Significance
Coronary heart disease is a leading cause of death worldwide. After acute myocardial infarction, early reperfusion limits infarct progression and improves clinical outcomes. However, despite reperfusion, the incidence of heart failure and cardiovascular deaths remains unacceptably high. Here, we report that a few days after ischemia, the reperfused heart transiently elaborates the cardioprotective polypeptide, insulin-like growth factor-1 (IGF-1). However, tissue IGF-1 levels increase only transiently because it is rapidly degraded by the chymase, mouse mast cell protease 4. Mouse mast cell protease 4 deletion promotes cardiac cell survival by reducing IGF-1 degradation, which ameliorates cardiac dysfunction caused by ischemic injury. Our findings suggest that chymase inhibition may be a viable therapeutic approach to enhance late cardioprotection in postischemic heart disease.
Keywords: insulin-like growth factor-1, chymase, mouse mast cell protease 4, ischemia-reperfusion injury, cardioprotection
Abstract
Heart disease is a leading cause of death in adults. Here, we show that a few days after coronary artery ligation and reperfusion, the ischemia-injured heart elaborates the cardioprotective polypeptide, insulin-like growth factor-1 (IGF-1), which activates IGF-1 receptor prosurvival signaling and improves cardiac left ventricular systolic function. However, this signaling is antagonized by the chymase, mouse mast cell protease 4 (MMCP-4), which degrades IGF-1. We found that deletion of the gene encoding MMCP-4 (Mcpt4), markedly reduced late, but not early, infarct size by suppressing IGF-1 degradation and, consequently, diminished cardiac dysfunction and adverse structural remodeling. Our findings represent the first demonstration to our knowledge of tissue IGF-1 regulation through proteolytic degradation and suggest that chymase inhibition may be a viable therapeutic approach to enhance late cardioprotection in postischemic heart disease.
Drugs that inhibit angiotensin II (Ang II) action or formation reduce mortality and cardiovascular morbidity in patients with myocardial infarction (MI) complicated by left ventricle (LV) systolic dysfunction, heart failure, or both (1, 2). Because human chymase, a mast cell protease (3), is an Ang II-forming enzyme (4) it is thought that, like angiotensin I-converting enzyme (ACE), chymase might be a useful drug target in the therapy of post-MI patients. However, the Valsartan in Acute Myocardial Infarction (VALIANT) trial, comparing inhibition of ACE with angiotensin receptor subtype-1 blockade (ARB), did not support a role for alternate Ang II-generating pathway(s) in post-MI heart failure (2).
In rodents, chymase inhibitor monotherapy improved survival and reduced post-MI cardiac hypertrophy and dysfunction (5, 6). Although these studies, and clinical trials, together suggest an Ang II-independent mechanism of action of chymase inhibitors, other studies with chymase inhibitor monotherapy were negative (7, 8). Variations in the specificities of chymase inhibitors—that were designed to inhibit human chymase—could be a source of differences in outcomes when used in nonprimates. This uncertainty led us to reassess whether chymase is an important therapeutic target for improving structure and function in ischemia-injured hearts by using a genetic model that obviates the issue of inhibitor specificity.
Mouse mast cell protease 4 (MMCP-4) is the functional homolog of human chymase (8). To address its role in post-MI hearts, we used mice lacking Mcpt4, the gene encoding MMCP-4. We show that 2 wk after cardiac ischemia and then reperfusion (I/R), beneficial effects of Mcpt4 deletion occur even after renin–angiotensin system (RAS) blockade. Thus, MMCP-4 inhibition may have therapeutic effects beyond those of mere RAS blockade. Specifically, we discovered that MMCP-4 is an insulin-like growth factor-1 (IGF-1)–degrading enzyme and that beneficial effects of Mcpt4 deletion involve sustained IGF-1 levels and IGF-1 receptor (IGF-1R) prosurvival signaling after I/R.
IGF-1 is highly cardioprotective in the setting of permanent coronary artery occlusion or I/R (9). A single intracoronary artery dose of IGF-1 in dogs after I/R reduces cardiomyocyte apoptosis within the ischemic border zone (10), and intramyocardial IGF-1 administration reduces post-MI infarct size and LV dysfunction in rats (11). However, dose-dependent side effects of acute or chronic IGF-1 therapy, which include potentially maladaptive promotion of cardiomyocyte hypertrophy (12), have hampered its clinical usefulness as a therapy. Hence, our findings open a previously unidentified avenue for locally increasing the cardioprotective effects of IGF-1 signaling by inhibiting a protease that regulates its degradation without impacting circulating IGF-1 levels.
Results
MMCP-4 Promotes Post-I/R Cardiac Dysfunction and Remodeling.
MMCP-4 protein and mRNA were low in uninjured hearts (Fig. 1 A–C). Thereafter, MMCP-4 protein and mRNA levels increased, with the highest levels observed at 72 h of reperfusion (Fig. 1 A and B). Mast cells contain a number of preformed chemical mediators such as histamine, chymase, carboxypeptidase, and tryptase (3). Tryptase is highly restricted to mast cells. Hence, it has been used extensively to identify mast cells, of which a subset contains MMCP-4 (3). We found ∼150 tryptase+ mast cells/mm2 in the infarct/border zone of 72 h post-I/R WT hearts, of which ∼50 cells/mm2 were positive for MMCP-4 (Fig. 1D). By contrast, mast cells were rare (<0.01 cells/mm2) in sham LVs or remote LVs of 72-h post-I/R mice. This difference indicates an ∼15,000-fold increase in mast cell numbers in the infarct border zone by 72 h after I/R. Mast cell infiltration is regulated by stem cell factor (SCF) (13). After I/R, peak levels of SCF mRNA were found at 48 h of reperfusion (Table S1), which precedes the peak increase in MMCP-4 expression (Fig. 1A).
Fig. 1.
MMCP-4 levels and mast cell numbers in murine hearts after I/R. (A) Immunoblot showing MMCP-4 in uninjured WT LVs and in 24- to 72-h post-I/R hearts. (B) Quantitation of MMCP-4 protein in 48- and 72-h post-I/R hearts. (C) MMCP-4 mRNA levels in uninjured WT and 24- to 72-h post-I/R hearts. (D) Tryptase+/MMCP-4– and tryptase+/MMCP-4+ mast cells in the infarct/border zone of 72-h post/I/R WT and Mcpt4−/− hearts. n, number of individual animals studied; data are mean ± SEM **P < 0.01; ***P < 0.001; n.s., not significant. (E) A photomicrograph showing a cluster of tryptase+ (green) cells (tryptase staining identifies mast cells) in the infarct border zone of a 72-h post-I/R WT heart. Nuclei are stained with DAPI (blue) and MMCP-4 staining is in red. Arrows indicate tryptase+ mast cells that also have cytoplasmic MMCP-4 staining. Images in E (from left to right) show DAPI, tryptase, MMCP-4 staining, and the Right shows a composite image. (F) Differential interference contrast (DIC) image of tissue section in E. (G) Overlay of composite image in E and DIC image in F showing MMCP-4+ mast cells (arrows). Adjacent to these cells, diffuse MMCP-4 staining is seen on cardiomyocytes (CMs) (arrowheads). (H) YZ and XZ planes showing cytoplasmic MMCP-4 and tryptase staining in interstitial cells and diffuse staining over CMs in the XZ plane.
Table S1.
Cardiac SCF mRNA transcripts, normalized to 18S mRNA transcripts, in uninjured and 24–72 h after I/R WT mice
| Groups | SCF/18S mRNA (relative expression) |
| Uninjured | 1 ± 0.14 |
| 24 h after I/R | 1.04 ± 0.07 |
| 48 h after I/R | 1.84 ± 0.12** |
| 72 h after I/R | 0.93 ± 0.21 |
Values are mean ± SEM. The number of mRNA transcripts was determined by quantitative real-time RT-PCR and expression was normalized against 18S rRNA. Values are relative to SCF mRNA in uninjured hearts. Values were compared by using one-way ANOVA followed by Dunnett’s multiple comparison test, comparing all WT groups against uninjured controls. n = 4 independent cardiac ventricles per group. **P < 0.01.
In humans, chymase is mainly found in mast cells, but endothelial cells also contain limited amounts of this protease (3). To our knowledge, however, MMCP-4 is predominantly (if not exclusively) expressed by mast cells; this contention is supported by the finding that MMCP-4 mRNA is low but detectible in heart and blood vessels of WT, but not mast cell-deficient, mice (8, 14). Moreover, in vivo, provoked release of MMCP-4 into the cardiac interstitium is lost in mast cell-deficient mice (8). Although our studies cannot rigorously exclude extramast cell production of MMCP-4, XY and XZ reconstruction planes of confocal images of 72-h post-I/R heart sections showed cytoplasmic MMCP-4 staining only in interstitial cells, identified as mast cells because of tryptase staining (Fig. 1 E–H). However, in cells adjacent to these MMCP-4+ cells—such as cardiomyocytes—we often observed diffuse cell surface MMCP-4 staining (Fig. 1G).
