Skip to main content
NCBI home page
Toxins logoLink to Toxins
. 2016 Jun 21;8(6):186. doi: 10.3390/toxins8060186

Identification of Pathogenic Fusarium spp. Causing Maize Ear Rot and Potential Mycotoxin Production in China

Canxing Duan 1, Zihui Qin 1, Zhihuan Yang 1, Weixi Li 1, Suli Sun 1, Zhendong Zhu 1, Xiaoming Wang 1,*
Editor: Sven Dänicke1
PMCID: PMC4926152  PMID: 27338476

Abstract

Ear rot is a serious disease that affects maize yield and grain quality worldwide. The mycotoxins are often hazardous to humans and livestock. In samples collected in China between 2009 and 2014, Fusarium verticillioides and F. graminearum species complex were the dominant fungi causing ear rot. According to the TEF-1α gene sequence, F. graminearum species complex in China included three independent species: F. graminearum, F. meridionale, and F. boothii. The key gene FUM1 responsible for the biosynthesis of fumonisin was detected in all 82 F. verticillioides isolates. Among these, 57 isolates mainly produced fumonisin B1, ranging from 2.52 to 18,416.44 µg/g for each gram of dry hyphal weight, in vitro. Three different toxigenic chemotypes were detected among 78 F. graminearum species complex: 15-ADON, NIV and 15-ADON+NIV. Sixty and 16 isolates represented the 15-ADON and NIV chemotypes, respectively; two isolates carried both 15-ADON and NIV-producing segments. All the isolates carrying NIV-specific segment were F. meridionale. The in vitro production of 15-ADON, 3-ADON, DON, and ZEN varied from 5.43 to 81,539.49; 6.04 to 19,590.61; 13.35 to 19,795.33; and 1.77 to 430.24 µg/g of dry hyphal weight, respectively. Altogether, our present data demonstrate potential main mycotoxin production of dominant pathogenic Fusarium in China.

Keywords: maize, ear rot, Fusarium spp., mycotoxin chemotype, mycotoxin production

1. Introduction

Fusarium spp. are among the most important pathogenic fungal communities affecting crops. These fungi can induce serious diseases on roots, stems, leaves, and fruits, resulting in huge economic losses. Maize ear rot caused by Fusarium spp. affects maize production and kernel quality. The disease occurs in many countries; in recent years, it has gradually expanded because of global warming [1,2,3]. In addition to causing ear rot and reducing yield, Fusarium spp. produce mycotoxins that are directly synthesized in kernels and accumulated there, hence, seriously threatening the health of both humans and livestock [4,5,6]. The most common Fusarium toxins are deoxynivalenol (DON) and the fumonisins. They are very often detected in cereal crops such as maize, wheat, and rice and have drawn wide attention owing to their toxicity and carcinogenicity. In 1973, Fusarium toxin was listed among the 16 research priorities of the World Health Organization and the Food and Agriculture Organization [7,8,9,10]. With improvements in living standards, higher requirements for food safety have been proposed.

Fusarium verticillioides is one of the most common pathogens causing ear rot in maize. This disease is widespread in temperate and semitropical areas, including all European maize-growing areas, and even prevailing in Mediterranean areas, such as the agricultural regions of Italy, which are characterized by dry, warm conditions [3,11]. In recent years, F. verticillioides has also been characterized as an important pathogen causing maize ear rot in several regions of China [12,13,14]. This fungus is able to produce dangerous fumonisins that can be toxic for humans and animals. The fumonisins have been classified into four main groups: fumonisins A, B, C, and P. The fumonisin B (FB) analogs—comprising toxicologically important FB1, FB2, and FB3—are the most abundant naturally-occurring fumonisins. FB1 is the most toxic and appears in the highest concentration in the host, accounting for 70% to 80% of total fumonisins [5,15,16]. This mycotoxin can be carcinogenic in humans and livestock and even cause equine leukoencephalomalacia, rat hepatocarcinoma, and porcine pulmonary edema [3,7].

Production of fumonisins by F. verticillioides is dependent on a biosynthetic gene cluster (FUM) made up of 16 contiguous and coexpressed genes; deletion of the gene FUM1 can reduce FB1 production by 99% [17,18]. The various toxicological profiles of F. verticillioides isolates may reflect significant differences in the risk for mycotoxin contamination, with potential implications for human and animal health and international trade [19].

Fusarium graminearum species complex (FGSC) comprises a class of important pathogens of small-grain cereals and maize in many areas of the world. These fungi often cause economically devastating diseases that occur at different stages of plant development, such as seedling blight, maize root rot, wheat head blight (FHB or scab), and maize ear rot, causing a significant eventual reduction in the quality and yield of the crops [20,21,22].

