Cloning and characterization of mersacidin like bacteriocin from Bacillus licheniformis MKU3 in Escherichia coli

Abstract

A putative gene encoding mersacidin like lantibiotic bacteriocin (lanA) was identified in Bacillus licheniformis genome. The lanA open reading frame codes for 74 amino acids with calculated isoelectric point of 6.7 and molecular mass of 8.2 kDa. The lanA gene was amplified from B. licheniformis MKU3, cloned in pQE30 vector and overexpressed in Escherichia coli M15. The recombinant peptide was purified to homogeneity using Ni–NTA chromatography and the SDS-PAGE analysis of the purified peptide revealed it to be a monomer with molecular mass of ~8.5 kDa. The purified bacteriocin showed wide spectrum activity against gram-positive pathogens. The peptide was found to be stable under in wide range of pH, temperature tolerant and resistant to the proteolytic enzymes. The stable nature of the bacteriocin to high temperature and resistant to various chemicals it also exhibited antimicrobial activity against food-borne pathogens make this bacteriocin as potent attractive antimicrobial agent in food products.

Introduction

Bacteriocins are ribosomally synthesized peptides that affect the growth and viability of closely related microorganisms. Earlier studied bacteriocins are colicins produced by the Enterobacteriaceae (Pugsley 1984) and antimicrobial peptides produced by several Gram-positive bacteria. In particular, bacteriocins produced by lactic acid bacteria have gained interest due to their potential application as natural food preservatives and therapeutic agents (Tagg et al. 1976). The bacteriocins are grouped into four distinct classes (Klaenhammer 1993) namely the class I bacteriocins are lantibiotics type containing unusual thioether amino acids, which are generated through post-translational modification (McAuliffe et al. 2001). The class II bacteriocins are small (<10 kDa), heat-stable, membrane-active peptides (Nes and Holo 2000) which are further divided into three subgroups: IIA are Listeria-active peptides containing N-terminal consensus sequence YGNGVXC (where X is any amino acid); IIB peptides are poration complexes that require two different peptides for its activity; and IIC are extracellular peptides dependent on the general secretory (sec) pathway. The class III bacteriocins are large (>30 kDa), heat labile proteins whereas the class IV bacteriocins contain essential lipid or carbohydrate moieties.

Similar to Lactic acid bacteria, several Bacillus spp., such as B. subtilis and B. licheniformis, are ‘generally recognized as safe’ (GRAS) bacteria (Sharp et al. 1989). Antimicrobial peptides or lantibiotic bacteriocins are produced by many gram positive bacteria including B. subtilis, B. thuringiensis, B. stearothermophilus (Sharp et al. 1979), B. licheniformis (Jamal et al. 2006), B. megaterium (Kiss et al. 2008), B. thermoleovorans (Novotny and Perry 1992), B. cereus (Bizani et al. 2008) and B. coagulans (Hyronimus et al. 1998). Several of the above mentioned bacteriocins were not purified to homogeneity for the study of biochemical characterizations and genetic information on these peptides are limited. The well characterized bacteriocins are subtilin, subtilisin from Bacillus subtilis (Shelburne et al. 2007) and megacin from B. megaterium (Kiss et al. 2008). Since several bacterial genome sequences are available in public databases, mining novel bacteriocins may be an attractive alternative. These bacteriocins could be used as an effective preservative to control the food-borne pathogens. The recombinant cells would merit consideration as an alternative experimental model for the heterologous production and functional expression of bacteriocin, the ability to grow in minimally defined media, as well as for the fast and efficient recovery of the bacteriocin from the supernatant of the recombinant producer.

Since there is no report on cloning of lantibiotic mersacidin gene from B. licheniformis, an attempt was made to clone and express this gene. In the present study, our objective was to identify and characterize a bacteriocin which is having wide spectrum activity against several food borne pathogens.

Materials and methods

Bacterial strains and growth conditions

Bacillus licheniformis (MKU3) from our laboratory stock (Microbial Type Culture Collection, Chandigarh, India; MTCC 5271) was grown in nutrient broth (Hi Media, Mumbai, India) at 37 °C for 18 h. E. coli M15 [pRep4] (Qiagen, Hilden Germany) was grown in Luria-Bertani (LB) medium (Hi Media, Mumbai, India) at 37 °C for 12 h in a shaking incubator. All indicator bacterial strains and their growth media used are listed in Table 3.

