Abstract
Epstein-Barr virus lytic replication is accomplished by an intricate cascade of gene expression that integrates viral DNA replication and structural protein synthesis. Most genes encoding structural proteins exhibit “true” late kinetics–their expression is strictly dependent on lytic DNA replication. Recently, the EBV BcRF1 gene was reported to encode a TATA box binding protein homolog, which preferentially recognizes the TATT sequence found in true late gene promoters. BcRF1 is one of seven EBV genes with homologs found in other β- and γ-, but not in α-herpesviruses. Using EBV BACmids, we systematically disrupted each of these “βγ” genes. We found that six of them, including BcRF1, exhibited an identical phenotype: intact viral DNA replication with loss of late gene expression. The proteins encoded by these six genes have been found by other investigators to form a viral protein complex that is essential for activation of TATT-containing reporters in EBV-negative 293 cells. Unexpectedly, in EBV infected 293 cells, we found that TATT reporter activation was weak and non-specific unless an EBV origin of lytic replication (OriLyt) was present in cis. Using two different replication-defective EBV genomes, we demonstrated that OriLyt-mediated DNA replication is required in cis for TATT reporter activation and for late gene expression from the EBV genome. We further demonstrate by fluorescence in situ hybridization that the late BcLF1 mRNA localizes to EBV DNA replication factories. These findings support a model in which EBV true late genes are only transcribed from newly replicated viral genomes.
Author Summary
A strict linkage between viral DNA replication and the onset of late gene expression is commonly found in DNA viruses. In herpesviruses, the precise mechanism for this requirement remains elusive. Competing models are titration of putative repressors as a result of increase in template copy number and the requirement of newly replicated DNA as the template for late gene transcription. Efforts to differentiate between these two models have been hampered in part by the use of reporter assays which may not recapitulate the effects of whole viral genomes. Several reports, using reporter assays, provide conflicting evidence arguing for both models in EBV. By performing experiments in the context of the whole virus, we demonstrate that EBV late gene expression requires both the products of six genes unique to β- and γ-herpesviruses and the presence of EBV origin of lytic replication (OriLyt) in cis. These findings provide strong evidence that the second model is correct for EBV, i.e., the newly replicated viral genome serves as the template for EBV late gene transcription.
Introduction
Epstein-Barr virus (EBV) is a γ-herpesvirus that infects more than 95% of the human adult population. Primary infection is usually asymptomatic if acquired early in life, but often results in infectious mononucleosis in adolescence [1,2]. EBV is associated with several B-cell and epithelial cancers, including Burkitt lymphoma, Hodgkin lymphoma, post-transplant lymphoproliferative disorder, nasopharyngeal and gastric carcinoma [3–6]. Like all herpesviruses, EBV exists in two states in infected cells: latent infection and lytic replication. In latent infection, only a limited subset of viral genes is expressed, and infectious virions are not produced. In contrast, during lytic replication (or productive infection), nearly all viral genes are transcribed, viral DNA is replicated, and infectious virions are produced, enabling transmission to other cells and hosts. Although EBV-positive tumors are characterized by latent infection, there is increasingly compelling evidence that both latent infection and lytic gene expression are essential for emergence of EBV-associated malignancies [7–10].
As with all herpesviruses, EBV lytic replication proceeds through an ordered cascade of gene expression. First, immediate-early genes BRLF1 and BZLF1, encoding the transcription factors R (also called Rta) and Z (also called Zta, ZEBRA or EB1), respectively, are expressed [11–16]. R and Z activate the promoters of early genes [12,17–19]. Many early genes encode proteins directly or indirectly involved in viral DNA replication, which is initiated at two origins of lytic replication (OriLyt) used during the productive cycle of EBV [20]. Following viral DNA synthesis, late genes are expressed. EBV late genes mainly encode structural proteins of the EBV virion that elicit strong immune responses (reviewed in reference [11]). EBV late genes can be further subdivided into two groups based on the degree of dependence on viral DNA replication. True late genes absolutely require viral DNA replication for their expression, while leaky late (or delayed early) genes, although usually expressed after DNA replication, can still be expressed from viruses defective for DNA replication. True late genes are often distinguished by their inability to be expressed in presence of viral DNA polymerase inhibitors such as acyclovir [21]. While regulation of immediate-early and early gene expression in herpesviruses is well characterized, relatively little is known about regulation of late genes.
In contrast to all other viral gene promoters, the promoters of EBV true late genes (simply referred to as late genes hereafter) frequently contain a non-canonical TATA box with a thymidine at the fourth position (TATT) [22]. This non-canonical TATT sequence has been recently identified as a critical element for activation of late genes in the β-herpesvirus human cytomegalovirus (HCMV), as well as other γ-herpesviruses, including Kaposi’s sarcoma-associated herpesvirus (KSHV) and murine herpesvirus-68 (MHV-68) [23–25]. An important advance in understanding of EBV late gene regulation came with the prediction that EBV BcRF1 encodes a TATA box binding protein (TBP)-homolog that preferentially recognizes the TATT box-containing promoters [26]. This prediction was subsequently confirmed experimentally; furthermore, deletion of BcRF1 from the EBV genome was found to inhibit late gene expression without impairing lytic DNA replication [27]. BcRF1 is one of 7 genes (BcRF1, BDLF3.5, BDLF4, BFRF2, BGLF3, BTRF1, and BVLF1) with homologs found in β- and γ- but not in α-herpesviruses (referred to as βγ genes hereafter). Interestingly, in both MHV-68 and HCMV, 5 out of 7 βγ genes, including the BcRF1 homologs, have been reported to produce the identical phenotype when deleted: 1) intact viral DNA synthesis; and 2) impaired late gene expression [28–35]. In EBV, two additional βγ gene knockout viruses deleted for BDLF4 and BFRF2 have been characterized and found to exhibit this specific defect in late gene expression [36,37]. Additionally, in reporter assays, 6 EBV βγ genes (all but BTRF1) were required together to activate a TATT-driven luciferase construct in EBV-negative 293 cells [37]. The requirement for BDLF3.5, BGLF3, BTRF1, and BVLF1 for late gene expression in the context of the viral genome is unknown.
The existence of a strict link between late gene transcription and the onset of viral DNA replication is observed among many DNA viruses. In herpesviruses, a critical unresolved question in understanding this link is whether an origin of lytic replication is required in cis with the late gene or if DNA replication in trans is sufficient to permit late gene expression. For example, in SV40, DNA replication in trans is sufficient to titrate transcriptional repressors that block late gene expression from the SV40 genome at early stages of replication [38]. In contrast, a requirement for an OriLyt in cis implies the parental genome is not competent for late gene transcription and that newly replicated DNA serves as the template for production of late gene mRNAs.
Attempts to resolve whether OriLyt is required in cis or in trans have met with conflicting results, in part because studies using plasmids do not always recapitulate effects in the context of whole viral genomes [39]. In the case of MHV-68, it was shown that a reporter plasmid containing a late promoter could not be activated unless OriLyt was present on the plasmid [25]. Studies in KSHV suggest that activation of KSHV K8.1 late promoter can be enhanced by the left-end viral origin of replication, OriLyt-L, largely in trans [24]. The requirement of OriLyt-mediated DNA replication in cis or in trans for late gene expression is also controversial in the EBV field. Using a transient late promoter-reporter system, Serio et al. showed that although activity of such reporters required EBV lytic replication occurring in the same cell, OriLyt-mediated DNA replication was not required in cis [22]. In contrast, Amon et al. demonstrated that robust late gene expression was detected in EBV-positive cell lines stably expressing late-promoter reporter plasmids only when EBV OriLyt was present on the reporters [40]. Finally, studies by Aubry et al. describe a viral pre-initiation complex (vPIC) encoded by 6 βγ genes (BcRF1, BDLF3.5, BDLF4, BFRF2, BGLF3, and BVLF1) that activates a TATT-containing promoter reporter plasmid lacking an OriLyt in EBV negative cells [37]. Thus, the requirement for OriLyt-mediated DNA replication for EBV late gene expression appears to depend upon the model system employed and has not been examined in the context of the intact EBV genome.
Here, we used EBV BACmids to analyze the role of each βγ gene in late gene expression. Using cell lines stably infected with EBV BACmids individually mutated for each βγ gene, we demonstrate that 6 out of 7 (BcRF1, BDLF3.5, BDLF4, BFRF2, BGLF3, and BVLF1) βγ genes are required for late gene expression from the virus, but dispensable for DNA replication. In reporter assays, βγ gene mediated activation of late-gene promoters required thymidine at the forth position of the non-canonical TATT sequence and, importantly, strictly required OriLyt-mediated DNA replication. Furthermore, using replication-defective EBV BACmids (lacking the single-stranded DNA binding protein BALF2 or OriLyt), we found that OriLyt-mediated DNA replication in cis, and not in trans, is a pre-requisite for EBV late gene expression. Finally, using fluorescence in situ hybridization and a visible EBV derivative, we demonstrate that the BcLF1 late mRNA localizes to the EBV replication factories. Our results are consistent with a model in which the viral pre-initiation complex encoded by 6 EBV βγ genes mediate late gene transcription from newly replicated viral DNA.
Results
Six of the seven EBV βγ genes are essential for late gene expression, but dispensable for early gene expression
To investigate the requirement of each of the 7 βγ genes for early and late gene expression, we derived 293 cell lines infected with EBV BACmids with one βγ gene mutated. We constructed the ΔBDLF3.5, ΔBGLF3, and ΔBTRF1 BACmids using the En Passant method [41,42] and obtained WT, ΔBcRF1 (MI-27), ΔBDLF4 (MI-84), ΔBFRF2 (MI-248) and ΔBVLF1 (MI-383) BACmids from a library of mutant EBV BACmids previously described [43]. Mutations were confirmed by sequencing of high fidelity PCR products from the appropriate region of each BACmid. Integrity of each BACmid was preliminarily assessed by restriction digestion using at least two enzymes (BamHI and EcoRI) and subsequently confirmed by trans-complementation (discussed below). 293 cells were infected with each EBV mutant BACmid, and several single-cell clones were selected for further validation. Each EBV Δβγ 293 line was induced for lytic replication by transfection with R and Z expression plasmids and trans-complemented with a plasmid expressing the missing βγ gene, where indicated. We found that 6 out of 7 βγ genes (BcRF1, BDLF3.5, BDLF4, BFRF2, BGLF3, and BVLF1) were required for expression of the minor capsid protein VCAp18 (product of the EBV BFRF3 late gene) at 72 hours post induction with R and Z (Fig 1A). In contrast, EBV BTRF1 was dispensable for VCAp18 expression (Fig 1B). None of the 7 βγ gene knockout genomes exhibited a defect in expressing the protein product of the BMRF1 early gene (Fig 1A and 1B). These results confirm and extend previous studies that demonstrated BcRF1, BFRF2, and BDLF4 share a common phenotype: defective late gene expression with intact early gene expression [27,36,37]. We have now shown that this same phenotype is shared by 3 other βγ genes: BDLF3.5, BGLF3, and BVLF1, but not by BTRF1, the last of the 7 genes conserved in all β- and γ-herpesviruses.
