Abstract
Direct-acting antivirals (DAAs) with activity against multiple genotypes of the hepatitis C virus (HCV) were recently developed and approved for standard-of-care treatment. However, sequencing assays to support HCV genotype 5 and 6 analysis are not widely available. Here, we describe the development of a sequencing assay for the NS3/4A, NS5A, and NS5B genes from HCV genotype 5 and 6 patient isolates. Genotype- and subtype-specific primers were designed to target NS3/4A, NS5A, and NS5B for cDNA synthesis and nested PCR amplification. Amplification was successfully performed for a panel of 32 plasma samples from HCV-infected genotype 5 and 6 patients with sequencing data obtained for all attempted samples. LiPA 2.0 (Versant HCV genotype 2.0) is a reverse hybridization line probe assay that is commonly used for genotyping HCV-infected patients enrolled in clinical studies. Using NS3/4A, NS5A, and NS5B consensus sequences, HCV subtypes were determined that were not available for the initial LiPA 2.0 result for genotype 6 samples. Samples amplified here included the following HCV subtypes: 5a, 6a, 6e, 6f, 6j, 6i, 6l, 6n, 6o, and 6p. The sequencing data generated allowed for the determination of the presence of variants at amino acid positions previously characterized as associated with resistance to DAAs. The simple and robust sequencing assay for genotypes 5 and 6 presented here may lead to a better understanding of HCV genetic diversity and prevalence of resistance-associated variants.
INTRODUCTION
Globally, 130 to 150 million people have chronic hepatitis C virus (HCV) infection. Without treatment, chronic hepatitis may lead to liver cirrhosis and hepatocellular carcinoma and the possible need for a liver transplantation (1–3). Hepatitis C virus has high genetic diversity and is classified into seven genotypes and at least 67 subtypes among the genotypes (4, 5). At the nucleotide level for the open reading frame, there is a 31 to 33% difference between genotypes and 20 to 25% difference between subtypes (6).
HCV genotype 1 is the most prevalent genotype and is widely distributed across the globe. Genotype 1 accounts for the majority of the HCV cases in North America, northern and western Europe, South America, Asia, and Australia (7, 8). Similarly, genotypes 2 and 3 have broad geographical distribution. In contrast, genotypes 4, 5, and 6 are common only in specific regions. Genotype 4 and genotype 5 are endemic to Egypt and South Africa, respectively. Genotype 6 has the highest prevalence in Southeast Asia and southern China. Although genotypes 5 and 6 are not widespread, there are an estimated 9.8 million and 1.4 million people infected with genotypes 5 and 6, respectively, worldwide (9–13). Better treatment options are needed for genotype 5- and 6-infected patients.
Due to the high prevalence and broad geographical distribution of genotype 1, early HCV research and development efforts were focused on this genotype. With the recent approval of HCV direct-acting antivirals (DAAs) active against multiple genotypes, such as Sovaldi (sofosbuvir), Harvoni (ledipasvir and sofosbuvir), and Daklinza (daclatasvir), there is an increased need to monitor the efficacy of pan-genotypic regimens and resistance-associated variants (RAVs) that may be present at baseline and posttreatment (14–24). However, compared to HCV genotype 1, genotypes 5 and 6 are not well-studied. A limited number of genotype 5 and 6 NS3/4A, NS5A, and NS5B sequences are deposited in public databases. Currently, there are few robust sequencing assays available for HCV genotype 5 and 6 patient isolates (25). Moreover, because many of the DAAs currently approved or being studied target either the protease (NS3), NS5A, or the polymerase (NS5B), an efficient strategy to amplify and sequence multiple genes is essential. With sequencing data, the detection and analysis of known gene-specific RAVs prior to treatment may guide selection of optimal HCV DAA combinations, allowing for improved sustained virologic response. Therefore, a robust sequencing assay is needed to allow for resistance testing and analysis. In this study, we developed a deep sequencing strategy of NS3/4A, NS5A, and NS5B for HCV genotype 5 and 6, allowing for the detection and analysis of RAVs and BLAST-based subtyping in HCV-infected genotype 5 and 6 patients.
MATERIALS AND METHODS
Clinical isolates.
Plasma samples were collected from 7 HCV-infected genotype 5 and 25 HCV-infected genotype 6 treatment-naive patients enrolled in phase 2 sofosbuvir-containing treatment studies (n = 22) or commercial sources (n = 10) (ClinicalTrials.gov identifiers NCT01329978, NCT01641640, NCT01826981, and NCT01858766). The study protocols were approved by the institutional review board and ethics committee. All of the samples had patient consent for use. The samples originated from patients in the United States, South Africa, Thailand, and New Zealand. The ethnicity for the United States and New Zealand patients was either non-Hispanic white or Asian; the ethnicity for the South African and Thai patients was unavailable. For the HCV-infected genotype 5 patients, the range for HCV RNA viral load was 65,000 to 9,300,000 IU/ml with a median of 550,000 IU/ml. For the HCV-infected genotype 6 patients, the range for HCV RNA viral load was 25,000 to 60,000,000 IU/ml with a median of 6,800,000 IU/ml.
Primer design.
All available nucleotide sequences covering NS3/4A, NS5A, or NS5B were downloaded from the European HCV Database (26) and aligned in Clone Manager 9 (Scientific and Educational Software, Cary, NC) or BioEdit (Abbott, Carlsbad, CA). Nineteen nearly full-length genotype 5 sequences were aligned (Table 1). To account for the diversity of genotype 6, 19 full-length and near-full-length genotype 6 sequences, representing the HCV genotype 6 subtypes of 6b, 6c, 6d, 6e, 6f, 6 h, 6i, 6j, 6o, 6p, 6q, 6s, and 6t, were obtained and analyzed similarly. Genotype- and subtype-specific primers were designed (Table 1). Near-full-length sequences for HCV genotype 6 subtypes of 6a, 6g, 6k, 6l, 6m, 6n, 6r, 6u, and 6v were not available at the initiation of primer design. All primers were at least 18 nucleotides in length and synthesized by Integrated DNA Technologies (Coralville, IA).
TABLE 1.