Next we investigated the role of the Mcpt4 gene in I/R-induced changes in cardiac structure and function. Comparison of 12-wk-old WT and Mcpt4−/− mice revealed no significant baseline differences in heart rate, blood pressure, LV end-systolic, and end-diastolic dimensions or ejection fraction (LVEF) (Table S2). However, 2 wk after I/R, LVEF was 26% greater in Mcpt4−/− mice compared with WT controls (Fig. 2A); this improvement was accompanied by reduced LV dilatation with decreases in end-systolic and -diastolic volumes (Fig. 2B) and attenuated infarct expansion (regional wall thinning) (Fig. 2C). I/R-induced cardiomyocyte hypertrophy (in the remote LV) and LV fibrosis were also reduced by Mcpt4 deletion (Fig. 2 D and E). MMCP-4–dependent Ang II generation in blood vessels regulates blood pressure in an experimental model of renovascular hypertension (14). We investigated whether post-I/R differences in afterload could account for different outcomes between genotypes. However, this explanation was not supported by the finding of similar mean arterial blood pressures in 14-d post-I/R WT and Mcpt4−/− mice (Fig. 2F). Together, these studies indicate that Mcpt4 gene expression mediates adverse functional and structural changes in the heart after I/R.
Table S2.
Baseline echocardiographic measurements of 11-wk-old WT and Mcpt4−/− mice
| Measurements | WT | Mcpt4–/– | P value |
| LV ED diameter, mm | 3.13 ± 0.05 | 3.2 ± 0.05 | 0.35 |
| LV ES diameter, mm | 1.82 ± 0.04 | 1.77 ± 0.05 | 0.46 |
| LV FW thickness at diastole, mm | 0.89 ± 0.02 | 0.88 ± 0.01 | 0.4 |
| LV FW thickness at systole, mm | 1.33 ± 0.02 | 1.32 ± 0.02 | 0.62 |
| LV ED volume, µL | 39.7 ± 1.5 | 40.5 ± 1.8 | 0.74 |
| LV ES volume, µL | 10.5 ± 0.54 | 9.75 ± 0.75 | 0.44 |
| Ejection fraction, % | 74.2 ± 0.69 | 75.3 ± 2.1 | 0.6 |
| n | 52 | 42 | — |
Values are mean ± SEM. ED, end-diastolic; ES, end-systolic; FW, free wall; LV, left ventricle. Values were compared by using unpaired Student’s t test.
Fig. 2.
Cardiac structure and function 14 d after I/R are improved by Mcpt4 deletion. (A and B) LVEF (A) and end-systolic and -diastolic LV volumes (B) in WT and Mcpt4−/− mice. (C) Average free wall (FW) thickness of WT and Mcpt4−/− hearts. (D and E) Cardiomyocyte cross-sectional area (in the remote myocardium) (D) and LV fibrosis (E) in WT and Mcpt4−/− hearts. (F) Mean arterial blood pressures (MAP) in mice 14 d after I/R or sham surgery. Values in square brackets are the number of animals studied; data are mean ± SEM *P < 0.05; **P < 0.01; ***P < 0.001; n.s., not significant for intergenotype comparisons. †††P < 0.001 for intragenotype comparisons in A and D.
Beneficial Effects of Mcpt4 Deletion in Postischemic Hearts Are Independent of RAS Blockade.
Serine proteases of mast cells and neutrophils, particularly chymase and cathepsin G, convert Ang I to Ang II (3, 15). These proteases collectively form ACE-independent, alternative pathways for Ang II generation, and both are insensitive to ACE inhibitors (ACEi). Because both mast cells and neutrophils infiltrate the I/R damaged heart in large numbers, alternate pathways of Ang II generation must be considered in the pathogenesis of postischemic heart disease.
To this end, we compared ACEi monotherapy (captopril) with triple therapy (AAA); the latter involving a combination of an ACEi (captopril) plus a type I (AT1) (valsartan) and a type 2 (AT2) Ang II receptor blocker (PD122139). ACEi should prevent ACE-dependent Ang II formation, but allow MMCP-4 (or cathepsin G) dependent Ang II formation, whereas AAA therapy should inhibit actions of Ang II produced by both ACE and non-ACE pathways. WT mice were subjected to I/R, and ACEi or AAA therapy initiated 24 h after reperfusion. We found no greater improvement in LV function or dilatation after 13 d of AAA therapy than after ACEi monotherapy (Table S3), arguing against a role for non-ACE Ang II-forming pathways in post-I/R hearts.
Table S3.
Effect of ACEi monotherapy or triple therapy (AAA) with a combination of an ACEi (captopril) plus a type I (AT1) (valsartan) and a type 2 (AT2) Ang II receptor blocker (PD122139) on cardiac structure and function after I/R in WT mice
| Measurements | I/R + vehicle | I/R + ACEi | I/R + AAA | P value (ACEi vs. AAA) |
| LV ED diameter, mm | 4.74 ± 0.1 | 4.18 ± 0.1** | 4.45 ± 0.17 | 0.29 |
| LV ES diameter, mm | 4.13 ± 0.13 | 3.5 ± 0.13** | 3.69 ± 0.19 | 0.63 |
| LV FW thickness at diastole, mm | 0.63 ± 0.02 | 0.65 ± 0.02 | 0.66 ± 0.04 | 0.97 |
| LV FW thickness at systole, mm | 0.83 ± 0.03 | 0.88 ± 0.02 | 0.88 ± 0.05 | 1.00 |
| LV ED volume, µL | 106 ± 5.6 | 79.2 ± 4.3** | 92.5 ± 8.1 | 0.27 |
| LV ES volume, µL | 77.5 ± 5.7 | 53.2 ± 4.1** | 61 ± 7.8 | 0.62 |
| Ejection fraction, % | 28.3 ± 1.75 | 34.8 ± 2* | 36.6 ± 2.6* | 0.56 |
| n | 21 | 22 | 21 | — |
ED, end-diastolic; ES, end-systolic; FW, free wall; LV, left ventricle. Data are represented as mean ± SEM. Values were compared by using one-way ANOVA. Tukey’s post hoc test was used for multiple comparisons and each P value adjusted to account for multiple comparisons. For comparisons with the vehicle group: *P < 0.05; **P < 0.01. P values for comparisons between ACEi and AAA groups are indicated.
We then addressed whether MMCP-4 has a role beyond Ang II generation in postischemic hearts. We compared LVEF after 14 d of I/R in WT and Mcpt4−/− mice, with or without AAA therapy. Whereas LVEF was 1.38-fold higher in Mcpt4−/− mice treated with AAA (49 ± 2.5%, n = 16) than in vehicle controls (35.6 ± 2.6%; n = 20; P < 0.001 by two-way ANOVA/Tukey multiple comparisons test), this difference did not reach significance (P > 0.05) compared with the increment (1.29-fold) in LVEF in WT mice treated with AAA versus vehicle controls (28.3 ± 1.8%, n = 21, versus 36.6 ± 2.6%, n = 14, in vehicle- and AAA-treated mice, respectively). In contrast, the difference in LVEF (1.34-fold) between AAA-treated Mcpt4−/− mice and AAA-treated WT mice was significant (P < 0.01). Thus, after I/R, functional benefits of MMCP-4 suppression are observed even in the face of RAS blockade and are, thus, mechanistically RAS-independent.
Mcpt4 Deletion Decreases Late but Not Early Infarct Size in Post-I/R Hearts.
Postischemic cardiac dysfunction and remodeling are intimately linked to infarct size (16). In pig hearts subjected to ischemia, and then perfused for approximately 2 h, chymase inhibitor treatment reduced infarct size as assessed by serum troponin levels or infarct size relative to the area at risk (17). We investigated whether MMCP-4 deficiency influences post-I/R infarct development. In mice, unlike pigs, 24 h post-I/R infarct size, estimated by 2,3,5-triphenyltetrazolium chloride (TTC)-staining (Fig. 3A) or serum cardiac troponin I levels (Fig. 3B) was not significantly different between WT and Mcpt4−/− mice. Moreover, the absence of a significant difference in the area at risk between genotypes (Fig. 3A) at 24 h after I/R suggests that the lack of effect of Mcpt4 deletion on early infarct size was not complicated by intergenotype differences in the baseline architecture of the LV coronary microcirculation.
Fig. 3.