Fig 1. Six of the seven EBV βγ genes are essential for late gene expression.
A) Immunoblots showing expression of the early gene product BMRF1 and the late gene product VCAp18 in 293 cells stably infected with EBV genomes disrupted for the indicated βγ gene under the following conditions: uninduced (U), Induced for replication by transfection with R and Z expression plasmids (I), induced for replication plus trans-complemented by transfection of R, Z, and an HA-tagged expression plasmid for the appropriate βγ gene (I + t). βγ gene expression was confirmed by HA immunoblot (top panels). Whole-cell lysates were prepared from cells at 72 hours post transfection. B) Immunoblot for BMRF1 and VCAp18, as indicated, from 293 cells stably infected with EBV ΔBTRF1 that were either uninduced (U) or induced for EBV replication (I) by transfection of R and Z expression plasmids.
βγ genes are dispensable for viral DNA replication
Because late gene expression is dependent on lytic viral DNA replication, it was important to determine whether any of the βγ genes played a role in viral DNA replication. For these experiments, we induced each of the six EBV Δβγ 293 lines, which exhibited a defect in VCAp18 expression, for lytic replication by transfection of R and Z with or without βγ gene trans-complementation. We then measured EBV DNA (relative to cellular GAPDH) by qPCR. As demonstrated in Fig 2, a 100-fold or greater increase in EBV DNA was observed in the EBV ΔBcRF1, ΔBDLF3.5, ΔBDLF4, ΔBFRF2, ΔBGLF3, and ΔBVLF1 293 cells in response to R and Z expression. No further increase in EBV DNA was observed upon βγ trans-complementation, consistent with BcRF1, BDLF3.5, BDLF4, BFRF2, BGLF3, and BVLF1 playing no role in supporting EBV DNA replication. Our results are consistent with prior studies demonstrating that BALF2, BALF5, BBLF2/3, BBLF4, BMRF1, BSLF1, BKRF3, Z, R, and SM are sufficient to reconstitute EBV lytic DNA replication from a lytic origin in vitro [44,45]. Our results further demonstrate that none of the 6 βγ genes tested play a role in EBV lytic DNA replication that could account for their role in late gene expression.
Fig 2. The six EBV βγ genes essential for late gene expression are dispensable for EBV lytic DNA replication.
Bar plots indicating EBV DNA levels relative to cellular GADPH DNA in 293 cells stably infected with EBV BACmids disrupted for the indicated EBV βγ gene. For each cell line, genomic DNA was prepared from uninduced cells (U), cells induced by transfection with R and Z expression plasmids (I), and cells induced and trans-complemented by transfection with plasmids expressing R, Z, and the relevant βγ gene (I + t). DNA abundance was measured by qPCR using specific primers (see methods) and reported as the fold increase in the ratio of EBV/GAPDH DNA. Experiments were performed in triplicate and error bars correspond to the standard error of the mean (SEM) across the three biologic replicates.
An EBV OriLyt in cis is required for activation of a TATT-containing reporter
In order to determine whether lack of TATT promoter activation correlated with the late gene expression defect observed in our βγ gene knockout genomes, we constructed a reporter, pGL2-TATT similar to the one described by Gruffat et al. [27], in which the promoter of the late gene BcLF1 (containing the non-canonical TATT) drives expression of luciferase. A corresponding control reporter, pGL2-TATA, was constructed by mutation of the fourth T to an A, resulting in a conventional TATA box. We performed reporter assays, with these reporters, using 293 cells infected with an EBV genome defective for R expression (EBV R-stop [46]) that exhibits no spontaneous lytic replication in the absence of transfected R. In this model, we observed an approximately 40-fold activation of the pGL2-TATT reporter in response to R-induced EBV replication (Fig 3A) which decreased to about 15-fold upon addition of acyclovir. Unexpectedly, the control pGL2-TATA was also activated about 35-fold, suggesting much of the observed activation was TATT independent.
Fig 3. An EBV OriLyt in cis is required for activation of a TATT-containing reporter.
A) Luciferase assays showing relative fold activation of the TATT-containing EBV BcLF1 promoter (black bars) and its corresponding control reporter where a point mutation changes T at the fourth position to A, making a conventional TATA box (gray bars). For each condition, 293 R-stop cells were either uninduced, induced for lytic replication by transfection of R or induced for lytic replication by transfection of an R expression plasmid and also treated with the herpesvirus DNA polymerase inhibitor, acyclovir. Fold activation relative to uninduced value is reported, after normalization to renilla internal control. B) Luciferase assays showing relative fold activation of the TATT-containing EBV BcLF1 promoter in presence or absence of EBV minimal OriLyt in cis in each EBV Δβγ 293 cell line. For each condition, cells were either uninduced (U), induced by transfection of R and Z (I) or induced and trans-complemented by transfection of R, Z, and the relevant βγ expression plasmid (I + t). Relative fold activation is reported after normalization to renilla internal control and to the uninduced (U) values. C) Image of 293 EBV cells transfected with either pTATT-GFP-VCAp18 (left column) or pTATT-GFP-VCAp18-OriLyt (right column) either without induction of EBV replication (top row, U) or induced by transfection of R and Z (bottom row, I). Cells were scored for GFP at 60 hours post transfection.
We hypothesized that EBV OriLyt may be required for specific activation of TATT promoter. To test this possibility, we cloned the EBV OriLyt sequence downstream of the luciferase gene to generate pGL2-TATT-OriLyt. To evaluate the OriLyt requirement for βγ gene mediated activation of TATT-containing promoters, each EBV Δβγ 293 line was transfected with either the pGL2-TATT or pGL2-TATT-OriLyt reporter plasmids, and induced with R and Z with or without trans-complementation of the disrupted βγ gene. As shown in Fig 3B, the pGL2-TATT-OriLyt reporter was robustly induced (30–500 fold) in each cell line. Only weak activation of the pGL2-TATT plasmid was observed, typically at levels 1–10% of that observed for pGL2-TATT-OriLyt. Activation of the pGL2-TATT-OriLyt construct was strongly dependent on trans-complementation with the missing βγ gene in each cell line. Furthermore, because OriLyt-mediated DNA replication is unaffected by βγ gene trans-complementation (Fig 2), it is unlikely that the OriLyt dependence of the βγ gene activity is due solely to an increase in reporter copy number. Thus, 6 out of 7 EBV βγ genes (BcRF1, BDLF3.5, BDLF4, BFRF2, BGLF3, and BVLF1) contribute to activation of a TATT reporter plasmid and the presence of the EBV OriLyt is required for high-level activation.
We also examined the requirement for OriLyt from a different late promoter using the pTATT-GFP-VCAp18-OriLyt and pTATT-GFP-VCAp18 reporter plasmids which express a GFP-VCAp18 fusion protein from the native VCAp18 (BFRF3) promoter with or without the EBV OriLyt sequence cloned 3’ to the expression cassette, respectively. Both plasmids have an EBV OriP latent origin, permitting their maintenance as an episome in EBV-infected cells. Initially these reporters were transfected into EBV WT 293 cells with or without R and Z expression plasmids to induce lytic replication. Cells were subjected to microscopy at 24, 48, and 60 hours after transfection to test for expression of GFP-VCAp18. As shown in Fig 3C, GFP-VCAp18 expression was only observed at 60 hours post-induction when the transfected construct contained EBV OriLyt (bottom right panel). No GFP-positive cells were scored in uninduced cells or at 24 or 48 hours post lytic induction, consistent with the late kinetics of the BFRF3 promoter.
We further evaluated the requirements of βγ gene mediated late gene transcription by constructing an additional reporter, pTATA-GFP-VCAp18-OriLyt, in which the BFRF3 promoter TATT sequence was mutated to the canonical TATA. As shown in Fig 4, 293 cells infected with EBV ΔBcRF1 only expressed the GFP-VCAp18 fusion protein in cells induced for replication, when trans-complemented with a BcRF1 expression plasmid (I + t condition). Further, BcRF1-mediated transcription was not supported by reporters lacking OriLyt (middle panels) or bearing the TATT to TATA mutation (bottom panels). Results using 293 cells infected with EBV ΔBDLF3.5, EBV ΔBDLF4, EBV ΔBFRF2, EBV ΔBGLF3, and EBV ΔBVLF1 were similar: GFP-VCAp18 expression was only observed from the pTATT-GFP-VCAp18-OriLyt reporter and required induction of viral replication plus trans-complementation of the absent βγ gene. Collectively these results suggest that late gene promoter activation requires each of 6 βγ genes, the non-canonical TATT-box, and the EBV origin of lytic replication.
Fig 4. Loss of the TATT motif or OriLyt disrupts βγ gene dependent transcription.
Images of 293 cells infected with the indicated EBV βγ gene deletion mutant and transfected with either pTATT-GFP-VCAp18-OriLyt (top rows), pTATT-GFP-VCAp18 (middle rows) or pTATA-GFP-VCAp18-OriLyt (bottom rows) either induced (I) by transfection of R and Z (second, forth, and sixth columns) or induced and trans-complemented (I + t) by transfection of R, Z, and the relevant βγ expression plasmid (first, third, and fifth columns). Cells were scored for GFP at 60 hours post transfection.