HCV NS3/4A, NS5A, and NS5B primers for cDNA synthesis and PCR amplification
| Name | Primer sequence (5′–3′) | Annealing temp (°C) |
|---|---|---|
| GT5a1_NS3/4A_PCR1_For | TGCTCCACCTTGGTAGGCTGACCGG | 50 |
| GT5a2_NS3/4A_PCR1_For | TGACCGGAACGTACATTTATGACC | 50 |
| GT5a1_NS3/4A_PCR1_Rev | GTGGAACTTTGTCAGTGGGATCCA | 50 |
| GT5a1_NS3/4A_PCR2_For | CCTATGGAGACGAAGGTCATCACG | 55 |
| GT5a1_NS3/4A_PCR2_Rev | GAGCAGTTCTGGGCAAAACACAT | 55 |
| GT6a1_NS3/4A_PCR1_For | GCCTTCTGAGGTTGGGCGCTTGGAC | 55 |
| GT6a1_NS3/4A_PCR1_Rev | CACATGTGGAACTTTGTCAGCGG | 55 |
| GT6a1_NS3/4A_PCR2_For | TGAGTGGCCTCCCGGTGTCAGC | 60 |
| GT6a1_NS3/4A_PCR2_Rev | GGGACTCCTCCAAGCGAGCGCTAAG | 60 |
| GT6e1_NS3/4A_PCR1_For | CCTGTTGTGTTCTCGCCTATGGAG | 55 |
| GT6e1_NS3/4A_PCR1_Rev | GACATCCTAGCAGGGTATGGAGC | 55 |
| GT6e1_NS3/4A_PCR2_For | GCAGACACGGCCGCGTGTGGCGAC | 55 |
| GT6e1_NS3/4A_PCR2_Rev | GAGGCATTCTGGCAGAAACATCTG | 55 |
| GT6l1_NS3/4A_PCR1_For | TTGAGAGTCGGATCTTGGACGGGCAC | 55 |
| GT6l1_NS3/4A_PCR1_Rev | GTGGAACTTTGTGAGCGGCATTC | 55 |
| GT6l1_NS3/4A_PCR2_For | TGCTGACACTGCTGCATGTGGAGAC | 55 |
| GT6l1_NS3/4A_PCR2_Rev | GTCCATTCCGCCTGGCCCAAGCT | 55 |
| GT5a_NS5A_PCR1_For | GACCTAGTMAACCTCCTGCC | 50 |
| GT5a_NS5A_PCR1_Rev | TCAAGCAAGTCCTGCCACAC | 50 |
| GT5a_NS5A_PCR2_For | TCTCCGACRCACTACGTGCC | 50 |
| GT5a_NS5A_PCR2_Rev | TACACAAGATTGTGGTGGCG | 50 |
| GT5a_NS5A_PCR2_Rev | GTGACCTTCTTCTGCCT | 50 |
| GT6_NS5A_PCR1_For | GCYTTYAAGATCATGAGYGG | 48 |
| GT6_NS5A_PCR1_Rev | AGCAAGTCCTCCCACACGGAG | 48 |
| GT6_NS5A_PCR2_For | AYCAGTGGATGAAYAGGCT | 48 |
| GT6_NS5A_PCR2_Rev | AGCAGGGCCATTAACCACATC | 48 |
| GT5a_NS5B_PCR1_For | GCGGCTTCATATTCTTCCATGCC | 50 |
| GT5a_NS5B_PCR1_Rev | GGAGTGTTTAGCTCCCAGC | 50 |
| GT5a_NS5B_PCR2_For | GACCTTTCGTCAGGGTCATGGT | 50 |
| GT5a_NS5B_PCR2_Rev | GGGAGYAAAAAGATGCCTAC | 50 |
| GT6_NS5B_PCR1_For | GGCCYGAYTAYAAYCCRC | 50 |
| GT6_NS5B_PCR1_Rev | CTACCGAGCHGGYAGCA | 50 |
| GT6_NS5B_PCR2_For | TCNTAYAGYTCNATGCC | 48 |
| GT6_NS5B_PCR2_Rev | GGAAGCAGAAAGATGCCTAC | 48 |
| GT6a_NS5B_PCR1_For | CTCTCCCAATATGGGCCAGGCCYGAYTACAATCCACC | 59 |
| GT6a_NS5B_PCR1_Rev | ATGTTGCTAAGGCCGCTCGTCTATCGAGCGGGGAG | 59 |
| GT6a_NS5B_PCR2_For | CTCGGAAGCAGAGTCCTATAGCTCWATGCCCCC | 59 |
| GT6a_NS5B_PCR2_Rev | CGTCTACCGAGCGGGGAGCAAAAAGATGCCT | 59 |
| GT6e_NS5B_PCR1_For | CACTACCTATATGGGCGAGGCCAGATTACAATCCTCC | 59 |
| GT6e1_NS5B_PCR1_Rev | GCTTTGGGCTTCCCCCTTACCGAGCGGGAAGAA | 59 |
| GT6e2_NS5B_PCR1_Rev | GCTTTAGGCTTCCCGCTTACCGAGCGGGAAGAA | 59 |
| GT6e_NS5B_PCR2_For | CTCCGATGCTGGCTCATATAGCTCCATGCCCCC | 59 |
| GT6e_NS5B_PCR2_For | CTCCGATGCTGGTTCGTACAGCTCTATGCCCCC | 59 |
| GT6e_NS5B_PCR2_Rev | CGCTTACCGAGCGGGAAGAAGGAAGATGCCTAC | 59 |
| GT6l_NS5B_PCR1_For | CACTACCTATATGGGCGCGGCCTGATTACAACCCACC | 59 |
| GT6l_NS5B_PCR1_Rev | TGGAGTGTTATGCTCCCTGCCTACCGGGCAGGGAGCA | 59 |
| GT6l_NS5B_PCR2_For | TCCTATAGCTCCATGCCACC | 59 |
| GT6l_NS5B_PCR2_Rev | GGAGCAGGAAGATGCCTAC | 59 |
cDNA synthesis and PCR amplification.