Late, but not early, infarct size after I/R is reduced by Mcpt4 deletion. (A) Area at risk (AAR) and infarct size expressed as a percentage of LV volume. Data are from 24-h post-I/R WT and Mcpt4−/− hearts. (B) Serum troponin I levels in 24-h post-I/R WT and Mcpt4−/− mice. n is the number of biological replicates (in square brackets); data are and mean ± SEM; n.s., not significant. (C) Heart sections at comparable levels of 14-d post-IR WT or Mcpt4−/− mice. Collagen in scar is blue and myocytes are red. (D) Scar area in WT and Mcpt4−/− post-I/R hearts was calculated in each of five sequential 500-µm LV sections. The average value is shown. The green data points are from the representative hearts shown in C. (E) Peri-infarct capillary density in 14-d post-I/R WT and Mcpt4−/− hearts. Values in square brackets are the number of animals studied; data are mean ± SEM, *P < 0.05; ***P < 0.001; n.s., not significant.
MMCP-4 expression is increased 48–72 h after I/R (Fig. 1 A and B). To test whether MMCP-4 deficiency impacts late infarct size, which encompasses the period of increased MMCP-4 expression, we studied mice after 14 d of reperfusion. In contrast to the effect of MMCP-4 deletion on early infarct area, Mcpt4−/− deletion markedly reduced (by ∼50%) 14 d post-I/R LV scar area (Fig. 3 C and D). This decrease was not related to differences in infarct border zone capillary density, which was similar in WT and MMCP-4–deficient mice (Fig. 3E).
The decreased scar area (Fig. 3 C–E) in MMCP-4–deficient hearts is consistent with improved function (Fig. 2 A–C) and could be due to late preservation of myocardium after I/R through a suppression of deleterious effects of MMCP-4 on cardiomyocyte survival. We considered this possibility because prior in vitro work has shown that mast cell serine proteinases cause cultured rat neonatal cardiomyocyte to undergo apoptosis (18); albeit that the apoptosis mechanism was not explored.
We explored the previously unidentified hypothesis that MMCP-4 mediates late myocardial cell death in post-I/R hearts by degrading IGF-1. Three lines of evidence led us to formulate this hypothesis: (i) cardiac IGF-1 mRNA expression is markedly, but transiently, increased 24–72 h after a MI (19); (ii) IGF-1 has a key role in the regulation of cell survival in general, and in the setting of MI, exogenous administration of IGF-1 attenuates cardiac dysfunction and reduces infarct size (10), and (iii) there are several predicted MMCP-4 sensitive cleavage sites in mouse IGF-1—based on the extended substrate binding specificity of MMCP-4 (20)—suggesting that MMCP-4 could be an IGF-1–degrading enzyme.
MMCP-4 Is the Major IGF-1–Degrading Enzyme in 72-h Post-I/R Hearts.
We found that IGF-1–degrading activity in 72-h post-I/R heart homogenates is associated with a charged soluble chymotrypsin-like serine protease, based on its extraction from crude membrane/extracellular matrix pellet fractions by high KCl concentrations, and its inhibition by phenylmethylsulfonyl fluoride and chymostatin (Fig. 4 A and B)—biochemical properties common to most chymases (4). Moreover, IGF-1–degrading activity in the high salt extract of 72-h post-I/R LVs was inhibited by an affinity-purified polyclonal antibody raised against a unique MMCP-4 epitope (Fig. 4B) (8).
Fig. 4.
Identification of MMCP-4 as the major IGF-1–degrading protease in post-I/R hearts. (A) Fractionated 72-h post-IR WT heart was incubated with recombinant mouse IGF-1 (r-m-IGF-1) and then subjected to SDS/PAGE and immunoblotting. S1 and P1 are high-speed supernatant fraction and membrane pellet, respectively. S2 and P2 are 1% Triton X-100 supernatant fraction and pellet, respectively, derived from P1. S3 and P3 are 1 M KCl supernatant fraction and pellet, respectively, derived from P2. Soluble r-m-IGF-1–degrading activity is evident in the high KCl extract, S3. (B) Immunoblot showing that IGF-1–degrading activity in S3 is resistant to cysteine-(N-ethylmaleimide, NEM), aspartyl- (pepstatin), or metalloproteinase (EDTA) inhibition, but is inhibited by the pan-serine protease inhibitor, phenylmethylsulfonyl fluoride (PMSF), the chymotrypsin-like protease inhibitor, chymostatin, or an affinity-purified antibody raised against a unique MMCP-4 peptide fragment (9). Blot shown is representative of three independent studies. (C) Concentration-dependent cleavage of r-m-IGF-1 by purified MMCP-4. (D) Concentration-dependent cleavage of recombinant human IGF-1 (r-h-IGF-1) by recombinant human chymase. IGF-1 degradation in C and D was inhibited by chymostatin, indicating that cleavage is by a chymotrypsin-like protease. Immunoblots in C and D are representative of four independent studies for each enzyme–substrate pair. (E) Hearts from uninjured WT, 72-h post-I/R WT, and 72-h post-I/R Mcpt4−/− mice were subjected to tissue fractionation as in A. Aliquots of the P1, S1, P2, S2, P3, and S3 fractions were used to determine MMCP-4 level by immunoblotting (Upper) and assayed for IGF-1–degrading activity (Lower).
Further support for MMCP-4 being an IGF-1–degrading enzyme is the finding that in vitro purified MMCP-4 degrades mouse IGF-1 (Fig. 4C), and human chymase degrades human-IGF-1 (Fig. 4D). Notably, IGF-1–degrading activity was prominently observed in 72 h post-I/R WT, but not in Mcpt4−/− heart homogenates (devoid of protease inhibitors). Moreover, immunoblots revealed a band at 30 kDa (which is the molecular mass of native MMCP-4) and a 19-kDa degradation product in WT but not MMCP-4–deficient heart homogenates (Fig. 4E). The 19-kDa MMCP-4 fragment is likely to occur by autocatalysis as we have demonstrated with human chymase (4). Together, these findings suggest that the major IGF-1–degrading activity in 72 h post-I/R hearts is due to MMCP-4.
I/R Increases IGF-1 Expression in Hearts.
IGF-1 mRNA levels were unchanged initially, but increased markedly between 48 and 72 h after I/R in WT hearts (Table S4). In 72-h post-I/R hearts, IGF-1 mRNA was enriched in cardiomyocytes (relative expression: 1 ± 0.22 versus 0.27 ± 0.027 18S-normalized IGF-1 mRNA transcripts in cardiomyocytes and noncardiomyocytes, respectively, n = 3, P < 0.05), suggesting that these cells are the main source of IGF-1 production. In contrast to IGF-1 mRNA levels, cardiac IGF-1 protein levels fell by 35% between 48 and 72 h after I/R (P < 0.001) (Fig. 5A). Fig. 5B presents examples of the immunohistochemical localization of IGF-1 in uninjured and post-I/R hearts. The findings of reciprocal changes in IGF-1 protein and its mRNA, marked increases in MMCP-4 levels in 72-h post-I/R hearts (Fig. 1 A and B), and the discovery of MMCP-4’s potent IGF-1 degrading activity (Fig. 4C) indicate posttranslational regulation of cardiac IGF-1 by MMCP-4.
Table S4.
IGF-1 mRNA levels in uninjured and 24- to 72-h post-I/R WT hearts
| Groups | IGF-1/18S mRNA (relative expression) |
| Uninjured | 1.0 ± 0.11 |
| 24 h after I/R | 0.52 ± 0.085 |
| 48 h after I/R | 1.6 ± 0.48 |
| 72 h after I/R | 6.3 ± 0.93*** |
Values are mean ± SEM. The number of IGF-1 mRNA transcripts was determined by quantitative real-time RT-PCR, and expression was normalized against 18S rRNA. Values are relative to IGF-1 mRNA in uninjured hearts. Values were compared by using one-way ANOVA followed by Dunnett’s multiple comparison test, comparing all WT groups against uninjured controls. n = 4 independent cardiac ventricles per group. ***P < 0.001.
Fig. 5.
Increased IGF-1 expression in post-I/R hearts. (A) Representative immunoblots and quantitative assessment of IGF-1 expression in uninjured WT hearts and in 24- to 72-h post-I/R hearts. Data are mean ± SEM; the data were normalized by using GAPDH as loading controls and values are relative to IGF-1 levels in uninjured hearts. ***P < 0.001. (B) Immunofluorescent images depict cardiomyocytes expressing α-sarcomeric actin (green), IGF-1 (red), and nuclei (blue) in sections from uninjured WT or 24- to 72-h post-I/R hearts. Inset shows a magnified view of the white box. The scale bar is the same for all images. Images are representative of four hearts at each time point.