Construction of an EBV mutant BACmid defective for lytic viral DNA replication
Because the EBV OriLyt functions as both a replication origin and a transcriptional enhancer, it was important to determine whether or not the requirement for OriLyt on the reporter reflected a need for the reporter plasmid DNA to be replicated in order to activate the TATT element. To assess this requirement for newly replicated DNA, we constructed a DNA replication-defective EBV BACmid by inserting a stop codon in place of the second amino acid codon of the BALF2 gene which encodes the single stranded DNA binding protein, an essential component of the viral DNA replication machinery. This BACmid had previously been modified by insertion of a sequence encoding an N-terminal HA epitope tag upstream of the BcRF1 gene and therefore was designated as EBV ΔBALF2/HA-BcRF1. 293 cells were stably infected with EBV ΔBALF2/HA-BcRF1, then induced with R and Z and trans-complemented with a plasmid expressing BALF2, where indicated. Cells were harvested 48 hours post induction and qPCR was performed with primers specific to EBV OriLyt and the cellular GAPDH. As shown in Fig 5A, when the BALF2 gene is mutated, viral DNA replication does not occur. This defect is rescued when BALF2 is expressed in trans. Immunoblotting revealed that EBV ΔBALF2/HA-BcRF1 239 cells express the BMRF1 early gene product in the absence of BALF2, but that expression of the VCAp18 late gene product is strictly dependent on BALF2 trans-complementation (Fig 5B). Furthermore, loss of BALF2 did not have an effect on relative βγ mRNA levels (S1 Fig). The replication-defective EBV ΔBALF2/HA-BcRF1 293 cells, therefore, provide an appropriate system for assessing the requirement of viral DNA synthesis for late gene expression, while bypassing the potential cytotoxic and/or off-target effects of the herpesvirus DNA polymerase inhibitor, acyclovir.
Fig 5. A BALF2 null EBV genome is defective for lytic DNA replication and late gene expression.
A) Bar plot indicating relative EBV DNA levels in 293 cells stably infected with the EBV ΔBALF2/HA-BcRF1 BACmid. Genomic DNA was prepared from uninduced cells (U), cells induced by transfection with R and Z expression plasmids (I), and cells induced and trans-complemented by transfection with R, Z, and BALF2 expression plasmids (I + t). DNA abundance was measured by qPCR using specific primers (see methods) and reported as the fold increase in the ratio of EBV/GAPDH DNA. Experiments were performed in triplicates and error bars correspond to the SEM across the three biologic replicates. B) Immunoblots showing expression of the early gene product BMRF1 and the late gene product VCAp18 in 293 cells stably infected with the EBV ΔBALF2/HA-BcRF1 BACmid under the following conditions: uninduced (U), Induced for replication by transfection of R and Z (I), induced for replication and trans-complemented by transfection of R, Z, and an HA-tagged BALF2 (I + t). BALF2 expression was confirmed by HA immunoblot (top panel). Whole cell lysates were prepared from cells at 72 hours post transfection.
Viral DNA replication is necessary for TATT promoter activation
To understand the role of viral DNA replication for late gene expression, we measured TATT promoter activity in 293 cells containing the replication-defective EBV BACmid described in Fig 5. EBV ΔBALF2/HA-BcRF1 293 cells were transfected with the pGL2-TATT and pGL2-TATT-OriLyt (containing the promoter of the late gene BcLF1) reporter plasmids and induced with R and Z in presence or absence of BALF2 trans-complementation. Cells were harvested 48 hours post lytic induction and reporter assays were performed. As shown in Fig 6A, the TATT promoter can only be robustly activated when the EBV OriLyt is present on the plasmid and viral DNA replication is rescued via BALF2 trans-complementation. This is consistent with the requirement of OriLyt-mediated viral DNA synthesis for TATT promoter activation.
Fig 6. EBV lytic DNA replication is necessary for TATT reporter activation.
A) Luciferase assay showing relative fold activation of the TATT-containing EBV BcLF1 promoter in presence or absence of EBV minimal OriLyt in cis in the replication defective EBV ΔBALF2/HA-BcRF1 293 cells. For each condition, cells were either uninduced (U), induced by transfection of R and Z (I) or induced and trans-complemented by transfection of R, Z, and BALF2 (I + t). Relative fold activation is reported after normalization to renilla internal control and to the uninduced (U) values. B) pTATT-GFP-VCAp18-OriLyt, expressing the fusion protein GFP-VCAp18 under control of the late VCAp18 promoter (i.e. BFRF3p) and containing EBV OriLyt was transfected in 293 cells containing EBV ΔBALF2/HA-BcRF1 genome. Cells were either uninduced (U), induced by transfection of R and Z (I) or induced and trans-complemented by transfection of R, Z and BALF2 (I + t). Cell were scored for GFP at 60 hours post transfection.
To further confirm the requirement of viral DNA synthesis for TATT activation and late gene expression, we examined expression from the pTATT-GFP-VCAp18-OriLyt reporter in the DNA replication-defective EBV ΔBALF2/HA-BcRF1 infected 293 cells. Cells were induced with R and Z, trans-complemented with a plasmid expressing BALF2 to rescue the replication defect where indicated, and assessed for GFP positivity at 24, 48, and 60 hours post induction by microscopy. GFP-positive cells were only observed at 60 hours when viral DNA replication was rescued by BALF2 trans-complementation (Fig 6B). No GFP-positive cells were observed at 24 or 48 hours post induction, consistent with late kinetics of GFP-VCAp18 expression. These observations are in accord with the hypotheses that OriLyt-mediated DNA replication from the pTATT-GFP-VCAp18-OriLyt reporter is required for GFP-VCAp18 expression to occur.
EBV TATT-driven late gene expression requires OriLyt in cis
Although we found a dependence on OriLyt-mediated DNA replication in two distinct reporter systems, it was important to determine if this was required for late gene expression in the context of the EBV genome. Therefore, we first deleted the remaining OriLyt from the EBV WT BACmid (one OriLyt is absent because the BACmid is derived from the B95.8 EBV strain) and established stable 293 cell lines. pTATT-GFP-VCAp18-OriLyt or pTATT-GFP-VCAp18 were transfected into 293 cells stably infected with EBV WT or EBV ΔOriLyt and the lytic cycle was induced by transfection of R and Z expression plasmids (Fig 7A). We then performed immunoblot assays to measure VCAp18 from the endogenous EBV genome or GFP-VCAp18 from the exogenous plasmid in the presence or absence of an OriLyt in cis. Cells were harvested 60 hours post induction and immunoblot assays were performed using antibodies against the early protein BMRF1 and the late protein VCAp18. VCAp18 signal from the endogenous EBV genome was detected in the context of WT EBV, but not with EBV ΔOriLyt genome even when OriLyt was present in trans on the pTATT-GFP-VCAp18-OriLyt plasmid (Fig 7B). Likewise, GFP-VCAp18 was expressed from pTATT-GFP-VCAp18-OriLyt but not from pTATT-GFP-VCAp18, even when an OriLyt was present on the WT EBV genome in trans. Thus, the late protein VCAp18 is only expressed when OriLyt is present in cis, but the early protein BMRF1 is expressed equally well in the presence or absence of OriLyt. Thus, we conclude that OriLyt-mediated DNA replication is specifically required in cis for EBV late gene expression from TATT promoters.
Fig 7. EBV OriLyt is required in cis for late gene expression in the context of the intact viral genome.
A) Schematic of the experiment shown in Fig 7B, in which 293 cells infected with either a wildtype EBV genome (EBV WT) or an EBV genome lacking an OriLyt (EBV ΔOriLyt) are transfected with either a plasmid that expresses a GFP-VCAp18 fusion protein under the control of the native VCAp18 promoter (i.e., BFRF3p) or an identical plasmid that also contains the EBV OriLyt. B) Immunoblots showing expression of the early gene product BMRF1 (bottom panels) and the late gene products GFP-VCAp18 (from plasmid) and VCAp18 (from EBV genome) (top panels) in presence or absence of EBV OriLyt on either the plasmid or the intact EBV genome. pTATT-GFP-VCAp18 or pTATT-GFP-VCAp18-OriLyt were transfected into cells stably infected with either EBV ΔOriLyt (left panels) or EBV WT (right panels) genomes. For each condition, cells were either uninduced or induced by transfection of R and Z expression plasmids. Immunoblots were performed at 60 hours post-transfection.
The BcLF1 late mRNAs co-localize exclusively with EBV DNA replication factories
It has been previously shown that EBV lytic DNA replication occurs in nuclear compartments or “factories” that are devoid of histones and cellular DNA [47]. The requirement for an OriLyt in cis suggests a functional link between these factories and late gene transcription. Using a previously described “visible” EBV derivative that contains 250 lacO binding sites and expresses a LacI-tdTomato fluorescent fusion protein, we identified DNA replication factories and sought to determine if they co-localized with late mRNAs. When cells were imaged at 36 hours, early DNA replication factories were observed in some cells (Fig 8A). In these cells, fluorescent in situ hybridization (FISH) for the early BALF2 mRNA revealed both a nuclear and cytoplasmic distribution. At 48 hours post-induction, EBV DNA replication factories were evident as large foci of red fluorescence (Fig 8B, Visible EBV panels). Detection of the BcLF1 mRNA at this time (Fig 8B, late mRNA panels) by FISH showed punctate staining that co-localized with sites of DNA replication (Fig 8B, merge). These results demonstrate that late mRNAs synthesis corresponds temporally and geographically with sites of productive EBV DNA synthesis.
Fig 8. Late gene mRNAs co-localize exclusively with sites of EBV DNA replication.
A) Fluorescent images of 293 cells infected with the “visible” EBV derivative at 36 hours post induction of replication. Early DNA replication factories are present in some cells (red), FISH for the early BALF2 mRNA (green) reveals punctate staining with both nuclear and cytoplasmic localization, and nuclei are visualized by DAPI staining (blue). B) Images of the same 293 cells infected with visible EBV are shown 48 hours post induction. EBV DNA replication factories are visible as discrete nuclear zones due to binding of the LacI-tdTomato fusions to EBV DNA (red), and FISH for the late BcLF1 mRNA (green) reveals punctate foci which co-localize with DNA replication factories (merge).