Viral RNA was isolated with a QIAamp viral RNA minikit (Qiagen, Valencia, CA) according to the manufacturer's instructions for the spin-column procedure. Using the MonsterScript 1st-strand cDNA synthesis kit (Illumina, Madison, WI), cDNA was synthesized from the RNA on a Tprofessional basic thermocycler (Biometra, Göttingen, Germany) or an ABI Veriti 96-well thermal cycler (Life Technologies, Grand Island, NY) (Table 1). The cDNA primer was the reverse primer for the first PCR and was selected based on the available result from the LiPA 2.0 assay (Versant HCV genotype 2.0). Briefly, 10 μl of the RNA, isolated from 140 μl of plasma, and 0.125 μM primer were incubated at 70°C for 4 min and then immediately chilled for more than 1 min before proceeding. After adding 1 μl MonsterScript reverse transcriptase with RNase inhibitor and 4 μl MonsterScript 5× cDNA premix (Illumina, Madison, WI), the mixture was incubated at 50°C for 10 min and then at 60°C for 40 min. Subsequently, the reverse transcriptase was heat inactivated at 90°C for 2 min. The cDNA was used as a template for consecutive PCR amplification of NS3/4A, NS5A, or NS5B. Depending on the available LiPA 2.0 result, the NS3/4A, NS5A, or NS5B amplicons were amplified with either genotype- or subtype-specific primers (Table 1), which were then used as a template for a subsequent nested PCR. Each 50-μl PCR consisted of 1 μM each forward and reverse primer, a 200 μM deoxynucleoside triphosphate set (Bioline USA Inc., Taunton, MA), 2.5 mM MgCl2 (Life Technologies, Grand Island, NY), 5 μl 10× PCR buffer (Life Technologies, Grand Island, NY), 2.5 U Platinum Taq DNA polymerase (Life Technologies, Grand Island, NY), and 4.5 μl cDNA, with the remaining volume being RNase-free water (Life Technologies, Grand Island, NY). The PCR parameters were 94°C for 2 min, 35 cycles at 94°C for 30 s or 48° to 59°C for 30 s, depending on the primers (Table 1), and then 72°C for 2 min. Nested PCR was performed next with 5 μl PCR product of each sample with the same PCR parameters mentioned above. PCR was set up at room temperature and performed on either of the aforementioned thermocyclers. All PCR products were run on a 0.8% precast E-Gel with ethidium bromide (Life Technologies, Grand Island, NY) and visualized with UV illumination to verify amplification.
Deep-sequencing-based consensus sequences.
PCR products underwent Illumina MiSeq deep sequencing at WuXi AppTec (Shanghai, China) using a procedure previously described (18). The raw deep sequencing data were processed to generate consensus sequences with a 15% cutoff using methods previously described (27). Briefly, for each sample, contigs were generated with VICUNA (28) and aligned to subtype-specific references using MOSAIK (29) to generate an NS3/4A, NS5A, or NS5B assembly sequence. This sequence was used as a reference for aligning trimmed and quality score-filtered reads to generate a consensus sequence.
HCV genotyping using sequencing data.
Using BLAST (basic alignment search tool), the HCV DNA nucleotide sequences were analyzed to determine the genotype and subtype classification (30). For each sequence, the genotype and subtype was assigned based on the highest BLAST identity percentage. The minimum BLAST identity percentage for genotype and subtype classification was 84%.
RAV analysis.
For genotype 5 NS3 sequences, known resistance-associated variants (RAVs) were defined as L36A/G/M, Q41R, F43S/I/V/L, T54A/C/G/S, V55A/I, Y56H, K80H/R/L, T122R, R155any, A156any, D168any, and I170A/L/T, with “any” representing any amino acid. For genotype 6 NS3 sequences, known RAVs were defined as V36A/G/M, Q41R, F43S/I/V/L, T54A/C/G/S, V55A/I, F56H, L80H/R/K, S122R, R155any, A156any, D168any, and I170A/L/T. For genotype 5 NS5A sequences, known RAVs were defined as Q24G/N/R, L28A/G/T, Q30E/G/H/L/K/R/T, L31F/I/M/V, P32L, S38F, P58D/S, A92K/T, and Y93C/F/H/N/S. For genotype 6 NS5A sequences, known RAVs were defined as Q24G/N, F28A/G/M/T/V, R30E/G/H/L/K/T, L31F/I/M/V, P32L, S38F, T58A/D/G/S, A92K/T, and T93A/C/F/H/N/S. For genotype 5 NS5B sequences, known RAVs were defined as S96T, N142T, L159F, E237G, S282any, M289I/L, L320F/I/V, and V321A/I. For GT 6 NS5B sequences, known RAVs were defined as S96T, N142T, L159F, N237G, S282any, M289I/L, L320F/I/V, and V321A/I.
Nucleotide sequence accession numbers.
All generated NS3/4A, NS5A, and NS5B consensus sequences were submitted to the NCBI GenBank database under accession numbers KX107848 to KX107897 and KX138233 to KX138249.
RESULTS
NS3/4A, NS5A, and NS5B PCR amplification from HCV-infected genotype 5 and 6 patients.
All cDNA synthesis and PCR amplification attempts for 14/14 NS3/4A (6 genotype 5, 8 genotype 6), 27/27 NS5A (7 genotype 5, 20 genotype 6), and 26/26 NS5B (7 genotype 5, 19 genotype 6) genes from patient HCV plasma samples were successful using the designed primers (Table 1). A deep-sequencing-based or Sanger sequencing-based (population) consensus sequence was generated for each amplicon (Table 2).
TABLE 2.
NS3/4A, NS5A, and NS5B PCR amplification results and comparison between LiPA 2.0 and BLAST-based subtyping methods
| LiPA 2.0 subtype | Result for gene: |
||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| NS3/4A |
NS5A |
NS5B |
|||||||||||||
| Patients (n) | Nucleotide coverage (start position-end position) | Concordanta (no. [%]) | Refinementb (no. [%]) | BLAST identity range (%) | Patients (n) | Nucleotide coverage (start position-end position) | Concordanta (no. [%]) | Refinementb (no. [%]) | BLAST identity range (%) | Patients (n) | Nucleotide coverage (start position-end position) | Concordanta (no. [%]) | Refinementb (no. [%]) | BLAST identity range (%) | |
| 5a | 6 | 1–685 | 6 (100) | 0 | 89–93 | 7 | 1–450 | 7 (100) | 0 | 87–93 | 7 | 1–591 | 7 (100) | 0 | 92–94 |
| 6 | 1 | 0 | 1 (100) | 95 | 9 | 1–456 | 0 | 9 (100) | 89–96 | 9 | 0 | 9 (100) | 93–97 | ||
| 6a/b | 4 | 0 | 4 (100) | 92–95 | 3 | 1–451 | 0 | 3 (100) | 90–91 | 3 | 0 | 3 (100) | 94–95 | ||
| 6c-l | 3 | 0 | 3 (100) | 89–93 | 8 | 1–456 | 0 | 8 (100) | 84–94 | 7 | 0 | 7 (100) | 89–95 | ||
| Total | 14 | 6 (42.9) | 8 (57.1) | 27 | 7 (25.9) | 20 (74.1) | 26 | 7 (26.9) | 19 (73.1) | ||||||
The same subtype was assigned by both methods.