Moreover, these diseases are often associated with various trichothecenes and other mycotoxins produced in plants, thus representing an important problem of food safety. FGSC can produce zearalenone (ZEN), nivalenol (NIV), and DON, which can inhibit protein synthesis by combining with the 60S ribosomal subunit. This poses a significant threat to the health of both humans and livestock [5,23]. Fusarium spp. can produce many types of trichothecenes. Type B trichothecenes are among the mycotoxins produced by the FGSC. The particularly important groups within this type are DON and its acetylated derivatives, 3-acetyl-deoxynivalenol (3-ADON) and 15-acetyl-deoxynivalenol (15-ADON), as well as nivalenol (NIV) and its acetylated derivatives, 4-acetylnivalenol. 3-ADON has been shown to be more phytotoxic and fungi that produce 3-ADON have a higher pathogenic potential than those producing 15-ADON [23,24,25].

Among specimens of F. graminearum isolated from barley, wheat, potato, and beet in America, 15-ADON–producing isolates were more common than those producing 3-ADON, and NIV was detected only in the isolate number 21 [26,27]. In North America, 3-ADON–producing isolates have been found to produce a higher DON content, and these may be replacing 15-ADON isolates with weaker pathogenicity [28,29]. In northern Europe and northwestern Russia, more 3-ADON isolates were present as compared with 15-ADON isolates [30,31,32]. The mycotoxins 15-ADON and NIV were produced by F. graminearum in Luxembourg and 15-ADON was the dominant type, while no 3-ADON–producing isolates were detected [33]. Of 42 F. culmorum isolates collected in Australia and nine European countries, 34 isolates produced DON and seven produced high concentrations of NIV but low levels of DON, while one produced neither DON nor NIV [34]. A recent study showed that in F. graminearum collected from Europe, the predominant genotype was 15-ADON (82.9%), followed by 3-ADON (13.6%), and nivalenol (NIV) (3.5%). In F. culmorum, the prevalent genotype was 3-ADON (59.9%), while the NIV genotype accounted for 40.1% [35].

Many methods can be used to detect Fusarium mycotoxins, including enzyme-linked immunosorbent assay, thin-layer chromatography, capillary electrophoresis, gas chromatography, gas chromatography/mass spectrometry, high-performance liquid chromatography (HPLC), liquid chromatography/mass spectrography, and ultra-high-performance liquid chromatography/mass spectrometry (UHPLC-MS/MS). HPLC and UHPLC-MS/MS are widely used in quantitative assays of mycotoxin because of their high efficiency and accuracy [36,37,38,39].

A good knowledge of the potential for mycotoxin biosynthesis by fungal isolates from different geographic regions could help to predict the risk of contamination by mycotoxins in the surveyed areas. To date, very little information on chemotypes and the mycotoxin-producing capacity of the main pathogenic Fusarium spp. causing maize ear rot in China has been reported. In the research documented here, samples were collected from the main maize producing areas experiencing frequent ear rot; pathogenic Fusarium spp. were then isolated and identified. Mycotoxin chemotypes and their production were examined. The aim was to determine the pathogenic species of Fusarium causing maize ear rot in China, as well as the main mycotoxin chemotypes and their production capacity.

2. Results

2.1. Identification of Fusarium spp.

According to morphological and molecular findings, 160 tested maize seed samples, accounting for 66.9% of total samples, were infected by Fusarium spp. and most of them were F. verticillioides and FGSC. 82 F. verticillioides isolates with the specific amplicon of 578 bp size were obtained from 82 samples (51.3%) at 67 places in 18 provinces, whereas FGSC was isolated from 70 samples (43.8%) at 66 places in 17 provinces. In addition, F. culmorum, F. oxysporum, F. proliferatum, F. subglutinans, and F. solani clades were isolated from three (1.9%), two (1.3%), one (0.6%), one (0.6%), and one (0.6%) sample, respectively (Figure 1).

Figure 1.

Figure 1

Open in a new tab

Molecular detection of Fusarium species. M, DNA marker; (a) Fusarium spp. were specifically amplified by polymerase chain reaction (PCR), 1–8: Fusarium spp. FG029, FG030, FG039, FG042, FG044, FVAH-1, FVAH-3, FVHB-4; (b) PCR amplification of F. verticillioides, 1–8: F. verticillioides FVAH-1 FVAH-3, FVHB-4, FVHB-5, FVHB-6, FVHN-7, FVHN-8, FVSD-9; (c) PCR amplification of F. graminearum species complex, 1–8: FGSC FG029, FG030, FG039, FG042, FG015, FG020, FG092, FG146; (d) PCR amplification of F. oxysporum species complex, 1–2: F. oxysporum species complex HN1, AH1; (e) PCR amplification of F. subglutinans, 2: F. subglutinans S’XX; 1, 3: F. verticillioides FVHB-4, FVHB-5; and (f) PCR amplification of F. culmorum, 1–2: FGSC FG080, FG081, 3: F. culmorum SD1.