Table 3.

Antibacterial activity of the purified LanA bacteriocin

Indicator strain	Medium used	Antibacterial activity
Staphylococcus aureus GCS1	NA	+
Bacillus cereus GCS2	NA	+
Bacillus cereus GCS3	NA	+
Staphylococcus epidermidis GCS4	NA	+
Staphylococcus epidermidis GCS5	NA	+
Kurthia gibsonii GCS6	NA	+
Micrococcus luteus GCS7	NA	+
Bacillus subtilis GCS8	NA	+
Streptococcus fecalis GCS9	NA	+
Bacillus cereus GCS10	NA	+
Bacillus cereus GCS11	NA	+
Lactobacillus acidophilus GCS12	MRS	+
Lactobacillus lactis NRRL B-1821	MRS	+
Lactobacillus acidophilus NRRL B-4495	MRS	+
Bacillus subtilis NRRL B-4219	NA	+
Staphylococcus epidermidis NRRL B-4268	NA	+
Bacillus smithii NRS-173	NA	+
Micrococcus luteus NRRL B-287	NA	+
Serratia marcescens ATCC27117	NA	–
Pseudomonas fluorescens NRRL B10	NA	–
Escherichia coli DH5α	LB	–

The media used in the bioassay were NA: Nutrient Agar, MRS: deMan Rogosa Sharpe Agar, LB: Luria Bertani Agar, GCS1-12 Laboratory strains

Cloning

Total genomic DNA from B. licheniformis MKU3 was isolated using the Qiagen DNA Purification Kit (Qiagen, Germany) and used as target DNA for PCR amplification of the gene lanA (fragment P, 216 bp) with primers lanAF (5′- GCTACATATGTCAAAAAAGGAAATGATTC – 3′) and lanAR (5′- ATACTCGACGTTACAGCTTGGCATGC - 3′). The primer were designed using the sequence available in the nucleotide accession number (CP000002; AE001733) by Netprimer software (www.premierbiosoft.com). PCR amplifications were performed in 50-μl reaction mixtures using 3 μl of purified DNA, 70 pmol of each primer and 1 U of Biotools DNA polymerase (Biotools, Madrid, Spain). Samples were subjected to an initial cycle of denaturation (95 °C for 2 min), followed by 35 cycles of denaturation (94 °C for 45 s), annealing (64 °C for 30 s) and elongation (72 °C for 30 s to 2 min), ending with a extension at 72 °C for 5 min, in a DNA thermal cycler (Biorad; Techne, Cambridge, UK). PCR-generated fragments were purified using a QIAquick PCR Purification Kit (QIAGEN, Hilden, Germany) before cloning into pQE-30UA vector (Qiagen, Hilden, Germany) and the construct pQLAN was used transform E. coli M15 [pRep4] by using Bio-Rad gene pulser electroporation unit (Bio-Rad Laboratories, Richmond, California).

Restriction digestion of DNA

An aliquot of DNA sample was mixed with 2 μl of appropriate 10X restriction buffer and the volume made up to 20 μl with MQ water. The reaction was started with the addition of the enzyme (EcoRI and HindIII) and incubated at 37 °C/30 °C for 2 h. Incubation at 70 °C for 3 min terminated the reaction. The digested DNA was observed on 1 % agarose gel. The sizes of the restriction fragments were determined by comparing their mobility with appropriate molecular weight DNA markers.

Ligation

A 224-bp fragment of the bacteriocin gene (lanA) was amplified by PCR and ligated into the EcoRI and HindIII site of pQE-30UA to form the plasmid pQElanA.

Transformation of E. coli

E. coli was transformed with plasmid DNA according to CaCl₂ method (Maniatis 1982). To 100 μl of competent cells, ~100 ng of plasmid DNA in ligation mixture was added. This was kept on ice for 45 min. A heat shock at 42 °C was given for 90 s. The cells were immediately chilled on ice for about 10 min. To this mix 900 μl of LB broth was added and the cells were incubated at 37 °C (60 min) for expression and plated on LB agar supplemented with X-gal (20 mg l⁻¹), IPTG (40 mg l⁻¹) or appropriate antibiotics. After overnight incubation at 37 °C, all white colonies were scored as transformants and then screened for the selected marker or activity (Maniatis 1982).