MMCP-4 Regulates Cardiac IGF-1 and IGF-1/IGF-1R Signaling Post-I/R.
Consistent with MMCP-4 regulating cardiac IGF-1 levels and prosurvival IGF-1 signaling in vivo, cardiac IGF-1 levels were 1.7-fold higher in 72-h post-I/R Mcpt4−/− mice than in WT controls (Fig. 6A). We ruled out increased IGF-1 mRNA expression or increased endocrine input of IGF-1 to Mcpt4−/− hearts, as explanations, because, at 72 h after I/R, neither cardiac IGF-1 mRNA nor serum IGF-1 levels were increased by Mcpt4 deletion (Table S5).
Fig. 6.
Mcpt4 deletion increases IGF-1–dependent prosurvival signaling after I/R and improves cardiac structure and function. (A) IGF-1 and prosurvival IGF-1 signaling protein levels in Mcpt4−/− and WT hearts 72 h after I/R. Representative immunoblots are on the right. Data are from four independent biological replicates. (B) Acute inhibition of IGF-1R by PPP (for 8 h) increases caspase-3 activation in 72 h post-I/R Mcpt4−/− hearts. (C–E) Apoptotic (TUNEL+) cells (C), serum troponin I levels (D), and macrophages (E) in the infarct border zone of WT or Mcpt4−/− mice 72 h after I/R. Data are mean ± SEM, *P < 0.05; **P < 0.01; ***P < 0.001. (F–H) Effect of IGF-1/IGF-1R inhibition by PPP (starting at 24 h after reperfusion and continuing until 14 d after I/R) on LV free wall (FW) width (F), scar area (G), and LVEF (H) in WT and Mcpt4−/− mice. In these graphs, the vehicle data are from Figs. 2 and 3. Values in square brackets are the number of independent biological replicates. *P < 0.05; ***P < 0.001; n.s., not significant for differences between treatment groups and †P < 0.05; ††P < 0.05; †††P < 0.001 for intergenotype differences.
Table S5.
Cardiac IGF-1 mRNA transcripts and serum IGF-1 levels in 72-h post-I/R WT and Mcpt4−/− mice
| Groups | IGF-1/18S mRNA (relative expression) | Serum IGF-1, pg/mL |
| 72 h post-I/R WT | 1.0 ± 0.15 | 790 ± 75 |
| 72 h post-I/R Mcpt4−/− | 0.56 ± 0.34 | 880 ± 60 |
| P value | 0.275 | 0.225 |
| n | 4 | 5 |
Values are mean ± SEM. The number of IGF-1 mRNA transcripts was determined by quantitative real-time RT-PCR and expression was normalized against 18S rRNA. mRNA values are relative to IGF-1 mRNA in 72 h post-I/R WT hearts. Values were compared by using unpaired Student’s t test.
IGF-1 controls cell survival by activating the insulin receptor substrate (IRS)-1/phosphoinositide 3 kinase/Akt and IRS-2/MEK/ERK effector pathways (21). Despite a lack of change in IGF-1R mRNA expression (relative expression: 1 ± 0.19 versus 1.19 ± 0.14 in 72-h post-I/R WT and Mcpt4−/− hearts, respectively; n = 4 per group; P = 0.39), Mcpt4 deletion increased the abundance of phosphorylated Akt-S473 and phosphorylated ERK-1/2 in 72-h post-I/R hearts (Fig. 6A). Phosphorylation of BAD at S136 by Akt, and at S112 by ERK, inhibits BAD’s proapoptotic effects (22). Mcpt4 deletion increased phosphorylation of BAD at both S112 and S136 (Fig. 6A). It also increased CREB phosphorylation and Bcl-2 levels (Fig. 6A), and reduced caspase-3 activation and decreased cleavage of the DNA repair enzyme poly ADP ribose polymerase (PARP) (Fig. 6A)—a target of caspase-3.
To determine whether the inverse changes in IGF-1 and activated caspase-3 caused by Mcpt4 deletion are causally related, we pretreated (for 8 h from 64 to 72 h after I/R) Mcpt4−/− mice with the specific IGF-1R inhibitor, picropodophyllin (PPP) (23). Hearts were then harvested at 72 h after I/R. This acute IGF-1R inhibition caused an ∼2.5-fold activation of cardiac caspase-3 (P < 0.001) (Fig. 6B), consistent with IGF-1/IGF-1R signaling in post-I/R Mcpt4−/− hearts being prosurvival. Consistent with reduced cardiomyocyte death and tissue injury, compared with WT controls, there were twofold fewer apoptotic cells (TUNEL staining) in the infarct border zone of 72-h post-I/R Mcpt4−/− hearts (Fig. 6C), serum cardiac troponin I levels were reduced by 60% in 72-h post-I/R Mcpt4−/− mice (Fig. 6D), and macrophage infiltration in the infarct border zone was reduced by 77% (Fig. 6E).
Mcpt4 deletion reduces kidney TNFα and MCP1, but not IL1β or TGFβ, mRNA in experimental chronic kidney disease, suggesting that MMCP-4 is proinflammatory (24). We found no significant differences in serum TNFα, MCP1, IL1β, and TGFβ between 72-h post-I/R WT and Mcpt4−/− mice (Table S6). Seventy-two-hour post-I/R cardiac TNFα, MCP1, and IL1β mRNA levels were also not significantly affected by Mcpt4 deletion, but TGFβ mRNA levels decreased by ∼50% (P < 0.01) (Table S6). This decrease was not reversed by acute 8-h IGF-1R inhibition (using PPP) (Table S7), suggesting that IGF-1R signaling does not regulate TGFβ mRNA levels in post-I/R Mcpt4−/− hearts. TGFβ is profibrotic. Hence, fibrosis reduction in Mcpt4−/− hearts might, in part, be due to reduced TGFβ mRNA levels.
Table S6.
Cardiac mRNA levels and serum concentration levels of cytokines/growth factors in 72-h post-I/R WT and Mcpt4−/− mice
| Cytokines/growth factors | Cardiac mRNA (relative expression) at 72 h after I/R | Serum cytokine/growth factor at 72 h after I/R, pg/mL | ||||
| WT | Mcpt4−/− | P value | WT | Mcpt4−/− | P value | |
| TNFα | 1.0 ± 0.23 | 1.22 ± 0.15 | (0.45) | 100 ± 11 | 95 ± 12 | (0.81) |
| TGFβ | 1.0 ± 0.13 | 0.49 ± 0.023 | (0.0091) | 910 ± 140 | 740 ± 160 | (0.43) |
| IL1β | 1.0 ± 0.19 | 1.74 ± 0.47 | (0.18) | 110 ± 11 | 80 ± 16 | (0.12) |
| MCP1 | 1.0 ± 0.23 | 0.81 ± 0.14 | (0.5) | 1,000 ± 63 | 900 ± 110 | (0.43) |
| n per group | 4 | 4 | — | 6 | 6 | — |
Values are mean ± SEM mRNA transcripts were determined by quantitative real-time RT-PCR, and expression was normalized against 18S rRNA. mRNA values are expressed relative to those in 72-h post-I/R WT hearts. Values were compared by using unpaired Student’s t test.
Table S7.
Cardiac mRNA levels of cytokines/growth factors in 72-h post-I/R Mcpt4−/− mice subjected to acute (8 h) IGF-1R inhibition using PPP or vehicle treatment
| Cytokines/growth factors | Cardiac mRNA (relative expression) at 72-h post-I/R | ||
| Vehicle-treated Mcpt4−/− mice | PPP-treated Mcpt4−/− mice | P value | |
| TNFα | 1.0 ± 0.36 | 0.83 ± 0.15 | (0.67) |
| TGFβ | 1.0 ± 0.17 | 0.82 ± 0.088 | (0.39) |
| IL1β | 1.0 ± 0.3 | 1.35 ± 0.46 | (0.55) |
| MCP1 | 1.0 ± 0.17 | 0.92 ± 0.12 | (0.68) |
| n per group | 4 | 4 | — |
PPP or vehicle was given over the 8-h period from 64 to 72 h after I/R. Values are mean ± SEM mRNA transcripts were determined by quantitative real-time RT-PCR, and expression was normalized against 18S rRNA. mRNA values are expressed relative to those in vehicle-treated 72-h post-I/R Mcpt4−/− mice. Values were compared by using unpaired Student’s t test.