Sequencing of the TEF-1α gene of 78 FGSC isolates and alignment with BLAST in the Fusarium Center’s database showed 99% to 100% homology between the tested FGSC and standard reference strains in this database. A total of 42 isolates—such as FG-029, FG-30, FG-043, FG-103 and others—exhibited 99% to 100% homology with F. graminearum sensu stricto (AJ543588.1), while the other 20 isolates (e.g., FG-015, FG-020, FG-100, FG-130, and the like) showed 99% to 100% homology with F. meridionale (AF212436.1). In addition, 16 isolates (e.g., FG-010, FG-057, and FG-094) expressed 100% homology with F. boothii (AF212444.1). The phylogenetic tree of some FGSC based on TEF-1α gene sequences confirmed Fusarium species. The tree topologies of the TEF-1α gene sequences showed the classification of FGSC into three distinct clades and the support values for these clades were high (no lower than 90% bootstrap value; BP) (Figure 2). These results demonstrated that the FGSC causing maize ear rot in China is mainly F. graminearum, which accounted for 53.8% of the total FGSC and was widely distributed in northern and southern maize-producing regions. The second main lineage was F. meridionale, accounting for 25.6% of total FGSC. This lineage was isolated only from Yunnan, Guizhou, and southern Shaanxi provinces. A total of 16 isolates showed 100% homology with F. boothii, accounting for 20.5% of the total; these were discovered in northern areas of China (e.g., Inner Mongolia, Jilin, Hebei, Shanxi, and Beijing).

Figure 2.

Figure 2

Open in a new tab

The phylogenetic tree of some F. graminearum species complex based on TEF-1α gene sequences. Branch lengths are proportional to the estimated number of nucleotide substitutions. The BP values are displayed on the nodes (BP: 1000 replicates).

2.2. Detection of Toxigenic Genes and Chemotypes

FUM1 was detected in 82 F. verticillioides isolates, thus indicating that these isolates can potentially synthesize FBs.

Three different mycotoxin chemotypes were detected from 78 isolates in FGSC. In all, 60 isolates with the specific 583-bp amplified fragments were 15-ADON, while 16 isolates producing the specific 859-bp amplified fragments were NIV. In addition, 583- and 859-bp amplified fragments produced by two isolates simultaneously were 15-ADON and NIV.

According to the molecular identification of NIV, 15-ADON, and 3-ADON of FGSC, 62 FGSC isolates collected from Beijing, Hebei, Liaoning, Jilin, Heilongjiang, Inner Mongolia, Henan, Shandong, Anhui, Ningxia, and Gansu were detected with only 15-ADON. Those in Guizhou were detected with only NIV. Both 15-ADON- and NIV-producing isolates were detected in samples from Shaanxi Province. Samples collected in Shaanxi Province had the most mycotoxin types. Isolates from northern Shaanxi had two main mycotoxin types, but 15-ADON was dominant in isolates from Guanzhong and northern Shaanxi Province. All 16 independent NIV isolates were identified as F. meridionale and mainly originated from Southwestern China. The two isolates containing specific 15-ADON- and NIV-producing segments were from southern Shaanxi.

2.3. Detection of Toxigenic Capacity

The results of FB detection with immunoafinity chromatography purification-HPLC and DON and ZEN assays based on UPLC-MS/MS agreed with the molecular identification of key mycotoxin-producing genes.

A fumonisin assay showed that the mycotoxin-producing capacity of F. verticillioides isolates from different regions varied greatly and that FB1 was the main chemotype. Among 82 F. verticillioides isolates, 79, 69, and 75 isolates produced FB1, FB2, and FB3 respectively. A total of 70 isolates were able to produce FB1, FB2, and FB3 simultaneously, and 12 isolates produced no FB2. Among the latter, seven produced no FB3. Among isolates producing FB, 57 isolates produced mainly FB1 and 23 produced mainly FB2 or FB3. The production capacities of FB1, FB2, and FB3 ranged from 2.52 to 18,416.44, 3.00 to 1864.90, and 0.28 to 1510.54 µg/g of dry hyphal weight, respectively (Table 1).

Table 1.

Mycotoxin production of Fusarium verticillioide isolates.