Plasmid isolation

The plasmid DNA was isolated by the method of Birnboim and Doly, (1979). Late log phase E. coli cultures (1.5) ml were transferred to a microcentrifuge tubes and centrifuged at 6,000 rpm for 10 min. The cells were resuspended completely in 150 μl of TEG buffer (Tris HCl 25 mM, EDTA 10 mM, glucose 50 mM pH 8.0). The cells were lysed, thereafter, by the addition of 300 μl of lysis mix (NaOH 0.2 N, SDS 1 % w v⁻¹), mixed thoroughly by inverting the tubes 4–6 times, and incubated for 5 min in room temperature. After the addition of 225 μl of 3 M potassium acetate buffer (pH 4.8), the tubes were gently mixed by inverting the tubes 5–6 times, incubated on ice for 30 min and centrifuged at 4 °C for 15 min (13,000 rpm). To the supernatant, 375 μl of isopropanol was added and the tubes were kept at room temperature for 15 min and the nucleic acid precipitate was collected by centrifugation at 10,000 rpm for 10 min. The DNA pellet was resuspended in 20 μl of TE (Tris HCl 10 mM, EDTA 1 mM).

Expression and purification of bacteriocin

E. coli M15 harboring recombinant plasmids were grown upto 0.6 OD at 600 nm in LB medium (g L⁻¹): tryptone - 10.0; yeast extract - 5.0; NaCl - 10.0 supplemented with 30 μg ml⁻¹ kanamycin at 37 °C. The cells were induced by adding 400 μmol L⁻¹ concentrations of IPTG and incubated at 37 °C for an additional 4 h. The cell pellets were resuspended in 20-mM sodium phosphate buffer (pH 7.5) in the presence of 1 mg ml⁻¹ lysozyme and incubated on ice for 30 min. Cells were disrupted by sonication at 4 °C for 5 min, and the lysate was centrifuged at 14,000 × g for 20 min at 4 °C to remove the cell debris. The resulted crude extract was concentrated by ultrafiltration (MW cutoff, 10 kDa, Amersham pharmacia, Uppsala, Sweden) and further subjected to purification. The fraction was further subjected to previously equilibrated with a binding buffer (50 mM NaH₂PO₄, 300 mM NaCl, pH 8.0) a Ni-NTA superflow column (5 × 1 cm, Amersham Pharmacia, Uppsala, Sweden). Unbounded proteins were washed out with a washing buffer (50 mM NaH₂PO₄, 300 mM NaCl, 20 mM imidazole, pH 8.0). The recombinant protein was eluted from the column with an elution buffer (50 mM NaH₂PO₄, 300 mM NaCl, 250 mM imidazole, pH 8.0). The fractions were assayed for bacteriocin activity and proteins were resolved on SDS-PAGE.

SDS-PAGE analysis of purified bacteriocin

Proteins were separated by Tricine-SDS-PAGE as described by Schägger and Von Jagow (1987). Molecular-weight-marker proteins with sizes ranging from 3 to 47 kDa (Bangalore Genei, Bangalore, India) were used. The gels were fixed and one-half was stained with Coomassie Blue R250, and the position of the active bacteriocin was determined on an unstained gel. Kurthia gibsonni GCS6 (10⁶ CFU/ml) is the indicator organism, suspended in nutrient agar (0.8 %) (Hi-Media, Mumbai, India) was used to overlay the gel to detect the zone of clearance after overnight incubation at 37 °C (Ivanova et al. 1998).

Bacteriocin assay and mode of action

Bacteriocin activity was determined by using agar well diffusion assay. Indicator bacteria were inoculated as lawn on the nutrient agar and purified bacteriocin was added into the wells in the lawn. The plates were incubated for overnight at 37 °C and diameter of inhibition zones was measured. Unit of antimicrobial activity (AU) was defined as the reciprocal of the highest level of dilution resulting in a clear zone of growth inhibition (Green et al. 1997). Specific activity of bacteriocin was expressed as units per mg of protein (AU mg⁻¹). Protein concentration was estimated by the method of Lowry et al. (1951) using bovine serum albumin (BSA) as standard.

