Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Aug 1.
Published in final edited form as: Pediatr Blood Cancer. 2016 Apr 21;63(8):1484–1487. doi: 10.1002/pbc.26032

Thrombopoietin measurement as a key component in the evaluation of pediatric thrombocytosis

Nya D Nelson 1, Andrea Marcogliese 2,3, Katie Bergstrom 3, Michael Scheurer 3, Donald Mahoney 3, Alison A Bertuch 3,4
PMCID: PMC4916014  NIHMSID: NIHMS779527  PMID: 27100794

Abstract

JAK2, MPL, and CALR mutations, which underlie essential thrombocythemia (ET) in most adults, are infrequent in children. Consequently, additional tests are needed to confirm pediatric ET diagnoses. We report a child with suspected ET and p JAK2, MPL, and CALR analyses. Serum thrombopoietin was markedly elevated, leading to analysis of the thrombopoietin gene, TPHO, which contains an upstream open reading frame (uORF) known to repress THPO translation. Sequencing revealed a de novo, germline stopgain mutation in the uORF, explaining the elevated thrombopoietin and thrombocytosis. This suggests that screening thrombopoietin levels and, if elevated, THPO 5’ UTR sequencing could be diagnostic.

Keywords: thrombocytosis, essential thrombocythemia, thrombopoietin, THPO, upstream open reading frame

Introduction

Essential thrombocythemia (ET) is a myeloproliferative disorder characterized by persistent thrombocytosis and increased megakaryocytes in the absence of a reactive or secondary cause or other myeloid neoplasia. Approximately 85 to 90% of adults with ET have clonal disease and an acquired JAK2, MPL, or CALR mutation.[1] Current algorithms for the diagnosis of ET include molecular genetic studies for a pathogenic variant in one of these genes.[2-4] ET is a rare disorder in childhood and, in striking contrast to adults, only 25 to 30% of children diagnosed with ET will have an acquired JAK2, MPL, or CALR mutation.[5,6] Thus, 70-75% of children are classified as having ‘triple negative’ disease. X chromosome inactivation studies in girls with triple negative disease argued against clonal disease.[5] However, targeted deep sequencing performed in two cohorts of children with ET revealed that 32 to 40% of those lacking JAK2, MPL, or CALR mutations had somatic changes in one or more other genes previously implicated in myeloproliferative neoplasms.[6,7] In these triple negative cases, any given other gene (e.g., ASXL1 and IRF8) was mutated in just a few patients. Thus, the diagnosis of ET in children remains challenging and the possibility remains that other genes may underlie the thrombocytosis.

Results

Our patient is a male who was referred at 16 months of age for persistent thrombocytosis, with platelet counts averaging between 1.2 and 1.6 × 106/μL and otherwise p complete blood counts. Past medical history was remarkable for recurrent otitis and mild eczema. There was no family history of thrombocytosis and both parents had p platelet counts. On physical exam, he had mild hepatosplenomegaly (liver edge and spleen tip palpable 1 and 2 cms below the right and left costal margins, respectively), but no other findings. Laboratory studies for secondary causes were p. Bone marrow examination demonstrated a mildly hypercellular marrow (95%) with megakaryocytic hyperplasia (up to 22 megakaryocytes per high powered field), no dysplasia, and no fibrosis (Figure 1). Chromosomal analysis revealed a p male karyotype and a myelodysplastic syndrome fluorescence in situ hybridization panel was p, showing no evidence of −5/5q-, −7/7q-,trisomy 8 or 20q-. Targeted JAK2 V617 pyrosequencing, CALR amplification and sequencing, and MPL gene bidirectional sequencing did not detect a variant. Variants of unknown significance in genes associated with hematologic disease (LYST, FANCI, PRF1, PNPLA1, and CD36) were noted in the initial interpretation of clinical whole exome sequencing (Baylor Medical Genetics Laboratory), however, none were considered to be responsible for the patient’s thrombocytosis nor clinically significant.

Figure 1.

Figure 1

Bone marrow histopathologic evaluation showing mild bone marrow hypercellularity with markedly increased megakaryocytes and p reticulin staining. A) 10X and B) 20X magnification of bone marrow biopsy. C) Reticulin stain of bone marrow biopsy under 20X magnification. D) 20X magnification of bone marrow aspirate.