Indeterminate subtype from LiPA 2.0 was fully determined at subtype level by BLAST sequencing.
For the 7 genotype 5 patients, NS3/4A, NS5A, and NS5B deep-sequencing-based consensus sequences were generated for 6/7, 7/7, and 6/7 patients, respectively. NS3/4A PCR amplification was not performed for one genotype 5 patient due to limited plasma sample availability. Additionally, NS5B Sanger population sequence was generated for one of the genotype 5 patients.
For the genotype 6 patients, the available LiPA 2.0 subtype result guided the selection of primers to use for the first amplification attempt. For patient samples without genotype 6 subtype information available, primers were designed with a 3′ end that was based on the most conserved region of the genotype 6 sequence alignment, including all subtypes; these primers then were used for the initial cDNA and PCR amplification attempt. For patient samples subtyped as genotype 6a/b, genotype 6a and 6b subtype-specific primers were tried individually. For patient samples subtyped as genotype 6c to 6l, subtype-specific primers for 6e and 6l were attempted first. For the 25 genotype 6 patients, NS3/4A, NS5A, and NS5B deep-sequencing-based consensus sequences were generated for 8/25, 20/25, and 11/25 patients, respectively. Due to limited plasma sample availability, NS3/4A, NS5A, and NS5B PCR amplification was not attempted for 17/25, 5/25, and 5/25 patients. NS5B population sequences were generated for 9/25 samples.
BLAST-based subtyping of NS3/4A, NS5A, and NS5B sequences.
NS3/4A, NS5A, and NS5B sequences were used to determine concordance, discordance, or refinement of the LiPA 2.0 subtype classification (26) (Table 2). For the genotype 5 patients, patients were initially subtyped by LiPA 2.0 as genotype 5a for all 7/7 patients. BLAST-based subtyping of the available NS3/4A, NS5A, and NS5B sequences were in concordance, confirming the subtype as genotype 5a for all 7/7 patients (Table 2; also see Table S1 in the supplemental material). For the genotype 5 patients, the BLAST identity of their associated sequences ranged from 89% to 93% for NS3/4A, 87% to 93% for NS5A, and 92% to 94% for NS5B (Table 2; also see Table S1). For the genotype 6 patients, patients were initially subtyped by LiPA as genotype 6a/b for 4/25 (16%) patients, genotype 6c to 6l for 11/25 (44%) patients, and unknown subtype of genotype 6 for 10/25 (40%) patients. BLAST analysis of the NS3/4A, NS5A, and NS5B sequences, when available, resulted in subtype refinement for all 25 genotype 6 patients (Table 2; also see Table S1). Among the 25 genotype 6 patients, there were 6 of subtype 6a, 9 of subtype 6e, 1 of subtype 6f, 1 of subtype 6i, 1 of subtype 6j, 3 of subtype 6l, 2 of subtype 6n, 1 of subtype 6o, and 1 of subtype 6p. For the 14/25 genotype 6 patients with only two available sequences, concordance was observed for the BLAST-based subtyping of the sequences. For the 4/25 genotype 6 patients with all three sequences (NS3/4A, NS5A, and NS5B), concordance was observed for the BLAST-based subtyping of the sequences. For the genotype 6 patients, the BLAST identity of the available, associated sequences ranged from 89% to 95% for NS3/4A, 84% to 96% for NS5A, and 89% to 97% for NS5B (Table 2; also see Table S1). BLAST-based subtypes were confirmed in all cases using a phylogenetic analysis wherein a maximum-likelihood phylogeny was constructed using the consensus sequences of the samples described here and sequences from samples with subtypes previously described (5).
Sequence analysis for RAVs.
Deep sequencing data with a 15% variant detection cutoff was analyzed for the presence of known NS3, NS5A, and NS5B RAVs (Tables 3, 4, and 5). Specific genotype 1a and 1b amino acid positions in NS3, NS5A, and NS5B have been well-characterized and documented as being associated with drug resistance. These amino acid positions are the basis for the genotype 5 and 6 NS3, NS5A, and NS5B RAV analysis in this study. Eleven amino acid positions in NS3, 9 amino acid positions in NS5A, and 8 amino acid positions in NS5B, described in Materials and Methods, were evaluated. For the genotype 5a patients, NS3/4A, NS5A, and NS5B deep sequencing data were available for 6/7, 7/7, and 6/7 patients, respectively. For the genotype 6 patients, NS3/4A, NS5A, and NS5B deep sequencing data were available for 8/25, 20/25, and 11/25 patients, respectively. The single NS3 RAV, D168E, was detected in 3/6 (50%) genotype 5a patients. The single NS3 RAV, Q80K, was detected in 4/8 (50%) genotype 6 patients who were all GT 6a subtype. No known NS5A RAVs were present in any of the 7 genotype 5a patients. For the genotype 6 patients, NS5A RAVs were detected at the NS5A amino acid positions 28, 58, and 93. Single NS5A RAVs were detected in 10/20 (50%) genotype 6 patients (F28M, n = 2; F28V, n = 8). Four of 20 (20%) genotype 6 patients had double NS5A RAVs (F28M and T93S, n = 1; F28V and T58A, n = 1; F28V and T93S, n = 2). NS5B RAVs were detected only in the genotype 6 patients, not the genotype 5 patients. For genotype 6, only the NS5B RAV M289L was identified and was observed in 7/11 (63.6%) patients.
TABLE 3.