The antimicrobial protein (50 AU ml⁻¹) was added to exponential growing cells of K. gibsonii GCS6 in nutrient medium. Sterile nutrient medium was used as control. Changes in the turbidity of the cultures were recorded at an OD of 600 nm and the number of colony-forming units (CFU) was determined by plating the samples on nutrient agar.

Effects of pH, temperature, chemicals and proteases

Aliquot of the purified bacteriocin was treated with proteinase K, trypsin or pronase E (2 and 10 mg ml⁻¹) (Sigma, St Louis, USA) at 37 °C for 1 h against Kurthia gibsonni GCS6. The set of aliquots of purified bacteriocin was kept at temperatures ranging from 30 to 100 °C for 30 min, 100 °C for 5–60 min and 121 °C for 15 min. To analyze the pH stability, the purified bacteriocin were incubated at different sodium phosphate buffers pH levels ranging from 3.0 to 10.0 for 2 h at 25 °C. Later neutralized to pH 7.0 and then tested for antimicrobial activity. Another set of samples were incubated with the selected chemicals for 1 h at 37 °C. Organic solvents were used at the working concentration of 50 % (v v⁻¹). The detergents Tween 20 and 80 (10 % v v⁻¹), sodium deoxycholate (0.1 % w v⁻¹), EDTA and trichloroacetic acid (10 mM and 0.61 M) concentrations were used. After treatment with TCA, samples were centrifuged at 10 000 g for 5 min and the supernatant was neutralized to pH 7.0. In all experiments, untreated purified bacteriocin was served as control.

Homology modeling

The Deep View programme (version 3.7) in SWISS-MODEL server was used to generate the 3D model of bacteriocin. Using the integrated sequence alignment tools and structural superimposition algorithms, the target sequence was mapped on the modeling templates. The sequence alignment was then optimized manually and the resulting model of B. licheniformis bacteriocin was analyzed using Swiss-PDB Viewer. Figures were created with PyMOL version 0.98. The model was validated using WHATCHECK programme available at the WHAT IF web interface (Rodriguez et al. 1998).

Results

Cloning and sequencing of bacteriocin gene of B. licheniformis MKU3

The whole genome of B. licheniformis ATCC 14580 sequence analysis revealed the presence of an ORF (224 bp) that code for putative mersarcidin like lantibiotic precursor. This ORF was amplified from genomic DNA of B. licheniformis MKU3 and directly cloned into pQE30-UA vector and expressed in E. coli M15[pREP4], the recombinant plasmid was designated as pQLAN (Fig. 1a). The size of the cloned gene in the recombinant plasmid was confirmed by digesting with restriction enzymes EcoRV and HindIII by electrophoresis (Fig. 1b). Nucleotide and deduced amino acid sequence of putative bacteriocin lanA of B. licheniformis MKU3 is presented in Fig. 2a and b. BlastN analysis of the lanA sequence showed 100 % identity with lantibiotic mersacidin precursor of B. licheniformis 14580/DSM13. The sequence analysis of the cloned lanA revealed that it encodes a polypeptide of 74 amino acids, with no signal peptide and a calculated molecular mass of 8.2 KDa and isoelectric point (pI) of 6.7. The deduced amino acid sequence of lanA gene showed 100, 60.52, 45.94, 43.47, and 44.28 % sequence identity with mersacidin from B. licheniformis DSM13, Bacillus holodurans, Ruminococcus gnavus, Streptococcus ratti and Streptococcus mutans respectively (Table 1). The secondary structure of lanA peptide is composed of 47.30 % of random coil, 32.43 % of alpha helix, 13.51 % of extended strand and 6.76 % of beta turn.

Fig. 1.

Cloning of lanA gene in pQE30A a PCR amplification of Lantibiotic mesarcidin gene lanA Lane M- 100 bp DNA Marker; Lane 2- PCR amplicon of B. licheniformis MKU3 genomic DNA with lanA specific primers.b Restriction digestion of plasmid pQLAN. Recombinant plasmid pQLAN was isolated and digested with EcoRV and HindIII and resolved on 0.7 % agarose gel. Lane M- 1 kb DNA Marker; Lane 1- Plasmid pQLAN from recombinant E. coli; Lane 2- EcoRV and HindIII digested pQLAN; Lane 3- Amplicon obtained from the PCR with lanA gene specific primers

Fig. 2.

a Nucleotide and deduced amino acid sequence of lanA of B. licheniformis MKU3 b Phylogenetic analysis of bacteriocin. The amino acid sequence of bacteriocin LanA was used to analyze the similarity relationship with related lantibiotics. The dendrogram was generated with ClustalX in Phylip format using the neighbor-joining method and displayed in Treeview

Table 1.