Collectively, our findings indicate that the deleterious effects of MMCP-4 after I/R are independent of its Ang II-forming activity, but rather are mediated by its IGF-1–degrading activity, which abolishes the late beneficial effects provided by enhanced IGF-1R prosurvival signaling. To further confirm this notion, we studied whether chronic IGF-1/IGF-1R inhibition abolishes all, or some, of the post-I/R protection afforded by Mcpt4 deletion. We found that although Mcpt4 deletion attenuated infarct expansion (wall thinning) at 14 d after I/R, this salutary effect was prevented by chronic IGF-1/IGF-1R inhibition (from 24 h to 14 d after I/R) (Fig. 6F). By contrast, chronic IGF-1/IGF-1R inhibition with PPP had no significant effect on infarct expansion in WT hearts (Fig. 6F). Similarly, after chronic IGF-1/IGF-1R inhibition, 14-d post-I/R scar areas in both WT and Mcpt4−/− mice were not significantly different from those in untreated WT controls (Fig. 6G) but, in the absence of IGF-1R inhibition, were smaller in Mcpt4−/− mice (Fig. 3D). Thus, endogenous IGF-1 activation does not protect ischemia-injured WT hearts from late infarct progression, but when MMCP-4 (and its IGF-1–degrading activity) is deleted, IGF-1 increases to a level that suppresses late infarct progression.
We also studied LV systolic function in these mice (Fig. 6H) and found that chronic IGF-1/IGF-1R inhibition markedly decreased LVEF in both WT and Mcpt4−/− mice to about the same level. Because LVEF was greater in post-I/R Mcpt4−/− mice than in WT controls, IGF-1R inhibition produced a greater decrease in LV systolic function in Mcpt4−/− mice. Together, these data suggest that, in WT animals, late post-I/R induction of endogenous IGF-1 is sufficient to impact cardiac function (Fig. 6H), but not infarct progression (Fig. 6 F and G). By decreasing IGF-1 cleavage, Mcpt4 deletion increases endogenous IGF-1 levels and prosurvival signaling to a level that allows late cardioprotection, which inhibits infarct progression.
Discussion
Exogenous IGF-1 inhibits apoptosis in reperfused hearts after an ischemic injury, as well as improving LV function and reducing adverse cardiac remodeling (9–11). IGF-1 plays critical roles in fetal and early postnatal heart growth (25, 26), but its expression is repressed soon after birth. The evidence presented here indicates that a few days after the start of reperfusion, myocardial IGF-1 levels increase, which could potentially limit further cardiomyocyte loss by inhibiting caspase-3 activation (21). However, our data suggest, rather, that post-I/R increases in cardiac MMCP-4 (most likely due to infiltration of MMCP-4 containing mast cell into the infarct zone) degrades IGF-1 and, thus, antagonizes its prosurvival effects, resulting in enhanced apoptosis and late infarct progression. Although cardiac dysfunction is related to infarct size in postischemic hearts (16), our results suggest that some of the functional effects of endogenous IGF-1 may be independent of its cardioprotective effects. This explanation is based on the finding that IGF-1/IGF-1R inhibition in post-I/R WT mice exacerbated LV systolic dysfunction without impacting late infarct progression. Whether this increased dysfunction is caused by blockade of a direct effect of IGF-1 on cardiomyocyte contractility, or involves other known effects of IGF-1—e.g., on cardiomyocyte metabolism, hypertrophy, autophagy, and replication (21)—remains to be established.
Mcpt4 deletion produced a relatively small (∼25%) improvement in post-I/R LV systolic function (Fig. 2A). Although even modest improvements can be important in human MI, the increase in systolic function in Mcpt4−/− mice is achieved at lower LV end-diastolic and -systolic volumes and at higher LV wall thicknesses, which are likely attributable to amelioration of pathological remodeling. Wall stress is proportional to LV chamber diameter and inversely proportional to wall thickness (27). Thus, Mcpt4 deletion likely lowers wall stress in post-I/R hearts at a time when systolic function is modestly improved; a reduction in wall stress is expected to increase mechanical efficiency of ischemia-injured hearts. Future studies are needed to understand whether chymase inhibitors improve post-MI survival by this mechanism (7, 8).
Clinical studies have established an important deleterious effect of Ang II in postischemic heart disease (2). Studies with chymase inhibitors have often alluded to the Ang II-forming activity of chymase as being critical to its detrimental effect in postischemic hearts—based entirely on associative findings (e.g., ref. 28). We show that whereas Mcpt4 deletion improves cardiac structure and function post-I/R, this effect is unrelated to blockade of a non-ACE Ang II-forming pathway. Chymases activate promatrix metalloproteinase 2 and 9 (pro-MMP2/9) (29), which could promote wall thinning and cardiac dilatation by degrading the cardiac interstitial matrix. Regional wall thinning is a consequence of myofiber slippage (30), and MMP-dependent extracellular remodeling is required for continued expansion of the healing infarct (31) and chamber dilatation (32). We show that Mcpt4 deletion attenuates infarct expansion; because this effect is negated by inhibition of IGF-1/IGF-1R signaling, it suggests that if MMCP-4–mediated pro-MMP2/9 activation is also important in post-I/R infarct progression, it is indirect and involves IGF-1.
MMCP-4 is the functional homolog of human chymase (e.g., ref. 8). We show here that, like MMCP-4, human chymase also degrades IGF-1. The rationale for developing human chymase inhibitors was to prevent chymase-mediated Ang II formation, which is resistant to ACE inhibition. However, a double-blind trial showed little improvement when AT1 receptor blockade was combined with ACEi treatment versus ACEi monotherapy (2). This lack of difference provided an argument against the use of chymase inhibitor therapy in patients with MI. We believe that this trial actually left unresolved the question of whether direct chymase inhibition, independent of its effects on Ang II generation, might be effective in these patients. Given the findings here, it is likely that chymase inhibitors may prove to be useful for protecting patients from delayed post-I/R cardiac injury and therefore warrant clinical investigation.
Materials and Methods
Animals were handled according to Emory University’s Institutional Animal Care and Use Committee (IACUC) Guidelines. To minimize inbred strain background effects, Mcpt4−/− mice (33) were first backcrossed for >12 generations to the C57BL/6J genetic background. Then, fewer than five homozygote × homozygote Mcpt4−/− crosses or WT × WT C57BL/6J mice crosses were used to accumulate Mcpt4−/− or WT homozygous progeny, respectively, which were studied at 11–13 wk of age. This breeding strategy allowed a large number of mice to be rapidly generated so that I/R surgeries could be performed by one surgeon (T.T.) over a short period. I/R surgeries were performed, as described (34), in cohorts of ∼8 mice per day. Infarct size and echocardiographic analyses were performed as described (34). Protein and gene expression levels were estimated by immunoblotting and quantitative RT-PCR, respectively, and IGF-1 was visualized by immunohistochemistry using described protocols (26). Detailed material and methods are provided in SI Materials and Methods.
SI Materials and Methods
Animals.
Animals were handled according to Emory University’s Institutional Animal Care and Use Committee Guidelines. All animal studies were approved by the Emory University IACUC (protocol no. 2002614-020617BN; US Public Health Service assurance no. A3180-01). All I/R surgeries were performed by the same surgeon on an 11- to 13-wk-old male Mcpt4−/− or WT mice over a short period. To minimize inbred strain background effects, Mcpt4−/− mice (33) were first backcrossed for more than 12 generations to the C57BL/6J genetic background. After this breeding, fewer than five homozygote × homozygote Mcpt4−/− crosses or WT × WT C57BL/6J mice crosses were used to accumulate Mcpt4−/− or WT homozygous progeny, respectively.
I/R Surgery.
Mice were subjected to I/R involving left anterior descending coronary artery occlusion followed by reperfusion for up to 2 wk, as described (34). In brief, before any surgical procedure, mice were anesthetized with i.p. injections of ketamine (60 mg/kg) and sodium pentobarbital (50 mg/kg). The mice were then attached to a surgical board with their ventral side up and subjected to tracheal intubation with polyethylene (PE)-60 tubing connected via a loose junction to a rodent ventilator (MiniVent Type 845; Hugo-Sachs Elektronik) set at a tidal volume of 240 µL and a rate of 110 breaths per minute and supplemented with 100% oxygen (at a flow rate of 0.1–0.2 l/min) via a side port on the ventilator. Effective ventilation was visually confirmed by vapor condensation in the endotracheal tube and rhythmic rising of the chest. Mice were maintained at a constant temperature of 37 °C with a heating pad. Temperature was monitored via a rectal probe connected to a Digisense K-Type digital thermometer. A median sternotomy was performed under aseptic conditions, and the wound edges were cauterized. The left anterior descending coronary artery was visualized with the aid of an Olympus stereomicroscope and ligated with a 7-0 silk suture. A short segment of PE-10 tubing was placed between the left anterior descending coronary artery and the 7-0 silk suture to minimize damage to the coronary artery and to allow complete reperfusion following the ischemic period. During the ischemic period, the incision was covered with Parafilm to prevent desiccation and dehydration. After 90 min of left anterior descending coronary artery occlusion, the ligature was removed, and reperfusion was confirmed visually. The chest wall and skin incision were carefully closed in layers and, during recovery, the animals were kept on a warming pad and received 100% oxygen.