No. Origin of Isolate FB1 (µg/g) FB2 (µg/g) FB3 (µg/g) FB (µg/g)
FVAH-1 Sixian, Anhui 3437.79 ± 39.21 253.12 ± 11.23 69.91 ± 2.66 3760.82 ± 51.21
FVAH-2 Wuhe, Anhui 533.71 ± 15.32 133.42 ± 8.11 27.90 ± 3.58 695.04 ± 15.22
FVAH-3 Xiaoxian, Anhui 695.72 ± 13.89 76.33 ± 6.23 30.18 ± 1.56 802.24 ± 13.56
FVAH-4 Sixian, Anhui 4837.44 ± 56.66 248.03 ± 7.89 121.23 ± 8.44 5206.70 ± 56.67
FVAH-5 Suzhou, Anhui 1427.11 ± 20.13 150.57 ± 5.24 31.67 ± 2.31 1609.35 ± 22.14
FVAH-6 Suzhou, Anhui 1605.32 ± 23.25 170.88 ± 4.61 44.21 ± 2.85 1820.41 ± 20.41
FVBJ-1 Changping, Beijing 123.00 ± 9.85 48.18 ± 2.12 8.00 ± 1.13 179.18 ± 13.01
FVGS-1 Zhenyuan, Gansu 1750.53 ± 15.22 144.26 ± 3.43 25.77 ± 1.89 1920.56 ± 15.21
FVGZ-1 Bijie, Guizhou 2432.10 ± 13.85 172.07 ± 12.88 27.01 ± 2.14 2631.18 ± 23.33
FVGZ-2 Xifeng, Guizhou 14.06 ± 1.31 33.46 ± 2.56 24.51 ± 0.92 72.03 ± 5.85
FVGZ-3 Xifeng, Guizhou 12.58 ± 1.02 30.12 ± 1.78 21.87 ± 088 64.57 ± 4.12
FVGZ-4 Qianxinan, Guizhou 14.29 ± 1.15 31.27 ± 1.36 22.91 ± 3.11 68.47 ± 3.66
FVHB-1 Shenzhou, Hebei 40.04 ± 2.89 14.10 ± 2.11 47.26 ± 0.98 101.39 ± 10.23
FVHB-2 Hengshui, Hebei 226.85 ± 8.87 71.20 ± 5.36 10.25 ± 2.10 308.29 ± 11.25
FVHB-3 Cangzhou, Hebei 102.81 ± 5.36 31.49 ± 2.88 5.63 ± 1.36 139.94 ± 12.03
FVHB-4 Cangzhou, Hebei 123.15 ± 3.85 42.59 ± 2.56 7.67 ± 1.87 173.41 ± 9.87
FVHB-5 Yongnian, Hebei 11.25 ± 1.39 27.95 ± 3.11 15.65 ± 2.58 54.85 ± 5.36
FVHB-6 Handan, Hebei 5.81 ± 0.97 14.90 ± 1.01 9.10 ± 1.30 29.81 ± 3.99
FVHB-7 Qinhuangdao, Hebei 405.76 ± 11.21 36.85 ± 1.23 6.71 ± 0.56 449.33 ± 8.23
FVHB-8 Luanxian, Hebei 374.05 ± 8.89 32.78 ± 2.58 8.73 ± 0.55 415.55 ± 14.25
FVHB-9 Zhangjiakou, Hebei 62.43 ± 3.25 23.44 ± 0.97 4.98 ± 0.87 90.85 ± 6.86
FVHN-1 Zhengzhou, Henan 54.53 ± 2.55 0.00 3.47 ± 0.64 57.99 ± 7.11
FVHN-2 Zhengzhou, Henan 350.58 ± 9.36 65.81 ± 3.12 8.00 ± 1.02 424.39 ± 13.58
FVHN-3 Zhongmo, Henan 1072.13 ± 23.56 61.19 ± 2.58 42.43 ± 2.37 1175.75 ± 35.56
FVHN-4 Xunxian, Henan 7.46 ± 0.91 8.03 ± 0.46 0.28 ± 0.04 15.77 ± 1.91
FVHN-6 Luoyang, Henan 3195.88 ± 33.51 755.84 ± 6.35 56.30 ± 3.25 4008.02 ± 80.12