NS3 amino acid changes at positions associated with drug resistance
| Reference or patient group | GTa | Amino acid(s) at positionc: |
|||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 36 | 41 | 43 | 54 | 55 | 56 | 80 | 122 | 155 | 156 | 168 | 170 | ||
| 1a H77 | V | Q | F | T | V | Y | Q | S | R | A | D | I | |
| 1b Con1 | V | Q | F | T | V | Y | Q | S | R | A | D | V | |
| 5a SA13b | L36A/G/M | Q41R | F43S/I/V/L | T54A/C/G/S | V55A/I | F56H | K80H/R/L | T122R | R155any | A156any | D168any | I170A/L/T | |
| Patients (n = 6) | 5a | A (n = 2) | E (n = 3) | V (n = 1) | |||||||||
| 6a EUHK2b | V36A/G/M | Q41R | F43S/I/V/L | T54A/C/G/S | V55A/I | Y56H | L80H/R/K | S122R | R155any | A156any | D168any | I170A/L/T | |
| Patients (n = 4) | 6a | K (n = 4) | N (n = 3) | ||||||||||
| Patients (n = 2) | 6e | Q (n = 2) | A (n = 1) | V (n = 2) | |||||||||
| T (n = 1) | |||||||||||||
| Patients (n = 2) | 6l | Q (n = 2) | V (n = 2) | ||||||||||
GT, genotype.
Potential genotype-specific resistance-associated variants are shown.
Amino acids in italics are potential resistance-associated variants. Blank cells indicate amino acids identical to the appropriate reference sequence.
TABLE 4.
NS5A amino acid changes at positions associated with drug resistance
| Reference or patient group | GTa | Amino acid at positionc: |
||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| 24 | 28 | 30 | 31 | 32 | 38 | 58 | 92 | 93 | ||
| 1a H77 | K | M | Q | L | P | S | H | A | Y | |
| 1b Con1 | Q | L | R | L | P | S | P | A | Y | |
| 5a SA13b | Q24G/N/R | L28A/G/T | Q30E/G/H/L/K/R/T | L31F/I/M/V | P32L | S38F | P58D/S | A92K/T | Y93C/F/H/N/S | |
| Patients (n = 7) | 5a | |||||||||
| 6a EUHK2b | Q24G/N | F28A/G/M/T/V | R30E/G/H/L/K/T | L31F/I/M/V | P32L | S38F | T58A/D/G/S | A92K/T | T93A/C/F/H/N/S | |
| Patients (n = 5) | 6a | R (n = 1) | L (n = 5) | |||||||
| Patients (n = 8) | 6e | K (n = 6) | M (n = 3) | S (n = 8) | H (n = 1) | S (n = 1) | ||||
| R (n = 2) | V (n = 5) | P (n = 7) | ||||||||
| Patients (n = 1) | 6f | K (n = 1) | A (n = 1) | S (n = 1) | P (n = 1) | |||||
| Patients (n = 1) | 6j | K (n = 1) | V (n = 1) | A (n = 1) | A (n = 1) | |||||
| Patients (n = 1) | 6l | K (n = 1) | V (n = 1) | A (n = 1) | P (n = 1) | |||||
| Patients (n = 2) | 6n | K (n = 2) | V (n = 2) | S (n = 2) | S (n = 2) | |||||
| Patients (n = 1) | 6o | K (n = 1) | L (n = 1) | A (n = 1) | A (n = 1) | |||||
| Patients (n = 1) | 6p | K (n = 1) | V (n = 1) | S (n = 1) | P (n = 1) | |||||
GT, genotype.
Potential genotype-specific resistance-associated variants are shown.
Amino acids in italics are potential resistance-associated variants. Blank cells indicate amino acids identical to the appropriate reference sequence.
TABLE 5.
NS5B amino acid changes at positions associated with drug resistance
| Reference or patient group | GTa | Amino acid at positionc: |
|||||||
|---|---|---|---|---|---|---|---|---|---|
| 96 | 142 | 159 | 237 | 282 | 289 | 320 | 321 | ||
| 1a H77 | S | N | L | E | S | C | L | V | |
| 1b Con1 | S | N | L | E | S | C | L | V | |
| 5a SA13b | S96T | N142T | L159F | E237G | S282any | M289I/L | L320F/I/V | V321A/I | |
| Patients (n = 6) | 5a | ||||||||
| 6a EUHK2b | S96T | N142T | L159F | N237G | S282any | M289I/L | L320F/I/V | V321A/I | |
| Patients (n = 2) | 6a | ||||||||
| Patients (n = 3) | 6e | H (n = 2) | L (n = 3) | ||||||
| R (n = 1) | |||||||||
| Patients (n = 1) | 6f | E (n = 1) | L (n = 1) | ||||||
| Patients (n = 1) | 6i | Q (n = 1) | |||||||
| Patients (n = 1) | 6l | R (n = 1) | L (n = 1) | ||||||
| Patients (n = 2) | 6n | H (n = 2) | L (n = 2) | ||||||
GT, genotype.
Potential genotype-specific resistance-associated variants are shown.
Amino acids in italics are potential resistance-associated variants. Blank cells indicate amino acids identical to the appropriate reference sequence.
DISCUSSION
Since the discovery of HCV in 1989 (31), research and drug development have been focused on the most prevalent and widespread genotypes, such as genotypes 1 and 2. In contrast, genotype 5 and 6 HCV remain poorly characterized. The recent development and approval of HCV DAAs efficacious against multiple genotypes has led to increased interest in these genotypes.