With a presumptive diagnosis of ET, the patient was managed over 2 years, during which time his platelet count ranged between 0.8 − 2.0 × 106/μL off medication (mean and median 1.2 × 106/μL) . The peripheral blood counts remained otherwise within p range.

To further explore the pathophysiology underlying this triple negative patient’s disease, a serum TPO measurement (Quest Diagnostics) was obtained to determine if thrombopoiesis was being driven by elevated TPO levels. The TPO concentration was extremely elevated at > 4000 pg/mL (reference range 7-99 pg/mL). This value was significantly higher than observed in ET or reactive thrombocytosis, in which the TPO concentrations are infrequently > 1,000 pg/mL,[8-13] and suggested the presence of a pathogenic variant driving TPO production.

Inherited pathogenic variants in the 5’ untranslated region (UTR) of THPO, which encodes TPO, have been reported in kinships with thrombocytosis in multiple family members, including children, with autosomal dominant transmission and elevated TPO levels.[14-17] The 5’ UTR of the various THPO mRNA isoforms contains 5-7 upstream open reading frames (uORFs), which regulate translation.[18] uORF7, present in all of the THPO mRNAs, exerts the strongest translational inhibition, with its translation extending past the physiologic AUG (Figure 2A). Given the highly elevated TPO level in our patient, we hypothesized that he may have a pathogenic variant in THPO uORF7. Polymerase chain reaction amplification of the THPO 5’ UTR was performed on peripheral blood DNA (forward primer 5’AATGTGAGAGAATTCAGGGCTT3’ and reverse primer 5’ TTTGGGAGAATGGGTTCCCC3’) followed by bidirectional sequencing and comparison to the THPO coding sequence (NM_001290028.1). This revealed a heterozygous pathogenic variant, THPO:c.−34C>T, resulting in a stopgain in uORF7 (Figure 2B). Sequencing of buccal DNA indicated the variant was germline. The variant was absent in both parents, indicating that the mutation was de novo (Figure 2A). The variant was considered novel, based on its absence in dbSNP and in the Exome Aggregation Consortium database, which reports the variants identified in approximately 60,706 unrelated individuals subjected to exome sequencing as part of various disease-specific and population genetic studies, with efforts made to specifically exclude individuals with severe pediatric disease (http://exac.broadinstitute.org/about).[19]

Figure 2.

Figure 2

A de novo, germline, stopgain mutation within uORF7 of THPO. A) Schematic of uORF7 and translation of wild type THPO. Sequence chromatograms of the proband’s parents are shown below. B) Schematic of the truncated uORF7 and effects on THPO translation. The sequencing chromatogram of the proband blood and buccal cell DNA is shown below. Asterisks indicate two previously identified mutations, c.−47delG and c.−31G>T.[14,15]

Re-evaluation of the prior clinical whole exome sequencing also revealed the variant, which had been initially excluded from interpretation given it was neither a previously reported pathogenic variant nor, given its noncoding position, predicted to affect splicing. Similar to previously reported inherited pathogenic variants in uORF7,[14,15] the c.−34C>T variant increases the intercistronic distance between uORF7 and the main ORF, and eliminates extension of uORF7 translation over the physiologic AUG, allowing increased ribosomal initiation at the THPO start site and markedly enhanced TPO expression (Figure 2).

Discussion

Proper diagnosis and identification of the underlying cause of ET is critical for prognosis, treatment, and genetic counseling. This case is the first description of suspected ET in childhood caused by a de novo germline pathogenic variant in the 5’ UTR of THPO. It illustrates that THPO uORF7 variants may underlie not just familial thrombocytosis, but also sporadic, chronic thrombocytosis masquerading as ET. Additionally, while similar mutations have been reported previously, the potential impact of novel mutations may be unappreciated during the analysis of whole exome sequencing data due to their location outside of the coding region of THPO. This report brings to light the fact that base substitutions in the 5’ UTR may be clinically significant even in the absence of family history, and that those who analyze clinical whole exome sequencing must consider them.