FVHN-7 Luoyang, Henan 2886.75 ± 30.12 661.72 ± 5.01 50.12 ± 3.68 3598.59 ± 53.13
FVHN-8 Fangcheng, Henan 280.79 ± 8.87 51.09 ± 1.25 5.83 ± 0.65 337.70 ± 23.14
FVHN-9 Luyi, Henan 276.79 ± 6.84 98.93 ± 2.11 3.85 ± 0.27 379.56 ± 11.08
FVHN-10 Zhumadian, Henan 13,456.63 ± 89.23 1864.90 ± 20.14 96.37 ± 3.87 15,417.91 ± 200.73
FVHLJ-1 Qiqihar, Heilongjiang 2.98 ± 0.31 8.65 ± 0.63 2.69 ± 0.29 14.32 ± 0.86
FVHLJ-2 Qiqihar, Heilongjiang 3.79 ± 0.41 10.25 ± 0.87 3.86 ± 0.27 17.90 ± 0.65
FVHLJ-3 Harbin, Heilongjiang 992.17 ± 8.11 120.22 ± 10.54 18.24 ± 3.45 1130.63 ± 21.21
FVHLJ-4 Harbin, Heilongjiang 3.62 ± 0.65 9.54 ± 0.68 6.16 ± 0.67 19.33 ± 1.22
FVHLJ-5 Suihua, Heilongjiang 5140.81 ± 32.23 652.95 ± 9.35 50.84 ± 2.35 5844.59 ± 23.56
FVHUB-1 Enshi, Hubei 21.54 ± 1.52 8.23 ± 0.21 16.87 ± 3.45 46.64 ± 2.24
FVHUN-2 Changsha, Hunan 51.04 ± 1.88 12.05 ± 0.66 101.46 ± 12.03 164.56 ± 3.21
FVJL-1 Dehui, Jining 18,416.44 ± 66.12 441.6818.11 356.31 ± 15.22 19,214.44 ± 159.32
FVLN-1 Youyan, Liaoning 5.75 ± 0.89 11.38 ± 1.02 14.93 ± 1.28 32.05 ± 2.14
FVLN-2 Donggang, Liaoning 0.00 0.00 0.00 0.00
FVLN-3 Fengcheng, Liaoning 1243.47 ± 13.56 203.89 ± 11.25 66.77 ± 0.89 1514.13 ± 23.14
FVLN-4 Fengcheng, Liaoning 1103.47 ± 11.33 198.35 ± 9.12 53.07 ± 0.45 1354.89 ± 19.88
FVLN-5 Fumeng, Liaoning 281.38 ± 5.78 50.88 ± 3.11 150.28 ± 10.22 482.54 ± 11.25
FVLN-6 Fumeng, Liaoning 18.47 ± 1.23 7.81 ± 0.78 14.35 ± 1.78 40.62 ± 3.32
FVLN-7 Fumeng, Liaoning 3.84 ± 0.75 9.33 ± 0.56 4.39 ± 0.56 17.56 ± 2.11
FVNMG-1 Chifeng, Inner Mongolia 586.63 ± 8.22 245.79 ± 11.23 55.16 ± 4.23 887.58 ± 12.01
FVNMG-2 Wuhai, Inner Mongolia 45.01 ± 3.11 9.25 ± 0.88 44.30 ± 3.55 98.56 ± 12.37
FVNX-1 Tongxin, Ningxia 11.74 ± 1.03 8.67 ± 0.97 9.34 ± 1.02 29.75 ± 3.21
FVNX-2 Yinchuan, Ningxia 213.72 ± 8.47 0.00 8.69 ± 0.89 222.41 ± 22.17
FVNX-3 Yongning, Ningxia 180.78 ± 3.66 39.89 ± 3.54 15.02 ± 1.58 235.68 ± 6.89
FVSD-1 Dezhou, Shandong 0.00 0.00 0.00 0.00
FVSD-2 Dezhou, Shandong 7.78 ± 1.12 6.60 ± 0.65 9.30 ± 1.07 23.68 ± 3.58
FVSD-3 Yuncheng, Shandong 7.91 ± 0.76 5.55 ± 0.77 13.32 ± 0.56 26.77 ± 1.25
FVSD-4 Jiaxiang, Shandong 3.55 ± 0.43 3.40 ± 0.61 1.04 ± 0.11 7.99 ± 0.81