To enable resistance testing of genotype 5 and 6 HCV, a robust PCR amplification and sequencing assay of viral target genes, such as NS3/4A, NS5A, and NS5B, is necessary. In this study, primers were developed to amplify NS3/4A, NS5A, and NS5B from genotype 5 and genotype 6 samples. Successful PCR amplification of HCV genes, such as NS5B, and subsequent sequencing allows for BLAST analysis of sequences for patient genotype and subtype determination. Antiviral therapy response and optimal treatment duration may vary based on the genotype/subtype of infection. HCV-infected, genotype 1b treatment-naive patients treated for 12 weeks with either daclatasvir and simeprevir or daclatasvir, simeprevir, and ribavirin achieved a higher rate of sustained virologic response at posttreatment week 12 (SVR12) than HCV-infected genotype 1a treatment-naive patients with 24 weeks of daclatasvir, simeprevir, and ribavirin (32). For the TURQUOISE-II study, HCV-infected genotype 1a patients needed to be treated for 24 weeks, instead of 12 weeks, with ombitasvir, paritaprevir, ritonavir, and dasabuvir with ribavirin to achieve high SVR12 rates similar to those of the HCV-infected genotype 1b patients treated for 12 weeks with ombitasvir, paritaprevir, ritonavir, and dasabuvir with ribavirin (33). Therefore, accurate, specific genotyping and subtyping of a patient's HCV is needed. LiPA 2.0 is a reverse hybridization line probe assay that targets the 5′ untranslated region and core regions, and it is a commonly used commercial HCV genotyping method (34). For genotype 6 samples, this assay commonly reports the genotype as either genotype 6a/b or genotype 6c to 6l. Previous studies evaluating LiPA 2.0 reported genotype 6 samples as failing the assay or being misclassified as genotype 1 or a different subtype (35–37). In this study, a majority of the genotype 6 samples had either an unknown or not fully determined subtype by LiPA 2.0. Considering the diversity of genotype 6 and the difference between subtypes within this genotype, the subtype may be more accurately determined through BLAST analysis of the NS3/4A, NS5A, and NS5B sequences; sequencing and BLAST analysis allowed for subtype refinement of all genotype 6 samples. Although LiPA 2.0 has successfully genotyped genotype 5 samples, assay failures have been reported for genotype 5 samples (37). In this study, BLAST analysis of the available genotype 5 NS3/4A, NS5A, and NS5B sequences confirmed the subtype of these samples as subtype 5a. Since LiPA 2.0 may fail to classify, misclassify, or provide a vague subtype, especially for genotype 6, the sequencing of a PCR-amplified portion of the patient genome followed by BLAST analysis represents a robust alternative genotyping method.
Deep sequencing allowed for the detection of NS3, NS5A, and NS5B RAVs. For NS3, RAVs were detected in 3/6 (50%) genotype 5 and 4/8 (50%) genotype 6 patient samples. For genotype 5, no NS5A or NS5B RAVs were identified. In contrast, at least 1 NS5A RAV was detected in 14/20 (70%) genotype 6 samples, and at least 1 NS5B RAV was detected in 7/10 (70%) genotype 6 samples; in contrast, no NS5A RAVs were in the 7 genotype 5 samples. Further investigation is still needed to determine if there are genotype 5- and genotype 6-specific RAVs that contribute to reduced susceptibility to HCV DAAs.
This study has limitations. Due to sample availability, the primers were evaluated with a limited number of HCV-infected genotype 5 and genotype 6 patient samples. Considering the diversity of genotype 6, the primers should have been evaluated with a few samples for each genotype 6 subtype. Primer sensitivity was not assessed by attempting amplification from patient samples with low HCV RNA viral load. Further studies are needed to evaluate PCR amplification success with the described primers and primer sensitivity.
In summary, a deep sequencing assay for NS3/4A, NS5A, and NS5B amplification from plasma samples of HCV-infected genotype 5 and 6 patients was developed. The generated sequences enabled subtype refinement of these patient samples. Moreover, known NS3, NS5A, and NS5B RAVs were detected in some genotype 5 and 6 samples, but it is unclear if these RAVs will lead to reduced drug susceptibility, since genotype 5- and 6-specific RAVs still are not well-characterized. Genotype 5 and 6 sequence information has the potential to facilitate the better understanding of HCV genetic diversity and drug-associated resistance.
Supplementary Material
Footnotes
Supplemental material for this article may be found at http://dx.doi.org/10.1128/JCM.00238-16.
REFERENCES
- 1.Alter MJ, Margolis HS, Krawczynski K, Judson FN, Mares A, Alexander WJ, Hu PY, Miller JK, Gerber MA, Sampliner RE, Meeks EM, Beach MJ. 1992. The natural history of community-acquired hepatitis C in the United States. The Sentinel Counties Chronic Non-A, Non-B Hepatitis Study Team. N Engl J Med 327:1899–1905. [DOI] [PubMed] [Google Scholar]
- 2.Saito I, Miyamura T, Ohbayashi A, Harada H, Katayama T, Kikuchi S, Watanabe Y, Koi S, Onji M, Ohta Y, Choo QL, Houghton M, Kuo G. 1990. Hepatitis C virus infection is associated with the development of hepatocellular carcinoma. Proc Natl Acad Sci U S A 87:6547–6549. doi: 10.1073/pnas.87.17.6547. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Tong MJ, El-Farra NS, Reikes AR, Co RL. 1995. Clinical outcomes after transfusion-associated hepatitis C. N Engl J Med 332:1463–1466. doi: 10.1056/NEJM199506013322202. [DOI] [PubMed] [Google Scholar]
- 4.Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, Beall E, Yap PL, Kolberg J, Urdea MS. 1993. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J Gen Virol 74(Part 11):2391–2399. [DOI] [PubMed] [Google Scholar]