While studies have previously reported elevated TPO levels in patients with ET,[8,11-13] those levels were substantially lower than those seen in our patient and in previously reported patients with inherited THPO uORF7 pathogenic variants.[14,15] Determination of TPO level is not included in current algorithms for the evaluation of persistent thrombocytosis or suspected ET. However, the discovery of a markedly elevated TPO level would direct further investigations, as in our case. Given the low proportion of JAK2, MPL, and CALR variants and clonality in children with suspected ET,[5] we propose that screening for an elevated TPO level be included in their initial evaluation. If found to be markedly elevated (e.g., >1000 pg/mL), evaluation for variants in the 5' UTR of THPO may prove diagnostic.

Acknowledgements

We thank the patient and his family for their participation in IRB approved study, H-29892. We also thank Dr. Kevin Fisher (Texas Children’s Hospital) for his guidance and Christopher Williams (Texas Children’s Hospital) for his technical expertise.

Abbreviations key

ET

essential thrombocythemia

TPO

thrombopoietin

uORF

upstream open reading frame

UTR

untranslated region

Footnotes

Authorship

NN performed THPO 5’UTR sequencing and wrote the manuscript. AM evaluated the bone marrow aspirate and biopsy. KB provided genetic counseling services. MS was responsible for enrollment of the patient and his parents on H-29892. DM conducted the clinical evaluation of the patient. AB oversaw the project. AM, KB, DM, and AB edited the manuscript. The authors have disclosed that they have no significant relationships with, or financial interest in, any commercial companies pertaining to this article.