FVSD-5 Jining, Shandong 3.24 ± 0.77 5.39 ± 0.56 3.88 ± 0.57 12.51 ± 0.56
FVSD-6 Jining, Shandong 5.35 ± 0.87 7.69 ± 0.86 5.93 ± 0.64 18.97 ± 0.47
FVSD-7 Sishui, Shandong 88.43 ± 5.44 13.57 ± 1.57 61.29 ± 1.26 163.29 ± 23.57
FVSD-8 Weishan, Shandong 4.14 ± 0.39 3.36 ± 0.67 5.26 ± 0.88 12.77 ± 1.87
FVSD-9 Yanzhou, Shandong 2.52 ± 0.57 3.00 ± 0.25 3.24 ± 0.54 8.75 ± 0.65
FVSD-10 Liaocheng, Shandong 204.66 ± 10.13 61.96 ± 3.31 11.95 ± 1.06 278.58 ± 12.37
FVSD-11 Pingdu, Shandong 2.61 ± 0.13 402.81 ± 23.14 89.43 ± 5.33 494.85 ± 23.11
FVSD-12 Qingzhou, Shandong 1196.33 ± 22.11 73.85 ± 11.01 321.18 ± 11.23 1591.37 ± 20.87
FVSD-13 Shouguang, Shandong, 2405.54 ± 28.32 106.06 ± 5.23 1510.54 ± 46.31 4022.15 ± 42.56
FVSD-14 Laizhou, Shandong 145.34 ± 8.46 25.82 ± 2.45 74.04 ± 8.12 245.20 ± 15.21
FVS-1 Changzhi, Shanxi 4402.45 ± 25.32 555.28 ± 35.43 1123.88 ± 23.21 6081.61 ± 53.25
FVSX-1 Baoji, Shaanxi 312.24 ± 12.78 18.66 ± 2.55 21.95 ± 3.01 352.85 ± 10.04
FVSX-2 Qishan, Shaanxi 253.62 ± 13.33 0.00 13.25 ± 2.06 266.87 ± 16.23
FVSX-3 Danfeng, Shaanxi 4384.86 ± 35.41 287.50 ± 5.37 61.46 ± 3.02 4733.82 ± 35.65
FVSX-4 Shangluo, Shaanxi 3476.72 ± 30.12 351.97 ± 15.36 95.03 ± 3.11 3923.72 ± 40.24
FVSX-5 Shangluo, Shaanxi 2486.72 ± 15.32 231.51 ± 9.31 65.13 ± 2.18 2783.36 ± 29.81
FVSX-6 Luonan, Shaanxi 21.52 ± 1.13 12.06 ± 2.14 16.42 ± 1.56 50.00 ± 3.60
FVSX-7 Luonan, Shaanxi 2383.63 ± 23.08 155.53 ± 6.87 310.49 ± 9.23 2849.66 ± 50.17
FVSX-8 Fuping, Shaanxi 210.44 ± 5.63 56.57 ± 3.47 17.26 ± 1.25 284.27 ± 23.14
FVSX-9 Huxian, Shaanxi 23.54 ± 2.13 0.00 0.00 23.54 ± 2.38
FVSC-1 Zhongjiang, Sichuan 223.58 ± 15.26 0.00 0.00 223.58 ± 10.25
FVSC-2 Santai, Sichuan 2.26 ± 0.23 3.63 ± 0.58 0.88 ± 0.05 6.77 ± 0.67
FVSC-3 Mianyang, Sichuan 77.40 ± 2.36 0.00 0.00 77.40 ± 3.54
FVSC-4 Xichong, Sichuan 17.73 ± 1.09 5.14 ± 0.82 28.86 ± 5.23 51.72 ± 3.14
FVYN-1 Mangshi, Yunnan 72.25 ± 2.11 15.88 ± 1.82 111.17 ± 4.77 199.30 ± 8.12
FVYN-2 Dehong, Yunnan 0.00 0.00 0.00 0.00
FVYN-3 Mile, Yunnan 40.23 ± 5.21 0.00 0.00 40.23 ± 3.69
FVYN-4 Qujing, Yunnan 114.54 ± 5.67 0.00 10.07 ± 0.78 124.61 ± 10.25
Open in a new tab