Similarity index of LanA of B. licheniformis MKU3 with other mersacidins from related bacteria

Strains	B. licheniformis MKU3	B. licheniformis ATCC 14580	B. holodurans	R. gnavus	S. ratti	S. mutans
B. licheniformis MKU3	–	100	60.52	45.94	43.47	44.28
B. licheniformis ATCC 14580	100	–	60.52	45.94	43.47	44.28
B. holodurans	43.42	43.42	–	53.75	48.64	49.33
R. gnavus	29.72	29.72	32.50	–	35.82	35.29
S. ratti	33.33	33.33	36.48	17.91	–	98.38
S. mutans	32.85	32.85	36.00	17.64	96.77	–

The percentage identity of amino acid sequences are listed in lower diagonal and the percentage similarity are listed in upper diagonal

Expression of lanA and molecular weight determination

The plasmid pQLAN carrying lanA expressed in E. coli M15 [pREP4] using the T5 promotor. Upon induction with IPTG (0.5 mM), the lanA gene was expressed in E. coli M15 (pQLAN) as revealed from the SDS-PAGE analysis. The bacteriocin was purified through nickel-nitrilotriacetic acid Ni-NTA affinity chromatography (Fig. 3). The expected molecular mass of ~8.5 kDa was detected from E. coli M15 (pQLAN) and result also well agreed with the predicted molecular mass for the bacteriocin. In parallel, zymogram analysis of LanA with K. gibsonii GCS6 as an indicator revealed an inhibition zone at the position of ~8.5 kDa protein band (Fig. 4). This result suggested that the bacteriocin lanA is a monomer with molecular weight of ~8.5 kDa. The specific activity of purified LanA was 49 × 10² AU ml⁻¹ and thus resulting in purification fold of 29 (Table 2).

Fig. 3.

Affinity chromatographic purification of recombinant bacteriocin LanA from E. coli M15 (pQLAN) Purification was performed at 22 °C in FPLC using HiTrap (5 ml) metal chelating column (Amersham Pharmacia Biotech, USA). Clear cell lysate (50 ml) was passed through the column at a flow rate of 0.5 ml min⁻¹ and washed with 10 column volumes of start buffer (20 mM sodium phosphate (pH 7.0), 100 mM NaCl and 20 mM imidazole). His-tagged protein was eluted with imidazole gradient using the elution buffer (20 mM sodium phosphate (pH 7.0), 100 mM NaCl and 400 mM imidazole). Fractions (2 ml) were collected, assayed for bacteriocin activity and the active fractions were pooled

Fig. 4.

SDS-PAGE and zymogram analyses of purified bacteriocin Proteins were resolved on a 15 % Tricine SDS-PAGE and stained with Coomassie brilliant blue R-250. Zymogram analysis was performed by overlaying the 0 · 7 % soft agar containing 10⁶ indicator strain K. gibsonii GCS6. Lane M-Molecular weight protein markers; Lane 1- Cell extract of E. coli (pQLAN) induced with 0.4 mM IPTG; Lane 2-Cell extract of E. coli M15; Lane 3-LanA protein of E. coli M15 (pQLAN) purified through affinity chromotography; Lane 4- purified LanA showing clear zone of inhibition on direct overlay of indicator strain K. gibsonii GCS6 on the gel

Table 2.