Drug Administration Protocol.
Buprenorphine at a dose of 0.05 mg⋅kg−1 was administered after surgery and twice daily for 2 d postoperatively. Drugs administered after the recovery period (i.e., 24 h after the start of reperfusion): captopril as an ACE inhibitor (0.346 mmol⋅kg−1⋅d−1 in drinking water, daily); valsartan as an AT1 receptor blocker (92 µmol⋅kg−1⋅d−1 in drinking water, daily); and PD123319 as an AT2 receptor antagonist (13.6 µmol⋅kg−1⋅d−1 in 0.9% saline, s.c., daily). Picropodophyllin (PPP; Tocris-R&D Systems), an IGF-1R inhibitor, was injected at 48.3 µmol/kg body weight, i.p., 8 h before killing or daily from day 2 to day 13 after I/R.
Echocardiography.
The mice were lightly anesthetized with isofluorane (1–2%) and a transthoracic echocardiogram of the LV obtained (28). A 38-MHz linear array scan-head interfaced with a Vevo 2100 (Visualsonics) was used to obtain high-resolution M-mode images. From these images, LV end-diastolic diameter, LV end-systolic diameter, fractional shortening, LV volumes, and ejection fraction were calculated.
Infarct Size Analyses.
At 24 h of reperfusion, the mice were anesthetized as before, intubated, and ventilated. A catheter (PE-10 tubing) was placed in the common carotid artery to allow for Evans Blue dye injection. A median sternotomy was performed, and the left coronary artery was religated in the same location as before. Evans Blue dye [1.25 mL of a 7.0% (wt/vol) solution; Sigma] was injected via the carotid artery catheter into the heart to delineate the area at risk. The heart was rapidly excised and serially sectioned along the long axis in five, 1-mm-thick sections that were then incubated in 1.0% 2,3,5-triphenyltetrazolium chloride (TTC; Sigma) for 4 min at 37 °C to demarcate the viable and nonviable myocardium within the area at risk. Each of the five, 1-mm-thick myocardial slices was weighed and the at-risk, infarcted, and nonischemic areas of the LV were quantitated by a blinded observer using computer-assisted planimetry (NIH Image 1.57), as described (34).
At 14 d after I/R, myocardial sections (5 µm) were stained with Masson's trichrome to determine scar size and viable myocardium by light microscopy. Viable myocardium stained red, and scar tissue appeared blue or grayish blue with Masson’s trichrome. Scar area, scar length, and LV wall thickness were measured and averaged by using five consecutive Masson’s trichrome-stained heart cross-sections each separated from the next by 500 µm. Micropictographs were obtained at 1.25× by using Lecia microscope (DM6000). Each image was digitally enhanced by adjusting the selective color to enhance and separate the blue and red pigments (Adobe Photoshop). The LV free wall was selected and separated from each image; the scar area within the LV wall was then selected by using the blue pigments (tolerance = 70). Total LV wall and scar area were measured by using ImageJ software (NIH). LV free wall length was measured by tracing the midlength point along the LV free wall in ImageJ. The average wall thickness (WTh) was calculated based on the LV free wall area (A) and length (L) measurements (average WTh = A/L).
Blood Pressure Analysis.
Hemodynamic measurements were carried out as described (15). Briefly, after induction of anesthesia with isofluorane [1–2% (wt/vol)], a 1F high fidelity pressure transducer (Millar Instruments) was passed into the aorta via the right carotid artery for measurement of arterial blood pressure. Electrodes were attached for ECG and heart rate recordings.
Immunohistochemistry and Confocal Microscopy.
Immunohistochemical analyses were performed as described (28). Mouse hearts were either immersion-fixed in 10% formalin, stored in 70% ethanol until paraffin embedding and sectioning, or stored by embedding in TissueTek cassettes and freezing in liquid nitrogen and then at –80 °C for immunostaining with those antibodies that work with frozen sections. Sections (5 μm) were mounted on slides. For paraffin-embedded sections, the slides were deparaffinized in xylene and rehydrated in ethanol. Sections were blocked with 5% vol/vol goat serum for 30 min at room temperature before applying primary antibody in 5% vol/vol goat serum for 1 h at room temperature. Antibodies used were those raised against α-sarcomeric actin (ab28052; Abcam), IGF-1 (ab9572; Abcam), and macrophages (Ab6640). Alexa Fluor-488, and Alexa Fluor-594 goat anti-mouse or anti-rabbit secondary antibodies were used. DAPI was used to stain nuclei. To determine whether a nucleus of interest was in a cardiomyocyte, several focal planes were examined by confocal microscopy. Images were acquired on a Leica Microsystems confocal microscope by using LAS AF program or by Nikon’s Structured Illumination Microscope for 3D reconstruction of the 100× images by using NIS Elements (Nikon Corporation). Images were adjusted appropriately to remove background fluorescence.
Apoptosis Analysis.
Unfixed, fresh hearts were harvested 3 d after I/R surgery, washed with PBS, tapped dried on a cotton gauze, immediately set in a tissue mold containing optimal cutting temperature (OCT) (Tissue-Tek; Sakura Finetek USA) and rapidly frozen in isopentane, and then stored at –80 °C. Sections (5 μm) were cut on lysine-coated slides by using a cryostat at –20 °C. Slides were stored at –80 °C until analyzed. Apoptosis assay was performed by using the CardioTACS kit (R&D Systems) as per the manufacturers’ protocol that is based on the principle of terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end-labeling (TUNEL).
Cardiomyocyte Isolation.
Cardiomyocytes and nonmyocytes from the 3-d post-I/R hearts were isolated, as described (28), with a few modifications. Briefly, hearts were perfused with perfusion buffer for 4 min and then with perfusion buffer containing 2 mg/mL collagenase (Worthington) for ∼15 min at 37 °C. The heart was placed in Stop buffer comprising perfusion buffer plus 10% vol/vol bovine calf serum. The perfused heart was gently disaggregated by teasing apart the tissue with scissors followed by passage through pipettes of progressively smaller diameters (28). The cardiomyocytes and nonmyocytes are separated through density centrifugation by spinning at a low speed (18 × g) for 5 min. Cardiomyocytes sediment at this speed, but the majority of nonmyocytes (e.g., fibroblasts, endothelial cells) remain in the supernatant. The supernatant was transferred into a new tube and centrifuged at 340 × g for 5 min to collect the nonmyocyte pellet. Both cardiomyocyte and nonmyocyte pellets are washed once with PBS and then snap frozen in liquid nitrogen until use for RNA extraction and then quantitative RT-PCR (qRT-PCR). Previously, we have shown that cardiomyocytes are ∼99% pure by using this protocol (28).
qRT-PCR.
RNA was extracted from snap frozen LVs using a mirVana miRNA kit (Ambion), and from cardiomyocytes and nonmyocytes using the RiboPure kit (Ambion) and real-time qRT-PCR performed as described (28). Primers for: MMCP-4 were 5′: GTAATTCCTCTGCCTCGTCCTT, 3′: GACAGGATGG-ACACATGCTTT; IGF-1 were 5′: ATAAAGATACACATCATGTC, 3′: TTGTAGGCTTCAGTGGGGCAC; IGF-1R were 5′: CGCCTGGAAAACTGCACG, 3′: AGCTGCCCAGGCACTCCG; SCF were 5′: GGTGGCA-AATCTTCCAAATG, 3′: GGCCTCTTCGGAGATTCTTT; TNFα were 5′: TCTTCTCATTCCTGCTTGTGG, 3′: GGTCTGGGCCATAGAACTGA; TGFβ were 5′: GCAACATGTGGAACTCTACCAGA, 3′: GACGTCAAAAGACAGCCACTCA; IL1β were 5′: TGTAATGAAAGACGGCACACC, 3′: TCTTCTTTGGGTATTGCTTGG; MCP1/CCL2 were 5′: ACCACAGTCCATGCCATCAC, 3′: TTGAGGTGGTTGTGGAAAAG. Primers for 18S were as described (26).
Western Blot Analysis.