Among FGSC, 15-ADON was detected in 68 isolates, showing a mycotoxin production range of 5.43 to 81,539.49 µg/g of dry hyphal weight. Among 10 isolates producing no 15-ADON, eight were F. meridionale, which produced NIV according to molecular identification; they were mainly distributed in Hubei, Sichuan, and Bijie of Guizhou. A total of 22 isolates had a low mycotoxin-producing capacity (≤1000 µg/g of dry hyphal weight). Among these 22 isolates, 12 were F. meridionale, including 11 NIV isolates from Guizhou, Yunnan, and Shangluo in southern Shaanxi Province. A total of 26 isolates had a moderate mycotoxin-producing capacity (from 1001 to 10,000 µg/g of dry hyphal weight). All of these were F. graminearum and F. boothii. Meanwhile 20 isolates had a high mycotoxin-producing capacity (>10,000 µg/g of hypha), all of which were F. graminearum and F. boothii (Table 2).

Table 2.

Mycotoxin chemotype and production of Fusarium graminearum species complex isolates.

No. Species Isolate of Origin Chemotype DON (µg/g) 15-ADON (µg/g) 3-ADON (µg/g) ZEN (µg/g)
FG001 F. g. Mengcheng, Anhui 15-ADON 7392.35 ± 48.02 27,713.62 ± 181.02 8316.53 ± 86.32 0.00
FG008 F. g. Shunyi, Beijing 15-ADON 304.06 ± 15.36 1920.07 ± 23.36 528.73 ± 23.21 46.31 ± 3.25
FG012 F. g. Zhuanglang, Gansu 15-ADON 19,795.33 ± 99.23 4350.49 ± 35.14 1315.46 ± 35.25 6.95 ± 0.81
FG023 F. g. Changli, Hebei 15-ADON 4319.20 ± 35.62 24,411.32 ± 150.12 8167.15 ± 78.23 0.00
FG029 F. g. Zhangjiakou, Hebei 15-ADON 12,464.99 ± 88.25 33,162.16 ± 223.57 11,471.99 ± 113.14 198.96 ± 13.37
FG030 F. g. Tangshan, Hebei 15-ADON 3898.09 ± 46.35 18,546.56 ± 88.17 5674.04 ± 53.62 0.00
FG039 F. g. Xiangcheng, Henan 15-ADON 0.00 0.00 0.00 0.00
FG042 F. g. Sanmenxia, Henan 15-ADON 3189.00 ± 23.56 18,175.55 ± 100.25 5297.00 ± 85.36 0.00
FG043 F. g. Zhoukou, Henan 15-ADON 394.64 ± 12.23 5956.24 ± 65.36 1863.57 ± 36.52 0.00
FG044 F. g. Zhumadian, Henan 15-ADON 7955.22 ± 65.57 34,732.64 ± 137.58 9981.63 ± 89.65 0.00
FG050 F. g. Qiqihar, Heilongjiang 15-ADON 4267.29 ± 23.39 6453.04 ± 82.21 1797.64 ± 13.56 0.00
FG060 F. g. Donggang, Liaoning 15-ADON 406.97 ± 12.35 6967.08 ± 56.34 1718.66 ± 56.23 0.00
FG063 F. g. Shenyang, Liaoning 15-ADON 1757.88 ± 21.45 4615.86 ± 58.75 1328.25 ± 33.21 2.73 ± 0.51
FG072 F. g. Pingdu, Shandong 15-ADON 3172.77 ± 39.23 12,843.81 ± 98.21 3430.94 ± 25.24 6.18 ± 0.39
FG075 F. g. Jiaxiang, Shandong 15-ADON 685.04 ± 15.63 10,420.73 ± 89.45 2869.32 ± 33.21 55.57 ± 3.21
FG078 F. g. Dezhou, Shandong 15-ADON 8566.56 ± 46.36 54,382.05 ± 256.32 17,855.15 ± 78.56 6.83 ± 1.02
FG080 F. g. Liaocheng, Shandong 15-ADON 224.59 ± 22.01 857.22 ± 10.58 242.27 ± 11.24 0.00
FG081 F. g. Liaocheng, Shandong 15-ADON 1308.70 ± 63.70 9308.46 ± 56.32 2934.81 ± 55.21 22.72 ± 0.97
FG082 F. g. Tai`an, Shandong 15-ADON 0.00 72.99 ± 6.38 23.20 ± 2.12 0.00
FG083 F. g. Yanzhou, Shandong 15-ADON 213.08 ± 13.54 1704.10 ± 20.12 451.66 ± 10.53 0.00
FG084 F. g. Qingdao, Shandong 15-ADON 0.00 25.52 ± 2.58 6.04 ± 0.65 0.00
FG086 F. g. Laizhou, Shandong 15-ADON 1419.21 ± 21.08 7742.05 ± 33.56 1956.23 ± 21.32 0.00
FG087 F. g. Weishan, Shandong 15-ADON 2417.01 ± 22.01 11,843.94 ± 87.58 2677.59 ± 35.26 0.00
FG096 F. g. Xianyang, Shaanxi 15-ADON 1201.27 ± 36.25 8910.50 ± 98.24 2572.49 ± 63.27 0.00
FG098 F. g. Fengxiang, Shaanxi 15-ADON 13.35 ± 1.04 86.84 ± 5.63 9.51 ± 0.59 0.00
FG099 F. g. Yulin, Shaanxi 15-ADON 0.00 47.01 ± 6.23 10.14 ± 0.26 0.00
FG101 F. g. Shangnan, Shaanxi 15-ADON 4764.23 ± 55.36 20,461.49 ± 100.58 5694.38 ± 66.39 0.00
FG103 F. g. Zhashui, Shaanxi 15-ADON 2710.03 ± 12.37 8006.75 ± 89.57 2286.71 ± 55.31 0.00