Purification of LanA from E. coli M15 (pQLAN)

Purification step	Volume (ml)	Total activity (AU)	Specific activity (AU mg−1)	Purification fold	Recovery (%)
Cell lysate	150	2,450	1,700	1	100
Ultrafiltration	50	1,800	4,100	2.4	73.5
Affinity Chromotograpy	10	250	49,000	29	10.2

Characterization of purified bacteriocin LanA

Bacteriocin assay

The antibacterial spectrum of purified of bacteriocin LanA was determined by agar well diffusion method. The purified LanA exhibited the broad spectrum of antagonistic activity against Gram-positive bacteria such as Bacillus sp., Lactobacillus, Staphylococcus sp. and Streptococcus sp. however not against Gram negative bacteria (Table 3). To determine lethal effect of LanA bacteriocin activity against sensitive strains, purified bacteriocin LanA was added to the cell suspension of K. gibsonii GCS6 (10⁷ CFU ml⁻¹). The number of viable bacterial cells after the exposure to LanA bacteriocin rapidly decreased (Fig. 5). The reduction in viable cell number was approximately 50 % in 5 h. These results strongly suggested that the LanA exhibits bactericidal effect on the indicator organism.

Fig. 5.

Effect of LanA on the viability of K. gibsonii GCS6 The culture of K. gibsonii GCS6 was incubated at 37 °C in 50 mM phosphate buffer without (♦) and with (■) 50 AU of LanA

Effects of proteolytic enzymes, heat, pH and chemicals on LanA activity

The recombinant LanA against the indicator strain K. gibsonii GCS6 was examined for its sensitivity to several proteases, chemicals, heat and pH and the results are summarized in Table 4. The purified LanA was resistant to proteinase K, pronase E and trypsin treatment. The LanA was stable to heat treatment up to 100 °C but unstable at 121 °C for 15 min and showed stability for wide range of pH 3–10. The LanA bacteriocin was also stable to various chemicals such as TCA, chloroform, methanol, butanol, toluene, Tween- 80, EDTA and SDS.

Table 4.

Effect of different enzymes, temperature, and pH on LanA activity against K.gibsonni GCS6

Treatment	Bacteriocin activity
Trypsin, 1 mg ml−1	+
Proteinase K,1 mg ml−1	+
Pronase, 1 mg ml−1	+
20–100 °C for 10 min	+
100 °C for 10–60 min	+
121 °C/15 min	-
pH 3.0–10.0	+
Acetone (50 % v v−1)	+
n- butanol (50 % v v−1)	+
Chloroform (50 % v v−1)	+
Methanol (50 % v v−1)	+
Toluene (50 % v v−1)	+
TCA (0.6 mM)	+
Tween-80 (10 % v v−1)	+
EDTA (10 mM)	+
SDS (10 % w v−1)	+

Structure prediction by homology modeling

B. licheniformis MKU3 LanA sequence did not find any matching sequence in PDB databank. It showed only 50 % sequence similarity with KvAP potassium channel voltage sensor membrane protein. This degree of sequence similarity is sufficient to make a homology model of LanA. The Swiss-PDB Viewer (www.expasy.org/spdbv) supported by the SWISS-MODEL server was used to generate the 3D model (Fig. 6). The structure evaluation server WHAT IF (www.cmbi.kun.nl/gv/servers/WIWWWI) was used for validation of the model. The modeled structure was 85 % correct by the validation tool. The plot indicates that the backbone conformations of amino acid residues are scattered within the acceptable regions (contoured areas). The modeled structure of bacteriocin of LanA indicated that bacteriocin LanA belongs to pore forming membrane and cell surface proteins.

Fig. 6.

Surface and ribbon model of the predicted structure of LanA

Discussion

Genome mining approach is considered to be a valuable tool for the development of new antimicrobials. In the present study, a putative mesarcidin like bacteriocin gene (lanA) was identified in the whole genome sequence of B. licheniformis ATCC 14580. Previously Choi et al. (2001) employed nisin gene-specific primers to clone bacteriocin from L. lactis A164. Sakacin G (class IIa bacteriocin) L. sake 2512 and haloarchaeal bacteriocin (halocin H4) in Haloferax mediterranei R4 have been cloned by PCR based technique (Simon et al. 2002; Cheung et al. 1997).