After extracting snap-frozen heart tissues with RIPA buffer (Sigma), 15 µg of protein was fractionated on 4–18% (wt/vol) precast Bio-Rad gels and then transferred to Bio-Rad’s PVDF membrane with Bio-Rad’s Turbo Transfer system. Membranes were preblocked for 1 h at room temperature in superblock (Thermo Scientific) and probed by using antibodies raised against IGF-1 (ab9572, Abcam), Akt (4691S, Cell Signaling), p-Akt-S473 (4060S, Cell Signaling), p-Bad-S136 (4366, Cell Signaling), p-Bad-S112 (9296, Cell Signaling), BCL2 (2870, Cell Signaling), p-ERK-p-44(T202/Y204) (4370, Cell Signaling), p-CREB-S133 (9198, Cell Signaling), active caspase-3 (Millipore, AB3623), cleaved PARP (9544, Cell Signaling), GAPDH (2118, Cell Signaling), and MMCP-4. MMCP-4 rabbit polyclonal antibody was made against the MMCP-4 sequence, as described (9). It recognizes a peptide sequence unique to the mouse mast cell protease 4 isoform. Goat anti-mouse IgG (Sigma) or anti-rabbit IgG (Bio-Rad) conjugated to HRP were used as the secondary antibody. Protein detection was accomplished with Super Signal West Dura Kit (Thermo Scientific). Quantitative densitometry was performed by using Bio-Rad’s GelDoc system equipped with a CCD camera and ImageLab v.5 program.
In most cases, representative images (two lanes per group) are shown above the quantitative data. Each lane represents a biological replicate. Because we wanted to limit variations between experimental groups caused by intergel densitometric analyses, quantitation of proteins of interest between two experimental groups were always performed by using data from a single gel, which limited n to 4 per group. Statistical power analyses indicated that with n of 4, a significant change of less than twofold between groups could be missed. That is, our immunoblot results could suffer from type II errors, or false negatives (when one does not see things that are there). To add strength to our immunoblot data, we mostly repeated analyses of each set of biological samples at least twice, and frequently two independent sets of four biological replicates per group were also studied. The values shown represent data from one of these sets.
IGF-1 Proteolytic Degradation Analyses.
Mouse IGF-1 (200 ng, R&D Systems) and human IGF-1 (200 ng, Millipore, catalog no. GF138) were incubated with serial dilutions of purified MMCP-4 (0–3 µg) (9) and recombinant human chymase (0–65 ng, Sigma, C8818-50UG), respectively, in a 100-µL reaction buffer containing 140 mM NaCl (pH 7.4) in 1× PBS. MMCP-4 was purified from mouse skin (9) and was a gift from Naoki Hase (Teijin Pharmaceuticals, Tokyo). To test for specificity in one control reaction, chymostatin, a chymotrypsin-like serine proteinase inhibitor, was used to prevent chymase-mediated IGF-1 cleavage with highest concentration of MMCP-4. Reaction was carried out at 37 °C for 1 h and stopped by the addition of 100 µL of Laemmli + 350 mM DTT and incubated at 99 °C for 5 min to denature the proteins for SDS/PAGE analysis. After cooling samples for 5 min on ice, 20 µL of each sample was loaded onto 18% (wt/vol) Criterion Gel (Bio-Rad). Proteins were transferred to PVDF membrane and preblocked for 1 h at room temperature in superblock (Thermo Scientific) and probed by using antibody against IGF-1 (ab9572, Abcam). Goat anti-rabbit IgG (Bio-Rad) conjugated to HRP was used as the secondary antibody. Protein detection was accomplished with Super Signal West Dura Kit (Thermo Scientific). Images were taken by using Bio-Rad’s Gel Doc system equipped with a CCD camera and Image Lab v.5 program.
LV Tissue Fractionation and IGF-1 Proteolytic Degradation.
A single LV, harvested at 72 h after IR, was snap frozen in liquid nitrogen. All of the procedures were performed at 4 °C. The LV was homogenized by using Polytron probe in 300 µL of ice-cold 20 mM Tris⋅HCl buffer, pH 7.5. The homogenate was centrifuged at 16,100 × g for 40 min and the pellet (P1) and supernatant (S1) saved. Ten-microliter aliquots were reserved for IGF-1–degrading activity assays. P1 was then resuspended in 250 µL of 20 mM Tris⋅HCl buffer containing 1% Triton-X-100 (pH 7.5) to solubilize membrane proteins. This homogenate was then centrifuged at 16,100 × g for 40 min and the pellet (P2) and supernatant (S2) saved. P2 was then resuspended in 250 µL of 20 mM Tris⋅HCl buffer, pH 7.5, containing 1 M KCl to extract charged membrane-associated proteins, and then centrifuged as described above. The remaining pellet (P3), which was resuspended in 250 µL of Tris⋅HCl buffer, and supernatant (S3) were reserved for IGF-1–degrading activity assays. Results shown are representative of three independent tissue extractions.
Recombinant mouse IGF-1 (200 ng, R&D Systems) was incubated with 10 µL of sample (P or S) in 100 µL of PBS, pH 7.4, containing 140 mM NaCl for 10 min, at 37 °C. To test which class of proteases is responsible for IGF-1 degradation, we used 1 mM PMSF, 1 mM EDTA, 1 µM pepstatin A (Sigma), 1 mM N-ethylmaleimide, and 10 µM chymostatin (Sigma) to inhibit serine proteases, metalloproteinases, aspartyl proteases, cysteine proteases, and chymotrypsin-like serine proteases, respectively. Inhibitors were preincubated for 30 min with 10 µL of sample before addition of the substrate mouse IGF-1 (200 ng). To test whether MMCP-4 in the LV fractions is responsible for IGF-1 degradation, we preincubated the samples with affinity purified custom polyclonal MMCP-4 antibody (9) (1:50 dilution) for 2 h at 4 °C before the addition of the substrate mouse IGF-1. Reactions were terminated by the addition of the Laemmli sample buffer and IGF-1 degradation analyzed by Western blot.
Serum Measurements of Cardiac Troponin I (cTnI) and Other Cytokines/Growth Factor.
Circulating cardiac troponin I (cTnI) (Life Diagnostics, catalog no. 2010–1-HSP) and IGF-1 (R&D Systems, catalog no. MG100) were determined by ELISA. Circulating TNFα, TGFβ, IL1β, and MCP1 concentrations were measured by Ray Biotech on their Quantikine Chip analysis platform.
Statistics.
Animal surgeries were performed in cohorts of ∼8 mice each. No blinding was used for the animal surgeries. Mice were randomly assigned to the drug treatment and control cages before injections or drug administration. All immunoblot experiments were repeated multiple times with similar results. Results are expressed as the mean ± SEM. Data represent biological replicates. Differences between experimental groups were assessed for significance by using a two-tailed unpaired Student t test, or one- or two-way ANOVA with Tukey multiple comparisons test using GraphPad Prism. In cases in which a parametric t test was used, we first checked normality by using a Shapiro–Wilk or a Kolmogorov–Smirnov normality test (depending on the number of measurements available). The statistical tests used to compare samples and cohorts in this study are described and well established. Data met the assumptions of the statistical tests used. Log2 conversion was used where appropriate. We were cautious in making as few assumptions as possible in our data analysis, often using nonparametric and/or multiple statistical tests for each experiment/analysis. P < 0.05 was considered significant.
Acknowledgments
This work was funded by a Department of Medicine, Emory University grant; a Carlyle Fraser Heart Center, Emory University Hospital Midtown grant; NIH Grants HL079040, HL127726, HL098481, T32HL007745, HL092141, HL093579, HL094373, and HL113452; American Heart Association Grant 13SDG16460006; a Swedish Research Council grant; the Foundation Leducq; and National Health and Medical Research Council of Australia Grant 573732.
Footnotes
The authors declare no conflict of interest.
This article is a PNAS Direct Submission.
This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1603127113/-/DCSupplemental.