- 5.Smith DB, Bukh J, Kuiken C, Muerhoff AS, Rice CM, Stapleton JT, Simmonds P. 2014. Expanded classification of hepatitis C virus into 7 genotypes and 67 subtypes: updated criteria and genotype assignment web resource. Hepatology 59:318–327. doi: 10.1002/hep.26744. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Simmonds P, Bukh J, Combet C, Deleage G, Enomoto N, Feinstone S, Halfon P, Inchauspe G, Kuiken C, Maertens G, Mizokami M, Murphy DG, Okamoto H, Pawlotsky JM, Penin F, Sablon E, Shin IT, Stuyver LJ, Thiel HJ, Viazov S, Weiner AJ, Widell A. 2005. Consensus proposals for a unified system of nomenclature of hepatitis C virus genotypes. Hepatology 42:962–973. doi: 10.1002/hep.20819. [DOI] [PubMed] [Google Scholar]
- 7.Alter MJ, Kruszon-Moran D, Nainan OV, McQuillan GM, Gao F, Moyer LA, Kaslow RA, Margolis HS. 1999. The prevalence of hepatitis C virus infection in the United States, 1988 through 1994. N Engl J Med 341:556–562. doi: 10.1056/NEJM199908193410802. [DOI] [PubMed] [Google Scholar]
- 8.Kaba S, Dutta U, Byth K, Crewe EB, Khan MH, Coverdale SA, Lin R, Liddle C, Farrell GC. 1998. Molecular epidemiology of hepatitis C in Australia. J Gastroenterol Hepatol 13:914–920. doi: 10.1111/j.1440-1746.1998.tb00761.x. [DOI] [PubMed] [Google Scholar]
- 9.Lu L, Nakano T, He Y, Fu Y, Hagedorn CH, Robertson BH. 2005. Hepatitis C virus genotype distribution in China: predominance of closely related subtype 1b isolates and existence of new genotype 6 variants. J Med Virol 75:538–549. doi: 10.1002/jmv.20307. [DOI] [PubMed] [Google Scholar]
- 10.Simmonds P, Mellor J, Sakuldamrongpanich T, Nuchaprayoon C, Tanprasert S, Holmes EC, Smith DB. 1996. Evolutionary analysis of variants of hepatitis C virus found in South-East Asia: comparison with classifications based upon sequence similarity. J Gen Virol 77(Part 12):3013–3024. [DOI] [PubMed] [Google Scholar]
- 11.Tokita H, Okamoto H, Tsuda F, Song P, Nakata S, Chosa T, Iizuka H, Mishiro S, Miyakawa Y, Mayumi M. 1994. Hepatitis C virus variants from Vietnam are classifiable into the seventh, eighth, and ninth major genetic groups. Proc Natl Acad Sci U S A 91:11022–11026. doi: 10.1073/pnas.91.23.11022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Mellor J, Walsh EA, Prescott LE, Jarvis LM, Davidson F, Yap PL, Simmonds P. 1996. Survey of type 6 group variants of hepatitis C virus in Southeast Asia by using a core-based genotyping assay. J Clin Microbiol 34:417–423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Messina JP, Humphreys I, Flaxman A, Brown A, Cooke GS, Pybus OG, Barnes E. 2014. Global distribution and prevalence of hepatitis C virus genotypes. Hepatology 61:77–87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Foster GR, Pianko S, Brown A, Forton D, Nahass RG, George J, Barnes E, Brainard DM, Massetto B, Lin M, Han B, McHutchison JG, Subramanian GM, Cooper C, Agarwal K, BOSON Study Group. 2015. Efficacy of sofosbuvir plus ribavirin with or without peginterferon-alfa in patients with hepatitis c virus genotype 3 infection and treatment-experienced patients with cirrhosis and hepatitis C virus genotype 2 infection. Gastroenterology 149:1462–1470. doi: 10.1053/j.gastro.2015.07.043. [DOI] [PubMed] [Google Scholar]
- 15.Doss W, Shiha G, Hassany M, Soliman R, Fouad R, Khairy M, Samir W, Hammad R, Kersey K, Jiang D, Doehle B, Knox SJ, Massetto B, McHutchison JG, Esmat G. 2015. Sofosbuvir plus ribavirin for treating Egyptian patients with hepatitis C genotype 4. J Hepatol 63:581–585. doi: 10.1016/j.jhep.2015.04.023. [DOI] [PubMed] [Google Scholar]
- 16.Pol S, Sulkowski MS, Hassanein T, Gane EJ, Liu L, Mo H, Doehle B, Kanwar B, Brainard D, Subramanian GM, Symonds WT, McHutchison JG, Nahass RG, Bennett M, Jacobson IM. 2015. Sofosbuvir plus pegylated interferon and ribavirin in patients with genotype 1 hepatitis C virus in whom previous therapy with direct-acting antivirals has failed. Hepatology 62:129–134. doi: 10.1002/hep.27836. [DOI] [PubMed] [Google Scholar]
- 17.Lawitz E, Poordad F, Brainard DM, Hyland RH, An D, Dvory-Sobol H, Symonds WT, McHutchison JG, Membreno FE. 2015. Sofosbuvir with peginterferon-ribavirin for 12 weeks in previously treated patients with hepatitis C genotype 2 or 3 and cirrhosis. Hepatology 61:769–775. doi: 10.1002/hep.27567. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Svarovskaia ES, Dvory-Sobol H, Parkin N, Hebner C, Gontcharova V, Martin R, Ouyang W, Han B, Xu S, Ku K, Chiu S, Gane E, Jacobson IM, Nelson DR, Lawitz E, Wyles DL, Bekele N, Brainard D, Symonds WT, McHutchison JG, Miller MD, Mo H. 2014. Infrequent development of resistance in genotype 1-6 hepatitis C virus-infected subjects treated with sofosbuvir in phase 2 and 3 clinical trials. Clin Infect Dis 59:1666–1674. doi: 10.1093/cid/ciu697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Omata M, Nishiguchi S, Ueno Y, Mochizuki H, Izumi N, Ikeda F, Toyoda H, Yokosuka O, Nirei K, Genda T, Umemura T, Takehara T, Sakamoto N, Nishigaki Y, Nakane K, Toda N, Ide T, Yanase M, Hino K, Gao B, Garrison KL, Dvory-Sobol H, Ishizaki A, Omote M, Brainard D, Knox S, Symonds WT, McHutchison JG, Yatsuhashi H, Mizokami M. 2014. Sofosbuvir plus ribavirin in Japanese patients with chronic genotype 2 HCV infection: an open-label, phase 3 trial. J Viral Hepatitis 21:762–768. doi: 10.1111/jvh.12312. [DOI] [PubMed] [Google Scholar]
- 20.Zeuzem S, Dusheiko GM, Salupere R, Mangia A, Flisiak R, Hyland RH, Illeperuma A, Svarovskaia E, Brainard DM, Symonds WT, Subramanian GM, McHutchison JG, Weiland O, Reesink HW, Ferenci P, Hezode C, Esteban R, VALENCE Investigators. 2014. Sofosbuvir and ribavirin in HCV genotypes 2 and 3. N Engl J Med 370:1993–2001. doi: 10.1056/NEJMoa1316145. [DOI] [PubMed] [Google Scholar]