The development of heterologous expression systems for bacteriocin production may offer several advantages over native systems. Some of the small, class II bacteriocins namely mesentericin Y105, gassericin A, pediocin PA-1, divergicin V41, enterocin A and enterocin P have been expressed in E. coli (Gutierrez et al. 2005; Moon et al. 2006). In this study, mersacidin like bacteriocin lanA gene was cloned and expressed in E. coli M15 [pREP4]. The lanA was poorly expressed in E. coli and the level of bacteriocin produced in recombinant strain was 10 times lower than that of produced by the wild type strain. The overproduced proteins in E. coli system are often aggregated to form inclusion body as a result of their improper folding (Baneyx and Mujacic 2004). Similarly, the activity of enterolysin A was 8.5 times lower than the natsive bacteriocin (Nigutova et al. 2008). The low level of expression of boticin B was found to be due to the absence of additional genes for regulatory activity, immunity, peptide modification and protein translocation. C. botulinum 62A transconjucant carrying boticin B showed 2 mm inhibition zone smaller than that observed with the wild type C. botulinum 6213B culture filtrate (8 mm) (Dineen et al. 2000). Since LanA was produced as His-tagged protein in the recombinant strain, it was purified employing Ni-NTA affinity chromatography.

The antibacterial activity range of LanA is rather narrow and limited to Gram-positive bacteria such as B. subtilis, B. smithii, B. megaterium, K. gibsonii, Staphylococcus and Streptococcus sp. But in earlier reports B. licheniformis produced a novel protein (30.7 kDa) with antibacterial activity against methicillin-resistant S. aureus, vancomycin-resistant Enterococci and L. monocytogenes (Jamal et al. 2006). Martirani et al. (2002) reported that bacillocin 490 is active principally against species phylogenetically related organisms. B. licheniformis P40 produced an antimicrobial peptide that showed a broad spectrum of activity against several spoilage and pathogenic microorganisms, and Corynebacterium fimi NCTC 7547 (Oliveira et al. 1998). Due to relative stability to pH, temperature and resistant to various chemicals and solvents, LanA was characterized as a bacteriocin-like protein (Klaenhammer 1993). Due to the resistance to proteolytic enzymes, the LanA bacteriocin is differed from other bacteriocin produced by Bacillus spp. (Hyronimus et al. 1998).

Three-dimensional structure of a protein provides valuable insight into the molecular basis of its function. Protein structure elucidation by X-ray crystallography and nuclear magnetic resonance spectroscopy (NMR) is still a time-consuming and expensive process Therefore, a 3-D model of LanA bacteriocin was generated using crystal structures of KvAP potassium channel voltage sensor membrane protein as template and structure validation at the server WHAT IF (Rodriguez et al. 1998). Ramachandran plot indicated that most of the residues are scattered within the acceptable regions of allowed conformation. Voltage-dependent ion channels respond to changes in cell membrane voltage and permit the propagation of action potentials. The structures of several voltage sensor toxins have been determined (Lee et al. 2005; Takahashi et al. 2004). Typical of small disulphide core proteins are well-structured globular proteins about 35 amino acids. The voltage sensor toxins exhibit unique feature of a strong hydrophobic moment at one face. The LanA bacteriocin from the present study was also hydrophobic and interacts with membrane of the indicator strains. Previously, Sanchez-Barrena et al. (2003) has also reported that bacteriocin AS-48 is a membrane interacting peptide which displays antimicrobial spectrum against Gram-positive and Gram-negative bacteria by the accumulation of positively charged molecules at the membrane surface leading to a disruption of the membrane potential. Our study also suggests that LanA bacteriocin to be a membrane interactive peptide.

Conclusion

Over the past several years, bacteriocins have received significant attention due to their potential application in food industry to provide microbiologically safe foods. The most attractive feature of bacteriocins is their improved potential as food preservatives when compared to conventional chemical preservatives. Although, the antimicrobial activity of bacteriocins is relatively well understood, their use as safe biopreservatives in food and feed is still limited. So far, nisin, a small antimicrobial peptide produced by Lactococcus lactis subsp. lactis, is the only bacteriocin officially approved in the EU as food additive for protection against bacterial pathogens. Necessary precondition before bacteriocins can be applied in foods and feed is assessing their antimicrobial activity and toxicity. Moreover, isolation and purification of bacteriocins from their native hosts is time-consuming and laborious process. In the present study, we have cloned and expressed bacteriocin gene in E. coli. As reported in our earlier study, this bacteriocin has a broad antimicrobial spectrum that inhibits many potentially pathogenic microorganisms, including food-borne pathogens. Successful expression of biologically active form of recombinant bacteriocin in the soluble fraction and their broad antimicrobial activity may facilitate high level production of this bacteriocin, purification and use as safe antimicrobial food and feed additive.