References
- 1.Pfeffer MA, et al. The SAVE Investigators Effect of captopril on mortality and morbidity in patients with left ventricular dysfunction after myocardial infarction. Results of the survival and ventricular enlargement trial. N Engl J Med. 1992;327(10):669–677. doi: 10.1056/NEJM199209033271001. [DOI] [PubMed] [Google Scholar]
- 2.Pfeffer MA, et al. Valsartan in Acute Myocardial Infarction Trial Investigators Valsartan, captopril, or both in myocardial infarction complicated by heart failure, left ventricular dysfunction, or both. N Engl J Med. 2003;349(20):1893–1906. doi: 10.1056/NEJMoa032292. [DOI] [PubMed] [Google Scholar]
- 3.Wernersson S, Pejler G. Mast cell secretory granules: Armed for battle. Nat Rev Immunol. 2014;14(7):478–494. doi: 10.1038/nri3690. [DOI] [PubMed] [Google Scholar]
- 4.Urata H, Kinoshita A, Misono KS, Bumpus FM, Husain A. Identification of a highly specific chymase as the major angiotensin II-forming enzyme in the human heart. J Biol Chem. 1990;265(36):22348–22357. [PubMed] [Google Scholar]
- 5.Jin D, et al. Impact of chymase inhibitor on cardiac function and survival after myocardial infarction. Cardiovasc Res. 2003;60(2):413–420. doi: 10.1016/s0008-6363(03)00535-2. [DOI] [PubMed] [Google Scholar]
- 6.Kanemitsu H, et al. Chymase inhibition prevents cardiac fibrosis and dysfunction after myocardial infarction in rats. Hypertens Res. 2006;29(1):57–64. doi: 10.1291/hypres.29.57. [DOI] [PubMed] [Google Scholar]
- 7.Hoshino F, et al. Chymase inhibitor improves survival in hamsters with myocardial infarction. J Cardiovasc Pharmacol. 2003;41(Suppl 1):S11–S18. [PubMed] [Google Scholar]
- 8.Wei CC, et al. Mast cell chymase limits the cardiac efficacy of Ang I-converting enzyme inhibitor therapy in rodents. J Clin Invest. 2010;120(4):1229–1239. doi: 10.1172/JCI39345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Dai W, Kloner RA. Cardioprotection of insulin-like growth factor-1 during reperfusion therapy: What is the underlying mechanism or mechanisms? Circ Cardiovasc Interv. 2011;4(4):311–313. doi: 10.1161/CIRCINTERVENTIONS.111.964049. [DOI] [PubMed] [Google Scholar]
- 10.O’Sullivan JF, et al. Potent long-term cardioprotective effects of single low-dose insulin-like growth factor-1 treatment postmyocardial infarction. Circ Cardiovasc Interv. 2011;4(4):327–335. doi: 10.1161/CIRCINTERVENTIONS.110.960765. [DOI] [PubMed] [Google Scholar]
- 11.Davis ME, et al. Local myocardial insulin-like growth factor 1 (IGF-1) delivery with biotinylated peptide nanofibers improves cell therapy for myocardial infarction. Proc Natl Acad Sci USA. 2006;103(21):8155–8160. doi: 10.1073/pnas.0602877103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Osterziel KJ, et al. Randomised, double-blind, placebo-controlled trial of human recombinant growth hormone in patients with chronic heart failure due to dilated cardiomyopathy. Lancet. 1998;351(9111):1233–1237. doi: 10.1016/S0140-6736(97)11329-0. [DOI] [PubMed] [Google Scholar]
- 13.Nilsson G, Butterfield JH, Nilsson K, Siegbahn A. Stem cell factor is a chemotactic factor for human mast cells. J Immunol. 1994;153(8):3717–3723. [PubMed] [Google Scholar]
- 14.Li M, et al. Involvement of chymase-mediated angiotensin II generation in blood pressure regulation. J Clin Invest. 2004;114(1):112–120. doi: 10.1172/JCI20805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Reilly CF, Tewksbury DA, Schechter NM, Travis J. Rapid conversion of angiotensin I to angiotensin II by neutrophil and mast cell proteinases. J Biol Chem. 1982;257(15):8619–8622. [PubMed] [Google Scholar]
- 16.Kwon DH, et al. Extent of left ventricular scar predicts outcomes in ischemic cardiomyopathy patients with significantly reduced systolic function: A delayed hyperenhancement cardiac magnetic resonance study. JACC Cardiovasc Imaging. 2009;2(1):34–44. doi: 10.1016/j.jcmg.2008.09.010. [DOI] [PubMed] [Google Scholar]
- 17.Oyamada S, Bianchi C, Takai S, Chu LM, Sellke FW. Chymase inhibition reduces infarction and matrix metalloproteinase-9 activation and attenuates inflammation and fibrosis after acute myocardial ischemia/reperfusion. J Pharmacol Exp Ther. 2011;339(1):143–151. doi: 10.1124/jpet.111.179697. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Hara M, et al. Mast cells cause apoptosis of cardiomyocytes and proliferation of other intramyocardial cells in vitro. Circulation. 1999;100(13):1443–1449. doi: 10.1161/01.cir.100.13.1443. [DOI] [PubMed] [Google Scholar]
- 19.Reiss K, et al. Acute myocardial infarction leads to upregulation of the IGF-1 autocrine system, DNA replication, and nuclear mitotic division in the remaining viable cardiac myocytes. Exp Cell Res. 1994;213(2):463–472. doi: 10.1006/excr.1994.1224. [DOI] [PubMed] [Google Scholar]
- 20.Andersson MK, Karlson U, Hellman L. The extended cleavage specificity of the rodent beta-chymases rMCP-1 and mMCP-4 reveal major functional similarities to the human mast cell chymase. Mol Immunol. 2008;45(3):766–775. doi: 10.1016/j.molimm.2007.06.360. [DOI] [PubMed] [Google Scholar]
- 21.Troncoso R, Ibarra C, Vicencio JM, Jaimovich E, Lavandero S. New insights into IGF-1 signaling in the heart. Trends Endocrinol Metab. 2014;25(3):128–137. doi: 10.1016/j.tem.2013.12.002. [DOI] [PubMed] [Google Scholar]
- 22.Fang X, et al. Regulation of BAD phosphorylation at serine 112 by the Ras-mitogen-activated protein kinase pathway. Oncogene. 1999;18(48):6635–6640. doi: 10.1038/sj.onc.1203076. [DOI] [PubMed] [Google Scholar]
- 23.Strömberg T, et al. IGF-1 receptor tyrosine kinase inhibition by the cyclolignan PPP induces G2/M-phase accumulation and apoptosis in multiple myeloma cells. Blood. 2006;107(2):669–678. doi: 10.1182/blood-2005-01-0306. [DOI] [PubMed] [Google Scholar]
- 24.Scandiuzzi L, et al. Mouse mast cell protease-4 deteriorates renal function by contributing to inflammation and fibrosis in immune complex-mediated glomerulonephritis. J Immunol. 2010;185(1):624–633. doi: 10.4049/jimmunol.0902129. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Xin M, et al. Regulation of insulin-like growth factor signaling by Yap governs cardiomyocyte proliferation and embryonic heart size. Sci Signal. 2011;4(196):ra70. doi: 10.1126/scisignal.2002278. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Naqvi N, et al. A proliferative burst during preadolescence establishes the final cardiomyocyte number. Cell. 2014;157(4):795–807. doi: 10.1016/j.cell.2014.03.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Grossman W, Jones D, McLaurin LP. Wall stress and patterns of hypertrophy in the human left ventricle. J Clin Invest. 1975;56(1):56–64. doi: 10.1172/JCI108079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Jin D, Takai S, Yamada M, Sakaguchi M, Miyazaki M. Beneficial effects of cardiac chymase inhibition during the acute phase of myocardial infarction. Life Sci. 2002;71(4):437–446. doi: 10.1016/s0024-3205(02)01689-2. [DOI] [PubMed] [Google Scholar]
- 29.Tchougounova E, et al. A key role for mast cell chymase in the activation of pro-matrix metalloprotease-9 and pro-matrix metalloprotease-2. J Biol Chem. 2005;280(10):9291–9296. doi: 10.1074/jbc.M410396200. [DOI] [PubMed] [Google Scholar]
- 30.Weisman HF, Healy B. Myocardial infarct expansion, infarct extension, and reinfarction: Pathophysiologic concepts. Prog Cardiovasc Dis. 1987;30(2):73–110. doi: 10.1016/0033-0620(87)90004-1. [DOI] [PubMed] [Google Scholar]
- 31.Mukherjee R, et al. Myocardial infarct expansion and matrix metalloproteinase inhibition. Circulation. 2003;107(4):618–625. doi: 10.1161/01.cir.0000046449.36178.00. [DOI] [PubMed] [Google Scholar]
- 32.Ducharme A, et al. Targeted deletion of matrix metalloproteinase-9 attenuates left ventricular enlargement and collagen accumulation after experimental myocardial infarction. J Clin Invest. 2000;106(1):55–62. doi: 10.1172/JCI8768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Tchougounova E, Pejler G, Abrink M. The chymase, mouse mast cell protease 4, constitutes the major chymotrypsin-like activity in peritoneum and ear tissue. A role for mouse mast cell protease 4 in thrombin regulation and fibronectin turnover. J Exp Med. 2003;198(3):423–431. doi: 10.1084/jem.20030671. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Bryan NS, et al. Dietary nitrite supplementation protects against myocardial ischemia-reperfusion injury. Proc Natl Acad Sci USA. 2007;104(48):19144–19149. doi: 10.1073/pnas.0706579104. [DOI] [PMC free article] [PubMed] [Google Scholar]