- 21.Osinusi A, Meissner EG, Lee YJ, Bon D, Heytens L, Nelson A, Sneller M, Kohli A, Barrett L, Proschan M, Herrmann E, Shivakumar B, Gu W, Kwan R, Teferi G, Talwani R, Silk R, Kotb C, Wroblewski S, Fishbein D, Dewar R, Highbarger H, Zhang X, Kleiner D, Wood BJ, Chavez J, Symonds WT, Subramanian M, McHutchison J, Polis MA, Fauci AS, Masur H, Kottilil S. 2013. Sofosbuvir and ribavirin for hepatitis C genotype 1 in patients with unfavorable treatment characteristics: a randomized clinical trial. JAMA 310:804–811. doi: 10.1001/jama.2013.109309. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Charlton M, Everson GT, Flamm SL, Kumar P, Landis C, Brown RS Jr, Fried MW, Terrault NA, O'Leary JG, Vargas HE, Kuo A, Schiff E, Sulkowski MS, Gilroy R, Watt KD, Brown K, Kwo P, Pungpapong S, Korenblat KM, Muir AJ, Teperman L, Fontana RJ, Denning J, Arterburn S, Dvory-Sobol H, Brandt-Sarif T, Pang PS, McHutchison JG, Reddy KR, Afdhal N, SOLAR-1 Investigators. 2015. Ledipasvir and sofosbuvir plus ribavirin for treatment of HCV infection in patients with advanced liver disease. Gastroenterology 149:649–659. doi: 10.1053/j.gastro.2015.05.010. [DOI] [PubMed] [Google Scholar]
- 23.Gane EJ, Hyland RH, An D, Svarovskaia E, Pang PS, Brainard D, Stedman CA. 2015. Efficacy of ledipasvir and sofosbuvir, with or without ribavirin, for 12 weeks in patients with HCV genotype 3 or 6 infection. Gastroenterology 149:1454–1461. doi: 10.1053/j.gastro.2015.07.063. [DOI] [PubMed] [Google Scholar]
- 24.Kohli A, Kapoor R, Sims Z, Nelson A, Sidharthan S, Lam B, Silk R, Kotb C, Gross C, Teferi G, Sugarman K, Pang PS, Osinusi A, Polis MA, Rustgi V, Masur H, Kottilil S. 2015. Ledipasvir and sofosbuvir for hepatitis C genotype 4: a proof-of-concept, single-centre, open-label phase 2a cohort study. Lancet Infect Dis 15:1049–1054. doi: 10.1016/S1473-3099(15)00157-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Hedskog C, Chodavarapu K, Ku KS, Xu S, Martin R, Miller MD, Mo H, Svarovskaia E. 2015. Genotype- and subtype-independent full-genome sequencing assay for hepatitis C virus. J Clin Microbiol 53:2049–2059. doi: 10.1128/JCM.02624-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Combet C, Garnier N, Charavay C, Grando D, Crisan D, Lopez J, Dehne-Garcia A, Geourjon C, Bettler E, Hulo C, Le Mercier P, Bartenschlager R, Diepolder H, Moradpour D, Pawlotsky JM, Rice CM, Trepo C, Penin F, Deleage G. 2007. euHCVdb: the European hepatitis C virus database. Nucleic Acids Res 35:D363–D366. doi: 10.1093/nar/gkl970. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Hedskog C, Doehle B, Chodavarapu K, Gontcharova V, Crespo Garcia J, De Knegt R, Drenth JP, McHutchison JG, Brainard D, Stamm LM, Miller MD, Svarovskaia E, Mo H. 2014. Characterization of hepatitis C virus inter-genotypic recombinant strains and associated virologic response to sofosbuvir/ribavirin. Hepatology 61:471–480. [DOI] [PubMed] [Google Scholar]
- 28.Yang X, Charlebois P, Gnerre S, Coole MG, Lennon NJ, Levin JZ, Qu J, Ryan EM, Zody MC, Henn MR. 2012. De novo assembly of highly diverse viral populations. BMC Genomics 13:475. doi: 10.1186/1471-2164-13-475. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Lee WP, Stromberg MP, Ward A, Stewart C, Garrison EP, Marth GT. 2014. MOSAIK: a hash-based algorithm for accurate next-generation sequencing short-read mapping. PLoS One 9:e90581. doi: 10.1371/journal.pone.0090581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215:403–410. doi: 10.1016/S0022-2836(05)80360-2. [DOI] [PubMed] [Google Scholar]
- 31.Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. 1989. Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 244:359–362. doi: 10.1126/science.2523562. [DOI] [PubMed] [Google Scholar]
- 32.Zeuzem S, Hezode C, Bronowicki JP, Loustaud-Ratti V, Gea F, Buti M, Olveira A, Banyai T, Al-Assi MT, Petersen J, Thabut D, Gadano A, Pruitt R, Makara M, Bourliere M, Pol S, Beumont-Mauviel M, Ouwerkerk-Mahadevan S, Picchio G, Bifano M, McPhee F, Boparai N, Cheung K, Hughes EA, Noviello S, LEAGUE-1 Study Team. 2016. Daclatasvir plus simeprevir with or without ribavirin for the treatment of chronic hepatitis C virus genotype 1 infection. J Hepatol 64:292–300. doi: 10.1016/j.jhep.2015.09.024. [DOI] [PubMed] [Google Scholar]
- 33.Forns X, Poordad F, Pedrosa M, Berenguer M, Wedemeyer H, Ferenci P, Shiffman ML, Fried MW, Lovell S, Trinh R, Lopez-Talavera JC, Everson G. 2015. Ombitasvir/paritaprevir/r, dasabuvir and ribavirin for cirrhotic HCV patients with thrombocytopaenia and hypoalbuminaemia. Liver Int 35:2358–2362. doi: 10.1111/liv.12931. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Verbeeck J, Stanley MJ, Shieh J, Celis L, Huyck E, Wollants E, Morimoto J, Farrior A, Sablon E, Jankowski-Hennig M, Schaper C, Johnson P, Van Ranst M, Van Brussel M. 2008. Evaluation of Versant hepatitis C virus genotype assay (LiPA) 2.0. J Clin Microbiol 46:1901–1906. doi: 10.1128/JCM.02390-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Yang R, Cong X, Du S, Fei R, Rao H, Wei L. 2014. Performance comparison of the versant HCV genotype 2.0 assay (LiPA) and the Abbott realtime HCV genotype II assay for detecting hepatitis C virus genotype 6. J Clin Microbiol 52:3685–3692. doi: 10.1128/JCM.00882-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Cai Q, Zhao Z, Liu Y, Shao X, Gao Z. 2013. Comparison of three different HCV genotyping methods: core, NS5B sequence analysis and line probe assay. Int J Mol Med 31:347–352. [DOI] [PubMed] [Google Scholar]
- 37.Larrat S, Poveda JD, Coudret C, Fusillier K, Magnat N, Signori-Schmuck A, Thibault V, Morand P. 2013. Sequencing assays for failed genotyping with the versant hepatitis C virus genotype assay (LiPA), version 2.0. J Clin Microbiol 51:2815–2821. doi: 10.1128/JCM.00586-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.