Discussion
A growing body of evidence supports the hypothesis that β- and γ-herpesviruses control late gene expression via a virus-encoded pre-initiation complex [26–37]. Here, we analyzed the phenotype of EBV mutants with disruptions in each of the seven genes with homologs in β- and γ-herpesviruses (βγ genes). We found that 6 of the 7 βγ genes are essential for expression of the EBV VCAp18 late gene product and dispensable for lytic DNA replication (Figs 1 and 2). These results are consistent with recently published reports assessing the roles of the BcRF1, BFRF2, and BDLF4 genes [27,36,37]. We extended these findings, demonstrating here that this phenotype is also true for three additional EBV βγ genes (BDLF3.5, BGLF3, and BVLF1), but not for the last EBV βγ gene, BTRF1. These same six proteins, when exogenously expressed in EBV-negative 293 cells, have been reported to form a viral pre-initiation complex that mediates transcription from the non-canonical TATT box found in late gene promoters [37]. Unexpectedly, using 293 cells infected with EBV genomes deleted for specific βγ genes, we found that βγ gene-mediated activation of a TATT reporter was weak and non-specific (relative to TATA) unless an EBV OriLyt was present on the reporter (Figs 3 and 4). Although the EBV OriLyt acts as both an enhancer and an origin of DNA replication, we demonstrated that the TATT-OriLyt reporter could not be activated in 293 cells infected with a replication defective EBV genome. Thus, lytic DNA replication is required for optimal EBV-mediated activation of the TATT reporter. We further demonstrated, using a combination of OriLyt deleted EBV genomes and plasmids, that an OriLyt in cis is essential for TATT-driven late gene expression (Fig 7). Finally, we demonstrated that the late BcLF1 mRNA exclusively localizes to the EBV replication factories; In contrast, the early BALF2 mRNA is more broadly distributed (Fig 8). Based on these results we propose a model where βγ gene products mediate recruitment of RNA polymerase II to transcribe EBV late genes from newly replicated viral DNA (illustrated in Fig 9).
Fig 9. Model for EBV late gene expression from the newly replicated DNA.
Model indicating transcription of late genes from the newly replicated viral DNA via six gene products conserved in β- and γ-herpesviruses (βγ genes). BcRF1, the EBV TATT-binding protein, directly binds the non-canonical TATT sequence found in the late gene promoters. According to this model, the parental EBV DNA is not suitable for binding of the viral pre-initiation complex encoded by the βγ genes and thus, late genes cannot be expressed from replication-defective genomes.
In an effort to most closely model EBV late gene expression, our experiments presented here were performed in cells infected with EBV WT or EBV mutant genomes. This approach offers multiple advantages over reporter assays in EBV-negative cells. First, EBV lytic gene products required for late gene expression are expressed under the control of the native promoters assuring proper temporal kinetics and levels of expression. Additionally, because the extent to which βγ gene products are modulated by other EBV lytic proteins (e.g., the BGLF4 kinase) remains to be determined, it is preferable to study their role in the presence of the EBV genome. Finally, late gene expression via βγ gene products has been compared to the T4 bacteriophage late gene regulation [34]. It is interesting to note that for T4, DNA nicks bypass the dependence of late gene expression on DNA replication [48]. If this holds true for EBV, one would expect the apparent requirement for OriLyt in reporter assays to be strongly influenced by the transfection conditions and the integrity of the reporter plasmid. For these reasons, we have endeavored to make or confirm all the observations reported here in EBV infected cells with plasmids that can be maintained extrachromosomally.
Why would an OriLyt in cis be required for late gene mediated transcriptional activation? The full EBV OriLyt is both a strong enhancer and a DNA replication origin. Indeed, transcriptional activation and the subsequent formation of RNA-DNA hybrids at OriLyt appear to be essential for initiation of lytic DNA replication in γ-herpesviruses (as well as cytomegalovirus) which lack dedicated origin binding proteins [49,50]. Because a minimal OriLyt exhibiting 1% of the DNA replication activity of full OriLyt supports late gene expression [40], it has been suggested that other mechanisms such as OriLyt dependent PML body association may be important [51]. Our results do not exclude these additional mechanisms; however, our ΔBALF2 experiment (Fig 6) and the ability of viral DNA polymerase inhibitors to block late gene expression argue that the requirement for OriLyt includes its DNA replication function. Further, we believe the linkage of βγ mediated late gene transcription to the requirement for an OriLyt in cis, strongly implies that the parental EBV genome is not competent for late gene transcription until it has been replicated.
In EBV, the viral replication machinery consisting of the BALF5 DNA polymerase, BMRF1 DNA polymerase processivity factor, BALF2 single-stranded DNA binding protein, and the BBLF4-BSLF1-BBLF2/3 helicase-primase complex replicate the EBV genome during productive infection in discrete nuclear sites called factories. Replication factories form as a consequence of a dramatic rearrangement in nuclear architecture, in which the cell DNA moves to the nuclear periphery and the nucleus becomes dominated by the expanding replication factory. These factories are characterized by the presence of newly synthesized viral DNA and the EBV DNA polymerase and its processivity factor, BALF5 and BMRF1 respectively, but are devoid of cellular DNA, histones, and PCNA [47]. Other investigators have used BMRF1 immunofluorescence to define EBV replication factories as BMRF1 cores [52,53] that lend additional support to our model that late gene mRNAs are transcribed from newly replicated viral DNA. Using pulse-chase experiments, Sugimoto et al. demonstrated that newly synthesized viral genomes organized around the BMRF1 cores were transferred inward, leaving the parental template outside the BMRF1 cores [53]. Using a “visible” EBV derivative, we demonstrated that the BcLF1 late mRNA co-localizes exclusively with DNA replication factories, in contrast the BALF2 early mRNA which was predominantly cytoplasmic at the time points studied and often identified in cells that had not formed DNA replication factories. Interestingly, BcRF1, the EBV TATT-binding protein, is primarily localized inside the BMRF1 cores where newly replicated DNA is localized [54], and therefore is well positioned to interact with newly synthesized viral DNA. Although not definitively demonstrated, these findings collectively suggest that EBV, and by analogy other β- and γ- herpesviruses, employ a set of evolutionary conserved proteins to mediate transcription of late genes from the newly replicated DNA template.
Although the dependence of late gene expression on viral DNA replication is observed in all herpesviruses, our work adds to an increasing body of evidence that β- and γ- herpesviruses regulate their late genes by a distinct mechanism. α-herpesvirus late genes are similar to β- and γ-herpesvirus late genes in that their expression is controlled by a short proximal TATA box [55], but differ in that this sequence neither appears to be similar to the unconventional TATT box found in β- and γ-herpesviruses, nor is it recognized by unique virally encoded trans-acting factors. In herpes simplex virus (HSV), a limited number of genes such as ICP4, ICP8 and ICP27 have been implicated [56–64], but their disruption impairs other stages of HSV replication as well as late gene expression. The preponderance of evidence suggests that β- and γ-herpesviruses encode six conserved gene products that mediate late gene expression by recruiting RNA polymerase II to TATT elements in late gene promoters. Our demonstration that OriLyt is required in cis is particularly appealing as it further explains the dependence of late gene expression on lytic DNA replication. That α-herpesviruses recapitulate this phenotype with a mechanistically distinct regulatory apparatus suggests that strong convergent evolutionary pressure exists to regulate late gene expression in a DNA replication-dependent fashion.
What are the potential evolutionary advantages of a viral pre-initiation complex linking late gene expression to DNA replication? One possibility is that such a system provides direct means for expressing structural protein mRNAs in direct proportion to the quantity of replicated viral DNA available for packaging. Such a system may also contribute to viral immune evasion by ensuring that regardless of the transcription factor milieu of the infected cell, a large number of potential antigens cannot be expressed unless the virus has committed to replicating its DNA. In a similar vein, by obviating the need for cell transcription factors to promote late gene expression, there is less potential for interference or cross-talk among viral lytic promoters. Given the propensity of α-herpesviruses to establish latency in neurons, it is tempting to speculate that some or all of these advantages facilitated the success of β- and γ-herpesviruses in establishing latency in cells with potential for dynamic changes in transcriptional regulation such as lymphocytes and hematopoietic stem cells.
If indeed β- and γ-herpesviruses direct RNA polymerase II to transcribe newly replicated DNA, it raises many interesting questions since mRNA transcription is normally suppressed during DNA replication. It is likely that the βγ pre-initiation complex must overcome a number of cellular checkpoints designed to prevent such transcription. Because nascent viral DNA is thought to be devoid of histones [47], proteins that bind specific histone modifications would need to be recruited by other means. Some progress has been made in mapping the protein-protein interactions that allow the βγ gene products to assemble into a pre-initiation complex [65,66]. At present, we only understand the specific role of one of these βγ genes, the TBP homolog-encoded BcRF1. The BDLF4 gene product and its paralogs are notable for a probable zinc coordination motif (Cys-X2-Cys-X3-His-X-Cys-X5,6-Cys-X10-Cys) in their N-termini that could mediate DNA or protein interactions. It will be important to determine the functions of the remaining βγ gene products and understand how they act to permit transcription from this atypical DNA template.
Materials and Methods
Cell lines and culture
All cell lines were maintained in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. EBV-negative 293 cell lines were obtained from Bill Sugden, University of Wisconsin-Madison. 293 cells infected with the EBV R-stop mutant (a gift from Shannon Kenney, University of Wisconsin-Madison) have been previously described [46].
