown because this variety is critically endangered, but are available from the authors upon request.