References

  • 1.Tefferi A, Wassie EA, Guglielmelli P, Gangat N, Belachew AA, Lasho TL, Finke C, Ketterling RP, Hanson CA, Pardanani A, Wolanskyj AP, Maffioli M, Casalone R, Pacilli A, Vannucchi AM, Passamonti F. Type 1 versus Type 2 calreticulin mutations in essential thrombocythemia: a collaborative study of 1027 patients. Am J Hematol. 2014;89(8):E121–124. doi: 10.1002/ajh.23743. [DOI] [PubMed] [Google Scholar]
  • 2.Alimam S, Wilkins BS, Harrison CN. How we diagnose and treat essential thrombocythaemia. Br J Haematol. 2015;171(3):306–321. doi: 10.1111/bjh.13605. [DOI] [PubMed] [Google Scholar]
  • 3.Langabeer SE, Andrikovics H, Asp J, Bellosillo B, Carillo S, Haslam K, Kjaer L, Lippert E, Mansier O, Leibundgut E, Percy MJ, Porret N, Palmqvist L, Schwarz J, McMullin MF, Schnittger S, Pallisgaard N, Hermouet S, EuroNet MP. Molecular diagnostics of myeloproliferative neoplasms. Eur J Haematol. 2015;95(4):270–279. doi: 10.1111/ejh.12578. Mpn. [DOI] [PubMed] [Google Scholar]
  • 4.Tefferi A, Pardanani A. Myeloproliferative Neoplasms: A Contemporary Review. JAMA Oncol. 2015;1(1):97–105. doi: 10.1001/jamaoncol.2015.89. [DOI] [PubMed] [Google Scholar]
  • 5.Randi ML, Geranio G, Bertozzi I, Micalizzi C, Ramenghi U, Tucci F, Notarangelo LD, Ladogana S, Menna G, Giordano P, Consarino C, Farruggia P, Zanazzo GA, Fiori GM, Burnelli R, Russo G, Jankovich M, Peroni E, Duner E, Basso G, Fabris F, Putti MC. Are all cases of paediatric essential thrombocythaemia really myeloproliferative neoplasms? Analysis of a large cohort. Br J Haematol. 2015;169(4):584–589. doi: 10.1111/bjh.13329. [DOI] [PubMed] [Google Scholar]
  • 6.Karow A, Nienhold R, Lundberg P, Peroni E, Putti MC, Randi ML, Skoda RC. Mutational profile of childhood myeloproliferative neoplasms. Leukemia. 2015 doi: 10.1038/leu.2015.205. [DOI] [PubMed] [Google Scholar]
  • 7.Fu R, Liu D, Cao Z, Zhu S, Li H, Su H, Zhang L, Xue F, Liu X, Zhang X, Cheng T, Yang R, Zhang L. Distinct molecular abnormalities underlie unique clinical features of essential thrombocythemia in children. Leukemia. 2016;30(3):746–749. doi: 10.1038/leu.2015.167. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Werynska B, Ramlau R, Podolak-Dawidziak M, Jankowska R, Prajs I, Usnarska-Zubkiewicz L, Kuliczkowski K. Serum thrombopoietin levels in patients with reactive thrombocytosis due to lung cancer and in patients with essential thrombocythemia. Neoplasma. 2003;50(6):447–451. [PubMed] [Google Scholar]
  • 9.Griesshammer M, Hornkohl A, Nichol JL, Hecht T, Raghavachar A, Heimpel H, Schrezenmeier H. High levels of thrombopoietin in sera of patients with essential thrombocythemia: cause or consequence of abnormal platelet production? Ann Hematol. 1998;77(5):211–215. doi: 10.1007/s002770050445. [DOI] [PubMed] [Google Scholar]
  • 10.Karakus S, Ozcebe OI, Haznedaroglu IC, Goker H, Ozatli D, Kosar A, BuyukasIk Y, Ertugrul D, SayInalp N, Kirazl IS, Dundar SV. Circulating thrombopoietin in clonal versus reactive thrombocytosis. Hematology. 2002;7(1):9–12. doi: 10.1080/10245330290020081. [DOI] [PubMed] [Google Scholar]
  • 11.Hou M, Carneskog J, Mellqvist UH, Stockelberg D, Hedberg M, Wadenvik H, Kutti J. Impact of endogenous thrombopoietin levels on the differential diagnosis of essential thrombocythaemia and reactive thrombocytosis. Eur J Haematol. 1998;61(2):119–122. doi: 10.1111/j.1600-0609.1998.tb01071.x. [DOI] [PubMed] [Google Scholar]
  • 12.Cerutti A, Custodi P, Duranti M, Noris P, Balduini CL. Thrombopoietin levels in patients with primary and reactive thrombocytosis. Br J Haematol. 1997;99(2):281–284. doi: 10.1046/j.1365-2141.1997.3823196.x. [DOI] [PubMed] [Google Scholar]
  • 13.Pitcher L, Taylor K, Nichol J, Selsi D, Rodwell R, Marty J, Taylor D, Wright S, Moore D, Kelly C, Rentoul A. Thrombopoietin measurement in thrombocytosis: dysregulation and lack of feedback inhibition in essential thrombocythaemia. Br J Haematol. 1997;99(4):929–932. doi: 10.1046/j.1365-2141.1997.4633267.x. [DOI] [PubMed] [Google Scholar]
  • 14.Kondo T, Okabe M, Sanada M, Kurosawa M, Suzuki S, Kobayashi M, Hosokawa M, Asaka M. Familial essential thrombocythemia associated with one-base deletion in the 5'-untranslated region of the thrombopoietin gene. Blood. 1998;92(4):1091–1096. [PubMed] [Google Scholar]
  • 15.Ghilardi N, Wiestner A, Kikuchi M, Ohsaka A, Skoda RC. Hereditary thrombocythaemia in a Japanese family is caused by a novel point mutation in the thrombopoietin gene. Br J Haematol. 1999;107(2):310–316. doi: 10.1046/j.1365-2141.1999.01710.x. [DOI] [PubMed] [Google Scholar]
  • 16.Wiestner A, Schlemper RJ, Maas AP, Skoda RC. An activating splice donor mutation in the thrombopoietin gene causes hereditary thrombocythaemia. Nat Genet. 1998;18(1):49–52. doi: 10.1038/ng0198-49. [DOI] [PubMed] [Google Scholar]
  • 17.Liu K, Kralovics R, Rudzki Z, Grabowska B, Buser AS, Olcaydu D, Gisslinger H, Tiedt R, Frank P, Okon K, Maas AP, Skoda RC. A de novo splice donor mutation in the thrombopoietin gene causes hereditary thrombocythemia in a Polish family. Haematologica. 2008;93(5):706–714. doi: 10.3324/haematol.11801. [DOI] [PubMed] [Google Scholar]
  • 18.Ghilardi N, Wiestner A, Skoda RC. Thrombopoietin production is inhibited by a translational mechanism. Blood. 1998;92(11):4023–4030. [PubMed] [Google Scholar]
  • 19. January 21. In Exome Aggregation Consortium (ExAC) < exac.broadinstitute.org>. Accessed 2016 January 21.

RESOURCES