Construction of EBV mutant genomes
The EBV p2089 BACmid contains the complete genome of the B95.8 strain of EBV in addition to a cassette containing the prokaryotic F-factor as well as the green fluorescent protein (GFP) and Hygromycin B resistance genes in the B95.8 deletion as previously described [67]. The EBV Wild-Type (WT) BACmid used in these studies is a modification of the p2089 BACmid lacking a functional GFP ORF. The WT, ΔBcRF1 (MI-27), ΔBDLF4 (MI-84), ΔBFRF2 (MI-248), and ΔBVLF1 (MI-383) BACmids (Ya-Fang Chiu at the laboratory of Shih-Tung Liu) were part of a comprehensive library of mutant EBV genomes and have been previously described [43]. This same WT GFP-negative p2089 BACmid is the parental BACmid to all mutants in this study. All remaining mutant BACmids were constructed using the GS1783 E. coli–based En Passant method previously described [41,42]. ΔBALF2/HA-BcRF1 BACmid is a double-mutant, in which the BcRF1 gene is N-terminally tagged with HA and the gene encoding the single-stranded DNA binding protein BALF2 is disrupted by a single nucleotide mutation changing the second amino acid residue in the BALF2 ORF to a stop codon. Similarly, ΔBDLF3.5 and ΔBGLF3 BACmids were constructed by introducing stop codons via point mutations in place of the amino acid residues 9 and 6 respectively. The ΔBTRF1 BACmid was constructed by introducing stop codons at amino acid residues 6 and 8, in addition to insertion of a Kanamycin resistance gene in the BTRF1 ORF (between coordinates 127,460 and 127,461; AJ507799.2). The ΔOriLyt BACmid was constructed by replacing the EBV OriLyt (coordinates 37,978–42,663; AJ507799.2) with a Kanamycin resistance gene. Finally, the Chloramphenicol cassette in the F-factor of each WT, ΔBALF2/HA-BcRF1, ΔBDLF3.5, ΔBGLF3 BACmids was replaced with Kanamycin. Kanamycin resistance facilitated the transfer of all BACmids to the chloramphenicol-resistant BM2710 E. coli used for infection of 293 cells. The integrity of all BACmids was confirmed by analyzing the restriction digestion patterns with multiple enzymes. Furthermore, all mutations were confirmed by high fidelity PCR amplification and sequencing the mutated junctions. The comprehensive list of primers used for generation and confirmation of all mutants is found in Tables 1 and 2 respectively.
Table 1. Primers used for construction of EBV mutant BACmids.
| Primer Name | Sequence | Purpose |
|---|---|---|
| ΔBALF2-Fwd | TGTGGGACTGGGAGGCCGGGGCGATACCTTGGGCATCATGTAGGGTGCACTGACTAGCGAGGATAATCTGGAGGATGACGACGATAAGTAGGG | ΔBALF2/HA-BcRF1 |
| ΔBALF2-Rev | ACCCGGCTGGCTCTGGCTGCCCAGATTATCCTCGCTAGTCAGTGCACCCTACATGATGCCCAAGGTATCGCCAACCAATTAACCAATTCTGATTAG | ΔBALF2/HA-BcRF1 |
| HA-BcRF1-Fwd | GGGGAAGGGTCTGTTTTCCACACCCTCATTTGAGGCCATGACATATCCATATGACGTTCCAGATTACGCTACACAAGGAGGATGACGACGATAAGTAGGG | ΔBALF2/HA-BcRF1 |
| HA-BcRF1-Rev | AGAAGCCCTCGAGACCTCCCCCCATCTCCCTCTTACCTTGTGTAGCGTAATCTGGAACGTCATATGGATATGTCATGGCAACCAATTAACCAATTCTGATTAG | ΔBALF2/HA-BcRF1 |
| ΔBDLF3.5-Fwd | ACAAACAAGAGGTGAAATGTCTGCCCCCGGATGCTCTGAATGACTGAATAAGAAGCGAGGCACTAGGATGACGACGATAAGTAGGG | ΔBDLF3.5 |
| ΔBDLF3.5-Rev | TCTCCAAATTCTCTCTCCCCAATAGTGCCTCGCTTCTTATTCAGTCATTCAGAGCATCCGGGGGCAACCAATTAACCAATTCTGATTAG | ΔBDLF3.5 |
| ΔBGLF3-Fwd | TCGGTCAGACGGCCGCGCTGCGAGGCATACAGCATGTTCATAGCTGACTAGGCCGATATGCCCGAAGGATGACGACGATAAGTAGGG | ΔBGLF3 |
| ΔBGLF3-Rev | TACCTGCGGGCGAGCATCGGGTCATCGGGCATATCGGCCTAGTCAGCTATGAACATGCTGTATGCCAACCAATTAACCAATTCTGATTAG | ΔBGLF3 |
| ΔBTRF1-Fwd | AAGACAGCCCCCATCCACTGCCGTGATGCTCAAGTGTAAGTAGCCCTGAGCCCGCTTCATTCACGGGGCTAGGGATAACAGGGTAATCGATTT | ΔBTRF1 |
| ΔBTRF1-Rev | GTCCCGATGGCAGGTGCACGGCCCCGTGAATGAAGCGGGCTCAGGGCTACTTACACTTGAGCATCACGGGCCAGTGTTACAACCAATTAACC | ΔBTRF1 |
| ΔOriLyt-Fwd | CACTCCTATGCATTTCCTGCCCTCCCACTTTTACCCCAGTTCTATACATTTTCTCAGCACTAGGGATAACAGGGTAATCGATTT | ΔOriLyt |
| ΔOriLyt-Rev | ATGACCCTGATTCATATAAAGTGCTGAGAAAATGTATAGAACTGGGGTAAAAGTGGGAGGGCCAGTGTTACAACCAATTAACC | ΔOriLyt |
| Cam-Ff-Kan-Fwd | CGGGCGTATTTTTTGAGTTATCGAGATTTTCAGGAGCTAAGGAAGCTAAAATGAGCCATATTCAACGGGAAAC | Swaps Chloramphenicol with Kanamycin in F-factor |
| Cam-Ff-Kan-Rev | CAGGCGTAGCAACCAGGCGTTTAAGGGCACCAATAACTGCCTTAAAAAAATTAGAAAAACTCATCGAGCATC | Swaps Chloramphenicol with Kanamycin in F-factor |
Table 2. Primers used for confirmation/sequencing of EBV mutant BACmids.
| Primer Name | Sequence | Purpose |
|---|---|---|
| ΔBALF2chk-Fwd | CCTTGAAGGCCTCGGTTATT | ΔBALF2/HA-BcRF1 |
| ΔBALF2chk-Rev | GTACAACGACCACTACGACTAC | ΔBALF2/HA-BcRF1 |
| HA-BcRF1chk-Fwd | CACACTCAGGACGGTGTTAAT | ΔBALF2/HA-BcRF1 |
| HA-BcRF1chk-Rev | GAGACAAGTAGCGGATGATAAGG | ΔBALF2/HA-BcRF1 |
| ΔBDLF3.5chk-Fwd | CTGTGTGTCTTGTCGGATCTC | ΔBDLF3.5 |
| ΔBDLF3.5chk-Rev | CCAGAAAGAGGTTGGTGGTT | ΔBDLF3.5 |
| ΔBGLF3chk-Fwd | GTTTGGGAGTGGGCCAATA | ΔBGLF3 |
| ΔBGLF3chk-Rev | GGACACGCTGGTCTTGAAT | ΔBGLF3 |
| ΔBTRF1-Fwd | CGAGGGCCTGTTTGATTTCT | ΔBTRF1 |
| ΔBTRF1-Rev | CATAAGTTGCGAGGAGGCTTTA | ΔBTRF1 |
| ΔOriLyt-Fwd | AGGTTTAGCTATTCCACCAACA | ΔOriLyt |
| ΔOriLyt-Rev | CGGGTCATTGGCATGTTATTC | ΔOriLyt |
Derivation of wild-type and mutant EBV-positive 293 cell lines
EBV-positive 293 WT, ΔBALF2/HA-BcRF1, ΔBcRF1, ΔBDLF3.5, ΔBDLF4, ΔBFRF2, ΔBGLF3, ΔBTRF1, ΔBVLF1, and ΔOriLyt were derived using the BM2710 E. coli, which can mediate the transfer of intact recombinant DNA into mammalian cells due to expression of the invasin gene from Yersinia pseudotuberculosis and the listeriolysin O gene from Listeria monocytogenes [68]. Briefly, BACmids were electroporated using a 0.1 cm gap cuvette (1.5 kV, 200 Ohms, 25 μF) into BM2710 E. coli and selected with Kanamycin. BM2710 E. coli containing the respective BACmid were used to infect EBV-negative 293 cells by co-incubation for 2 hours (approximately 25 bacteria per cell). Cell lines were derived by single-cell cloning and, when possible, screened for ability to complete the lytic cascade by immunoblotting for viral late protein VCAp18 after the mutated gene was supplied in trans. EBV-positive 293 cells were selected and maintained with 200 μg/ml of Hygromycin B. Viral DNA synthesis was blocked with 100 μg/ml of acyclovir where indicated.
Plasmids
pcDNA3-Rta, and pSG5-Zta (or pSVNaeZ) have been described previously [69,70]. pGK-Renilla, pMSCV-F-HA-BDLF4, pMSCV-F-HA-BGLF3, and pMSCV-F-HA-BTRF1 have been previously described [71]. pcDNA3-HA(2x)-BVLF1 was constructed by gateway cloning using pDONR223-BVLF1 and pN-2xHA [69]. pcDNA3-HA-BcRF1 was cloned by amplifying BcRF1 from the EBV genome using primers 5’-CGCGGGTACCGCCACCATGTATCCATATGACGTTCCAGATTACGCTACACAAGGTAAGAGGGAGATG-3’ and 5’-CGCGGAATTCTTACACTTGAGCATCACGGC-3’ and cloning into EcoRI/Acc65I sites of the pcDNA3-HA-SUMO1 vector (Addgene plasmid #21154). pcDNA3-HA-BFRF2 was cloned by amplifying BFRF2 from the EBV genome using primers 5’-CGCGTGTACAGCCACCATGTATCCATATGACGTTCCAGATTACGCTGCGTTATTCTTGGCGCGCCAC-3’ and 5’-CGCGGAATTCTTAGGAAGCAGGGGACTGTCTGGAAAATC-3’ and cloning into EcoRI/Acc65I sites of the pcDNA3-HA-SUMO1 vector (Addgene plasmid #21154). pSG5-HA-BDLF3.5 was cloned by amplifying BDLF3.5 from the EBV genome using primers 5’- CGCGGAATTCATGTATCCATATGACGTTCCAGATTACGCTTCTGCCCCCGGATGCTCTGAAAG-3’ and 5’-CGCGGGATCCTCAATCGGCCTTGGTCTGAC-3’ and cloning into EcoRI/BamHI sites of the pSG5 vector (Invitrogen). pSG5-BGLF3 was cloned by amplifying BGLF3 from the EBV genome using primers 5’-CGCGGAATTCATGTTCAACGCGGTCAAGGCCG-3’ and 5’- CGCGGGATCCCTACTCATCTTCATAAGTCAC-3’ and cloning into EcoRI/BamHI sites of the pSG5 vector. pSG5-HA-BALF2 was cloned by amplifying the BALF2 from EBV genome using primers 5’-CGCGGAATTCATGTATCCATATGACGTTCCAGATTACGCTCAGGGTGCACAGACTAGCGAGG-3’ and 5’-CGCGGGATCCCTAGACCTCGAGTCCGGGGAG-3’ and cloning into EcoRI/BamHI sites of the pSG5 vector. pGL2-TATT was cloned by annealing the oligos 5’- CCGGGTATTAAACCGGGTGGCAGCTCCTGGCAGTCATTCAC-3’ and 5’- TCGAGTGAATGACTGCCAGGAGCTGCCACCCGGTTTAATAC-3’ and cloning into XmaI/XhoI sites of the pGL2-Basic vector. pGL2-TATA is identical to pGL2-TATT except with a point mutation changing the T at the fourth position in the TATT sequence to an A and was constructed by annealing the oligos 5’-CCGGGTATAAAACCGGGTGGCAGCTCCTGGCAGTCATTCAC-3’ and 5’-TCGAGTGAATGACTGCCAGGAGCTGCCACCCGGTTTTATAC-3’ and cloning into XmaI/XhoI sites of the pGL2-Basic vector. pGL2-TATT-OriLyt is similar to pGL2-TATT with addition of EBV minimal OriLyt downstream of the Luciferase gene and was constructed first by annealing the oligos 5’-TAGTCGAGCTCAGGAGAATTCATTGATGCATG-3’ and 5’-TCGACATGCATCAATGAATTCTCCTGAGCTCGACTA-3’ into SalI/PshAI sites of pGL2-TATT to create a multiple cloning site followed by cloning the minimal OriLyt DNA fragment cut with NsiI/SacI from the B95.8 BamHI-H fragment into the resulting plasmid. pTATT-GFP-VCAp18-OriLyt, which contains EBV full OriLyt and GFP-VCAp18 under its native promoter was constructed as follows: The BFRF3 gene was amplified with the primer pair 5'-ATCGGAATTCATGGCACGCCGGCTGC-3' and 5'-ATGCTACTCGAGCTGTTTCTTACGTGCCCCGCGTGG 3’, inserted into the EcoRI/SalI sites of pEGFP-C2 (Clontech) after digestion with EcoRI and XhoI to generate pEGFP-VCAp18. The BFRF3 promoter was amplified with the primer pair 5’-GAATGCATTAATGTTATTCTTGGCGCGCCACACCT 3’ and 5’-ATCGCAGCTAGCAACGCGTCTGATAGAGACGGCAGC 3’, digested with AseI and NheI, and inserted into the AseI/NheI site of pEGFP-VCAp18 to replace the CMV promoter and generate pBFRF3p-gfpBFRF3. The DNA fragment encoding BFRF3 promoter and GFP-VCAp18 fusion was isolated from pBFRF3p-gfpBFRF3 with AseI and SspI, blunt-ended using Klenow, and inserted into the Klenow-filled HindII site of p562 [20] to generate pTATT-GFP-VCAp18-OriLyt, in which the BFRF3 promoter drives the expression of GFP-VCAp18 fusion towards the replication origin, OriLyt, for EBV's lytic genome amplification. pTATT-GFP-VCAp18 is a modification of pTATT-GFP-VCAp18-OriLyt without the full OriLyt fragment and was constructed by cutting pTATT-GFP-VCAp18-OriLyt with SfiI/SalI followed by Klenow treatment and unimolecular ligation. In order to create pTATA-GFP-VCAp18, a 222 bp and a 964 bp fragment were PCR amplified from the pTATT-GFP-VCAp18 using the primers (p4222-Blp-side-F: 5’-GCGGCGGTGGGCTGCCAGAG-3’; p4222-TATA-R: 5’-CCGCAAAGTTAT ATACAGGAGCTGCCTGACC-3’) and (p4222-TATA-F: 5’-CAGCTCCTGTAT ATAACTTTGCGGACAGAGGC-3’; p4222-Xho-side-R: 5’-AGCCGGCGTGCCATGAATTC-3’) respectively and the pTATA-GFP-VCAp18 was constructed via Gibson Assembly (New England Biolabs) using the two PCR products and the original pTATT-GFP-VCAp18 vector backbone (cut with BlpI and XhoI). The integrity of the final plasmid was initially confirmed by restriction digestion with multiple enzymes (including MseI, which cleaves the sequence 5’-…T|TAA…-3’ distinguishing between TATA and TATT) and subsequently sequencing of the appropriate junctions.
Immunoblotting
Total cell lysates were harvested in Laemmli Buffer and separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to nitrocellulose membrane. Membranes were blocked in Tris-buffered saline (TBS) containing 5% milk and 0.1% Tween 20 and incubated with appropriate primary antibodies overnight at 4°C. The following primary antibodies were used: anti-EBV EA-D p52/50 (EMD Millipore, MAB8186; 1:3,000), anti-EBV VCA-p18 (Thermo Scientific, PA1-73003; 1:1,000), anti-EBV Zta (Santa Cruz Biotechnology, sc-53904; 1:250), anti-EBV Rta (Thermo Scientific, custom antibody described here [72]; 1:1000), anti-HA (Covance, MMS-101P; 1:1,000), and anti-α-tubulin (Sigma, T6074; 1:1,000). Following treatment with primary antibodies, membranes were washed with TBS containing 0.1% tween and incubated with appropriate secondary antibodies for 1 hour at room temperature. The following secondary antibodies were used: goat anti-mouse poly-HRP (Fisher Scientific), goat anti-rabbit poly-HRP (Fisher Scientific), and donkey anti-goat (Fisher Scientific). Membranes were washed again and visualized on film using ECL chemiluminescent kit (Thermo Scientific) according to manufacturer’s protocol.
Reporter assays
Cells were transfected in 12-well plates with 0.25 μg of reporter plasmid, 0.25 μg of trans-complementing plasmid where indicated, 0.02–0.125 μg of R and Z expression plasmid, and 0.025 μg of a plasmid expressing renilla luciferase (as a control) using Lipofectamine 2000 (Invitrogen) according to manufacturer’s protocol. After 48 hours, cells were lysed in passive lysis buffer (Promega) for 15 minutes at room temperature on a rocking platform and clarified by centrifugation. Firefly and renilla luciferase values were measured using the dual-luciferase reporter assay kit (Promega) on a BD Monolight 3010 luminometer (BD Biosciences).
Quantification of viral DNA copy number by real-time (RT) PCR
EBV-positive 293 cells were induced in 12-well plates using 125 ng each of R and Z expression plasmids along with 250 ng of the trans-complementing plasmid. 48 hours post lytic induction, cells were washed with phosphate-buffered saline (PBS), and genomic DNA was extracted using GeneJET genomic DNA purification kit (Thermo Scientific) according to manufacturer’s protocol. Purified DNA was subjected to qRT-PCR with a 7900HT Fast Real-Time PCR system (Applied Biosciences) using SYBR Green Real-Time PCR Master Mix (Biorad) with primers specific to EBV OriLyt (5’-TCGCCTTCTTTTATCCTCTTTTTG-3’ and 5’-CCCAACGGGCTAAAATGACA-3’) and GAPDH (5’-CTCCCGCTTCGCTCTCT-3’ and 5’-TTTCTCTCCGCCCGTCTT-3’). All values were normalized to GAPDH using the 2-ΔΔC T method described previously [73].
Single-molecule RNA fluorescence in situ hybridization
RNA fluorescence in situ hybridization (FISH) was performed following manufacturer’s protocol (LGC Bioresearch Technologies). The probes employed are single-stranded DNA oligos (20 nucleotides), each labeled with the fluorophore Quasar 670 and were designed using online Stellaris probe designer provided by manufacturer (LGC Bioresearch Technologies). i293 Visible EBV cells [47] were plated on coverslips and grown overnight at 37°C. Replication was induced by addition of 200nM 4-hydroxytamoxifen and LacI-tdTomato binding to the EBV genome induced by IPTG withdrawal. At 36–48 hours post-induction, cells were washed once with PBS and fixed with 3.7% formaldehyde/PBS solution for 10 minutes at room temperature. Next, cells were washed twice with PBS and subsequently permeabilized with 70% ethanol at 4°C, overnight. The cells were then washed with Wash Buffer A (LGC Bioresearch Technologies) at room temperature for 5 minutes before hybridization. To detect viral RNAs, 125 nM of labeled probes in 100 μl of Hybridization Buffer (LGC Bioresearch Technologies) was used for each sample. Hybridization was carried out in humidified chambers maintained at 37°C for 16 hours. The samples were then washed twice with Wash Buffer A at 37°C for 30 minutes, and once with Wash Buffer B (LGC Bioresearch Technologies) at room temperature for 5 minutes. Nuclear staining was performed using Vectashield Antifade mounting medium with DAPI (Vector Laboratory Inc.). The distributions of EBV mRNAs and amplified genomes in the lytic cycle were imaged with a Zeiss Apotome microscope.
RNA isolation, reverse transcription and quantification by real-time (RT) PCR
EBV-positive 293 cells were induced in 12-well plates using 125 ng each of R and Z expression plasmids along with 250 ng of the trans-complementing plasmid. 48 hours post lytic induction, cells were washed with phosphate-buffered saline (PBS), and RNA was extracted using GeneJET RNA purification kit (Thermo Scientific) according to manufacturer’s protocol with the following modification: after lysis and before loading on column, lysates was passed through a QIAshredder cell and tissue homogenizer (Qiagen). The eluted RNA was then treated with DNase (1 unit/μg DNA), DNase was deactivated by incubation at 65°C and the treated RNA (~ 1 μg) was reverse transcribed using the ImProm-II Reverse Transcription System (Promega). Purified cDNA was subjected to qRT-PCR with a 7900HT Fast Real-Time PCR system (Applied Biosciences) using SYBR Green Real-Time PCR Master Mix (Biorad). The primers used to detect various EBV transcripts and β-Actin are listed in S1 Table.
Supporting Information
Bar plots showing mRNA levels of six βγ genes (BcRF1, BDLF3.5, BDLF4, BGLF3, BFRF2, and BVLF1) relative to β-Actin in 293 EBV ΔBALF2/HA-BcRF1 cells that were uninduced (U), induced (I) by transfection with R and Z expression plasmids, or induced and trans-complemented by transfection with plasmid expressing R, Z, and BALF2 (I + t) at 48 hours post induction. Transcripts for six βγ genes are detected in the induced condition (I, middle bar) and were not significantly increased by trans-complementation with BALF2 (I + t).
(TIF)
(PDF)
Acknowledgments
We thank Drs. Bill Sugden, Shannon Kenney, Janet Mertz, Robert Kalejta and members of their laboratories for helpful suggestions and discussions. We are indebted to Dr. Shih-Tung Liu for the generous gift of multiple EBV BACmid clones.
Data Availability
All relevant data are within the paper and its Supporting Information files.
Funding Statement
This work was supported by the National Institute of Dental and Craniofacial Research (http://www.nih.gov/) grant R01-DE023939 to EJ, National Cancer Institute (http://www.nih.gov/) grant P01-CA022443 to EJ, and the National Institute of Allergy and Infectious Diseases (http://www.nih.gov/) grant T32-AI078985 to RD. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Rickinson AB, Kieff E. Epstein-Barr virus Fields Virology. 5th ed. Philadelphia: Wolters Kluwer Health/Lippincott Williams & Wilkins; 2007. pp. 2655–2700. [Google Scholar]
- 2. Henle W. Role of Epstein-Barr virus in infectious mononucleosis and malignant lymphomas in man. Fed Proc. 1972;31: 1674 [PubMed] [Google Scholar]
- 3. Thorley-Lawson DA, Allday MJ. The curious case of the tumour virus: 50 years of Burkitt’s lymphoma. Nat Rev Microbiol. 2008;6: 913–924. 10.1038/nrmicro2015 [DOI] [PubMed] [Google Scholar]
- 4. zur Hausen H, Schulte-Holthausen H, Klein G, Henle W, Henle G, Clifford P, et al. EBV DNA in biopsies of Burkitt tumours and anaplastic carcinomas of the nasopharynx. Nature. 1970;228: 1056–1058. [DOI] [PubMed] [Google Scholar]
- 5. Kutok JL, Wang F. Spectrum of Epstein-Barr virus-associated diseases. Annu Rev Pathol. 2006;1: 375–404. 10.1146/annurev.pathol.1.110304.100209 [DOI] [PubMed] [Google Scholar]
- 6. Thompson MP, Kurzrock R. Epstein-Barr virus and cancer. Clin Cancer Res Off J Am Assoc Cancer Res. 2004;10: 803–821. [DOI] [PubMed] [Google Scholar]
- 7. Hong GK, Gulley ML, Feng W-H, Delecluse H-J, Holley-Guthrie E, Kenney SC. Epstein-Barr virus lytic infection contributes to lymphoproliferative disease in a SCID mouse model. J Virol. 2005;79: 13993–14003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Jochum S, Moosmann A, Lang S, Hammerschmidt W, Zeidler R. The EBV immunoevasins vIL-10 and BNLF2a protect newly infected B cells from immune recognition and elimination. PLoS Pathog. 2012;8: e1002704 10.1371/journal.ppat.1002704 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Altmann M, Hammerschmidt W. Epstein-Barr virus provides a new paradigm: a requirement for the immediate inhibition of apoptosis. PLoS Biol. 2005;3: e404 10.1371/journal.pbio.0030404 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Thorley-Lawson DA, Hawkins JB, Tracy SI, Shapiro M. The pathogenesis of Epstein-Barr virus persistent infection. Curr Opin Virol. 2013;3: 227–232. 10.1016/j.coviro.2013.04.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Israel B, Kenney S. EBV lytic infection. In: Robertson E, editor. Epstein-Barr virus. Philadelphia: Caister Academic Press; 2005. pp. 571–611. [Google Scholar]
- 12. Chevallier-Greco A, Manet E, Chavrier P, Mosnier C, Daillie J, Sergeant A. Both Epstein-Barr virus (EBV)-encoded trans-acting factors, EB1 and EB2, are required to activate transcription from an EBV early promoter. EMBO J. 1986;5: 3243–3249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Countryman J, Miller G. Activation of expression of latent Epstein-Barr herpesvirus after gene transfer with a small cloned subfragment of heterogeneous viral DNA. Proc Natl Acad Sci U S A. 1985;82: 4085–4089. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Takada K, Shimizu N, Sakuma S, Ono Y. trans activation of the latent Epstein-Barr virus (EBV) genome after transfection of the EBV DNA fragment. J Virol. 1986;57: 1016–1022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Zalani S, Holley-Guthrie E, Kenney S. Epstein-Barr viral latency is disrupted by the immediate-early BRLF1 protein through a cell-specific mechanism. Proc Natl Acad Sci U S A. 1996;93: 9194–9199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Seibl R, Motz M, Wolf H. Strain-specific transcription and translation of the BamHI Z area of Epstein-Barr Virus. J Virol. 1986;60: 902–909. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Hardwick JM, Lieberman PM, Hayward SD. A new Epstein-Barr virus transactivator, R, induces expression of a cytoplasmic early antigen. J Virol. 1988;62: 2274–2284. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Rooney CM, Rowe DT, Ragot T, Farrell PJ. The spliced BZLF1 gene of Epstein-Barr virus (EBV) transactivates an early EBV promoter and induces the virus productive cycle. J Virol. 1989;63: 3109–3116. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Kenney S, Kamine J, Holley-Guthrie E, Lin JC, Mar EC, Pagano J. The Epstein-Barr virus (EBV) BZLF1 immediate-early gene product differentially affects latent versus productive EBV promoters. J Virol. 1989;63: 1729–1736. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Hammerschmidt W, Sugden B. Identification and characterization of oriLyt, a lytic origin of DNA replication of Epstein-Barr virus. Cell. 1988;55: 427–433. [DOI] [PubMed] [Google Scholar]
- 21. Yuan J, Cahir-McFarland E, Zhao B, Kieff E. Virus and cell RNAs expressed during Epstein-Barr virus replication. J Virol. 2006;80: 2548–2565. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Serio TR, Kolman JL, Miller G. Late gene expression from the Epstein-Barr virus BcLF1 and BFRF3 promoters does not require DNA replication in cis. J Virol. 1997;71: 8726–8734. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Isomura H, Stinski MF, Kudoh A, Murata T, Nakayama S, Sato Y, et al. Noncanonical TATA sequence in the UL44 late promoter of human cytomegalovirus is required for the accumulation of late viral transcripts. J Virol. 2008;82: 1638–1646. 10.1128/JVI.01917-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Tang S, Yamanegi K, Zheng Z-M. Requirement of a 12-base-pair TATT-containing sequence and viral lytic DNA replication in activation of the Kaposi’s sarcoma-associated herpesvirus K8.1 late promoter. J Virol. 2004;78: 2609–2614. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Wong-Ho E, Wu T-T, Davis ZH, Zhang B, Huang J, Gong H, et al. Unconventional sequence requirement for viral late gene core promoters of murine gammaherpesvirus 68. J Virol. 2014;88: 3411–3422. 10.1128/JVI.01374-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Wyrwicz LS, Rychlewski L. Identification of Herpes TATT-binding protein. Antiviral Res. 2007;75: 167–172. 10.1016/j.antiviral.2007.03.002 [DOI] [PubMed] [Google Scholar]
- 27. Gruffat H, Kadjouf F, Mariamé B, Manet E. The Epstein-Barr virus BcRF1 gene product is a TBP-like protein with an essential role in late gene expression. J Virol. 2012;86: 6023–6032. 10.1128/JVI.00159-12 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Arumugaswami V, Wu T-T, Martinez-Guzman D, Jia Q, Deng H, Reyes N, et al. ORF18 is a transfactor that is essential for late gene transcription of a gammaherpesvirus. J Virol. 2006;80: 9730–9740. 10.1128/JVI.00246-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Wong E, Wu T-T, Reyes N, Deng H, Sun R. Murine gammaherpesvirus 68 open reading frame 24 is required for late gene expression after DNA replication. J Virol. 2007;81: 6761–6764. 10.1128/JVI.02726-06 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Wu T-T, Park T, Kim H, Tran T, Tong L, Martinez-Guzman D, et al. ORF30 and ORF34 are essential for expression of late genes in murine gammaherpesvirus 68. J Virol. 2009;83: 2265–2273. 10.1128/JVI.01785-08 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Kayhan B, Yager EJ, Lanzer K, Cookenham T, Jia Q, Wu T-T, et al. A replication-deficient murine gamma-herpesvirus blocked in late viral gene expression can establish latency and elicit protective cellular immunity. J Immunol Baltim Md 1950. 2007;179: 8392–8402. [DOI] [PubMed] [Google Scholar]
- 32. Isomura H, Stinski MF, Murata T, Yamashita Y, Kanda T, Toyokuni S, et al. The human cytomegalovirus gene products essential for late viral gene expression assemble into prereplication complexes before viral DNA replication. J Virol. 2011;85: 6629–6644. 10.1128/JVI.00384-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Perng Y-C, Qian Z, Fehr AR, Xuan B, Yu D. The human cytomegalovirus gene UL79 is required for the accumulation of late viral transcripts. J Virol. 2011;85: 4841–4852. 10.1128/JVI.02344-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Omoto S, Mocarski ES. Transcription of true late (γ2) cytomegalovirus genes requires UL92 function that is conserved among beta- and gammaherpesviruses. J Virol. 2014;88: 120–130. 10.1128/JVI.02983-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Omoto S, Mocarski ES. Cytomegalovirus UL91 is essential for transcription of viral true late (γ2) genes. J Virol. 2013;87: 8651–8664. 10.1128/JVI.01052-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Watanabe T, Narita Y, Yoshida M, Sato Y, Goshima F, Kimura H, et al. Epstein-Barr virus BDLF4 Gene Is Required for Efficient Expression of Viral Late Lytic Genes. J Virol. 2015; 10.1128/JVI.01604-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Aubry V, Mure F, Mariamé B, Deschamps T, Wyrwicz LS, Manet E, et al. Epstein-Barr virus late gene transcription depends on the assembly of a virus-specific preinitiation complex. J Virol. 2014;88: 12825–12838. 10.1128/JVI.02139-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Wiley SR, Kraus RJ, Zuo F, Murray EE, Loritz K, Mertz JE. SV40 early-to-late switch involves titration of cellular transcriptional repressors. Genes Dev. 1993;7: 2206–2219. [DOI] [PubMed] [Google Scholar]
- 39.Anders DG, Kerry JA, Pari GS. DNA synthesis and late viral gene expression. 2007; Available: http://www.ncbi.nlm.nih.gov/books/NBK47419/ [PubMed]
- 40. Amon W, Binné UK, Bryant H, Jenkins PJ, Karstegl CE, Farrell PJ. Lytic cycle gene regulation of Epstein-Barr virus. J Virol. 2004;78: 13460–13469. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Braman J, editor. In Vitro Mutagenesis Protocols [Internet]. Totowa, NJ: Humana Press; 2010. Available: http://link.springer.com/10.1007/978-1-60761-652-8 [Google Scholar]
- 42. Tischer BK, Smith GA, Osterrieder N. En passant mutagenesis: a two step markerless red recombination system. Methods Mol Biol Clifton NJ. 2010;634: 421–430. 10.1007/978-1-60761-652-8_30 [DOI] [PubMed] [Google Scholar]
- 43. Chiu Y-F, Tung C-P, Lee Y-H, Wang W-H, Li C, Hung J-Y, et al. A comprehensive library of mutations of Epstein Barr virus. J Gen Virol. 2007;88: 2463–2472. [DOI] [PubMed] [Google Scholar]
- 44. Fixman ED, Hayward GS, Hayward SD. trans-acting requirements for replication of Epstein-Barr virus ori-Lyt. J Virol. 1992;66: 5030–5039. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Fixman ED, Hayward GS, Hayward SD. Replication of Epstein-Barr virus oriLyt: lack of a dedicated virally encoded origin-binding protein and dependence on Zta in cotransfection assays. J Virol. 1995;69: 2998–3006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Robinson AR, Kwek SS, Hagemeier SR, Wille CK, Kenney SC. Cellular transcription factor Oct-1 interacts with the Epstein-Barr virus BRLF1 protein to promote disruption of viral latency. J Virol. 2011;85: 8940–8953. 10.1128/JVI.00569-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Chiu Y-F, Sugden AU, Sugden B. Epstein-Barr viral productive amplification reprograms nuclear architecture, DNA replication, and histone deposition. Cell Host Microbe. 2013;14: 607–618. 10.1016/j.chom.2013.11.009 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Geiduschek EP, Kassavetis GA. Transcription of the T4 late genes. Virol J. 2010;7: 288 10.1186/1743-422X-7-288 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Rennekamp AJ, Lieberman PM. Initiation of lytic DNA replication in Epstein-Barr virus: search for a common family mechanism. Future Virol. 2010;5: 65–83. 10.2217/fvl.09.69 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Rennekamp AJ, Lieberman PM. Initiation of Epstein-Barr virus lytic replication requires transcription and the formation of a stable RNA-DNA hybrid molecule at OriLyt. J Virol. 2011;85: 2837–2850. 10.1128/JVI.02175-10 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Amon W, White RE, Farrell PJ. Epstein-Barr virus origin of lytic replication mediates association of replicating episomes with promyelocytic leukaemia protein nuclear bodies and replication compartments. J Gen Virol. 2006;87: 1133–1137. [DOI] [PubMed] [Google Scholar]
- 52. Daikoku T, Kudoh A, Fujita M, Sugaya Y, Isomura H, Shirata N, et al. Architecture of replication compartments formed during Epstein-Barr virus lytic replication. J Virol. 2005;79: 3409–3418. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. Sugimoto A, Kanda T, Yamashita Y, Murata T, Saito S, Kawashima D, et al. Spatiotemporally Different DNA Repair Systems Participate in Epstein-Barr Virus Genome Maturation▿. J Virol. 2011;85: 6127–6135. 10.1128/JVI.00258-11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Sugimoto A, Sato Y, Kanda T, Murata T, Narita Y, Kawashima D, et al. Different Distributions of Epstein-Barr Virus Early and Late Gene Transcripts within Viral Replication Compartments. J Virol. 2013;87: 6693–6699. 10.1128/JVI.00219-13 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 55. Homa FL, Glorioso JC, Levine M. A specific 15-bp TATA box promoter element is required for expression of a herpes simplex virus type 1 late gene. Genes Dev. 1988;2: 40–53. 10.1101/gad.2.1.40 [DOI] [PubMed] [Google Scholar]
- 56. Gao M, Knipe DM. Potential role for herpes simplex virus ICP8 DNA replication protein in stimulation of late gene expression. J Virol. 1991;65: 2666–2675. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Olesky M, McNamee EE, Zhou C, Taylor TJ, Knipe DM. Evidence for a direct interaction between HSV-1 ICP27 and ICP8 proteins. Virology. 2005;331: 94–105. 10.1016/j.virol.2004.10.003 [DOI] [PubMed] [Google Scholar]
- 58. Zhou C, Knipe DM. Association of herpes simplex virus type 1 ICP8 and ICP27 proteins with cellular RNA polymerase II holoenzyme. J Virol. 2002;76: 5893–5904. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59. Soliman TM, Sandri-Goldin RM, Silverstein SJ. Shuttling of the herpes simplex virus type 1 regulatory protein ICP27 between the nucleus and cytoplasm mediates the expression of late proteins. J Virol. 1997;71: 9188–9197. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60. Fontaine-Rodriguez EC, Knipe DM. Herpes simplex virus ICP27 increases translation of a subset of viral late mRNAs. J Virol. 2008;82: 3538–3545. 10.1128/JVI.02395-07 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Jean S, LeVan KM, Song B, Levine M, Knipe DM. Herpes simplex virus 1 ICP27 is required for transcription of two viral late (gamma 2) genes in infected cells. Virology. 2001;283: 273–284. 10.1006/viro.2001.0902 [DOI] [PubMed] [Google Scholar]
- 62. Sacks WR, Greene CC, Aschman DP, Schaffer PA. Herpes simplex virus type 1 ICP27 is an essential regulatory protein. J Virol. 1985;55: 796–805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63. Kim D-B, Zabierowski S, DeLuca NA. The initiator element in a herpes simplex virus type 1 late-gene promoter enhances activation by ICP4, resulting in abundant late-gene expression. J Virol. 2002;76: 1548–1558. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64. Zabierowski S, DeLuca NA. Differential cellular requirements for activation of herpes simplex virus type 1 early (tk) and late (gC) promoters by ICP4. J Virol. 2004;78: 6162–6170. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Davis ZH, Hesser CR, Park J, Glaunsinger BA. Interaction between ORF24 and ORF34 in the Kaposi’s Sarcoma-Associated Herpesvirus Late Gene Transcription Factor Complex Is Essential for Viral Late Gene Expression. J Virol. 2016;90: 599–604. 10.1128/JVI.02157-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66. Brulois K, Wong L-Y, Lee H-R, Sivadas P, Ensser A, Feng P, et al. Association of Kaposi’s Sarcoma-Associated Herpesvirus ORF31 with ORF34 and ORF24 Is Critical for Late Gene Expression. J Virol. 2015;89: 6148–6154. 10.1128/JVI.00272-15 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 67. Delecluse HJ, Hilsendegen T, Pich D, Zeidler R, Hammerschmidt W. Propagation and recovery of intact, infectious Epstein-Barr virus from prokaryotic to human cells. Proc Natl Acad Sci U S A. 1998;95: 8245–8250. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68. Grillot-Courvalin C, Goussard S, Huetz F, Ojcius DM, Courvalin P. Functional gene transfer from intracellular bacteria to mammalian cells. Nat Biotechnol. 1998;16: 862–866. 10.1038/nbt0998-862 [DOI] [PubMed] [Google Scholar]
- 69. Calderwood MA, Venkatesan K, Xing L, Chase MR, Vazquez A, Holthaus AM, et al. Epstein-Barr virus and virus human protein interaction maps. Proc Natl Acad Sci U S A. 2007;104: 7606–7611. 10.1073/pnas.0702332104 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 70. Swaminathan S, Tomkinson B, Kieff E. Recombinant Epstein-Barr virus with small RNA (EBER) genes deleted transforms lymphocytes and replicates in vitro. Proc Natl Acad Sci U S A. 1991;88: 1546–1550. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 71. Rozenblatt-Rosen O, Deo RC, Padi M, Adelmant G, Calderwood MA, Rolland T, et al. Interpreting cancer genomes using systematic host network perturbations by tumour virus proteins. Nature. 2012;487: 491–495. 10.1038/nature11288 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72. Reusch JA, Nawandar DM, Wright KL, Kenney SC, Mertz JE. Cellular differentiation regulator BLIMP1 induces Epstein-Barr virus lytic reactivation in epithelial and B cells by activating transcription from both the R and Z promoters. J Virol. 2015;89: 1731–1743. 10.1128/JVI.02781-14 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 73. Livak KJ, Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods. 2001;25: 402–408. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Bar plots showing mRNA levels of six βγ genes (BcRF1, BDLF3.5, BDLF4, BGLF3, BFRF2, and BVLF1) relative to β-Actin in 293 EBV ΔBALF2/HA-BcRF1 cells that were uninduced (U), induced (I) by transfection with R and Z expression plasmids, or induced and trans-complemented by transfection with plasmid expressing R, Z, and BALF2 (I + t) at 48 hours post induction. Transcripts for six βγ genes are detected in the induced condition (I, middle bar) and were not significantly increased by trans-complementation with BALF2 (I + t).
(TIF)
(PDF)
Data Availability Statement
All relevant data are within the paper and its Supporting Information files.