FG135 F. g. Sanmenxia, Henan 15-ADON 866.30 ± 26.31 4106.67 ± 76.35 1164.43 ± 53.37 1.77 ± 0.55
FG141 F. g. Heishan, Liaoning 15-ADON 1668.64 ± 33.10 9666.53 ± 100.57 2425.36 ± 51.98 0
FG144 F. g. Xianfeng, Hubei 15-ADON 5915.73 ± 29.25 26,784.49 ± 85.69 6497.77 ± 88.56 0.00
FG144 F. g. Heihe, Helongjiang 15-ADON 0 174.24 ± 12.35 27.75 ± 3.04 3.63 ± 0.34
FG147 F. g. Wangkui, Helongjiang 15-ADON 170.41 ± 8.63 311.93 ± 23.21 69.48 ± 3.56 88.27 ± 2.78
FG150 F. g. Jiamusi, Helongjiang 15-ADON 12,422.55 ± 119.65 16,823.61 ± 88.56 4803.78 ± 40.12 0
FG153 F. g. Fujin, Helongjiang 15-ADON 4742.29 ± 63.21 23,219.59 ± 150.69 6518.67 ± 45.23 0
FG155 F. g. Fujin, Helongjiang 15-ADON 1825.81 ± 25.78 8084.01 ± 80.23 2064.13 ± 35.55 0
FG156 F. g. Fengcheng, Liaoning 15-ADON 507.41 ± 13.69 2925.37 ± 23.01 575.05 ± 10.27 0
FG158 F. g. Panshi, Jilin 15-ADON 16,723.72 ± 87.56 81,539.49 ± 300.57 19,590.61 ± 211.25 0
FG159 F. g. Panshi, Jilin 15-ADON 698.51 ± 4.68 2845.5 ± 23.45 887.61 ± 6.38 0
FG162 F. g. Nenjiang, Helongjiang 15-ADON 929.66 ± 15.23 5251.46 ± 23.22 1298.79 ± 37.24 14.37 ± 1.39
FG165 F. g. Qinggang, Helongjiang 15-ADON 2998.93 ± 23.24 23,152.65 ± 123.5 5391.17 ± 52.13 430.24 ± 25.87
FG015 F. m. Puding, Guizhou NIV 0.00 5.43 ± 0.56 17.24 ± 1.66 0.00
FG017 F. m. Bijie, Guizhou NIV 0.00 0.00 0.00 0.00
FG019 F. m. Guiyang, Guizhou NIV 0.00 20.46 ± 1.23 470.83 ± 12.25 0.00
FG020 F. m. Zunyi, Guizhou NIV 0.00 28.82 ± 1.21 151.29 ± 13.24 0.00
FG100 F. m. Luonan, Shaanxi NIV 0.00 67.44 ± 2.25 709.58 ± 33.22 0.00
FG102 F. m. Danfeng, Shaanxi 15-ADON, NIV 0.00 12.29 ± 2.58 13.85 ± 1.65 0.00
FG104 F. m. Zhenan, Shaanxi 15-ADON 69.60 ± 6.87 222.33 ± 11.012 63.93 ± 3.77 0.00
FG105 F. m. Shangluo, Shaanxi 15-ADON, NIV 0.00 47.25 ± 3.12 53.13 ± 5.20 0.00
FG106 F. m. Huayin, Shaanxi NIV 0.00 55.75 ± 1.25 767.60 ± 45.31 2.11 ± 0.49
FG107 F. m. Luonan, Shaanxi NIV 0.00 40.05 ± 3.24 0.00 0.00
FG128 F. m. Qujing, Yunnan NIV 0.00 8.58 ± 0.54 0.00 0.00
FG129 F. m. Qujing, Yunnan NIV 0.00 11.46 ± 0.89 284.86 ± 23.56 8.90 ± 0.87
FG130 F. m. Mile, Yunnan NIV 0.00 14.24 ± 1.55 78.62 ± 9.39 0.00
FG133 F. m. Luxi, Yunnan NIV 0.00 104.90 ± 9.25 3519.87 ± 33.21 0.00
FG140 F. m. Yuxi, Yunnan NIV 0.00 0.00 0.00 0.00
FG142 F. m. Badong, Hubei NIV 0.00 0.00 0.00 0.00
FG143 F. m. Jianshi, Hubei NIV 0.00 0.00 0.00 0.00
FG145 F. m. Xianfeng, Hubei NIV 0.00 0.00 0.00 0.00
FG146 F. m. Pixian, Sichuan NIV 0.00 0.00 0.00 0.00
FG151 F. m. Mianyang, Sichuan 15-ADON 0.00 0.00 0.00 0.00
FG152 F. m. Jianyang, Sichuan 15-ADON 0.00 0.00 0.00 0.00
FG010 F. b. Haidian, Beijng 15-ADON 371.46 ± 12.56 2876.36 ± 36.56 843.70 ± 23.10 10.64 ± 1.11
FG028 F. b. Zhangjiakou, Hebei 15-ADON 3636.37 ± 46.38 13,845.04 ± 95.63 4475.88 ± 45.32 0.00
FG057 F. b. Huinan, Jilin 15-ADON 6794.02 ± 45.57 6844.28 ± 98.76 2132.45 ± 33.12 17.39 ± 0.97
FG069 F. b. Chifeng, Inner Mongolia 15-ADON 9439.56 ± 80.67 9901.51 ± 85.69 2795.33 ± 46.29 0.00
FG092 F. b. Changzhi, Shanxi 15-ADON 5629.31 ± 36.87 5687.94 ± 36.54 1779.75 ± 30.01 53.51 ± 3.24
FG094 F. b. Changzhi, Shanxi 15-ADON 9939.69 ± 55.36 11,725.34 ± 111.30 3457.11 ± 55.32 0.00
FG142 F. b. Suihua, Helongjiang 15-ADON 1491.91 ± 23.25 4549.23 ± 56.68 1334.72 ± 23.65 14.25 ± 2.16
FG145 F. b. Tongliao, Inner Mongolia 15-ADON 3151.85 ± 53.23 7899.02 ± 36.89 2168.33 ± 33.45 0
FG146 F. b. Tongliao, Inner Mongolia 15-ADON 0 38.83 ± 3.87 0 0
FG147 F. b. Chengdu, Sichuan 15-ADON 0.00 0.00 0.00 0.00
FG148 F. b. Liangshan, Sichuan 15-ADON 1156.47 ± 23.15 22123.45 ± 78.65 5838.04 ± 39.87 0.00
FG149 F. b. Qiqihar, Helongjiang 15-ADON 1548.25 ± 35.24 6991.64 ± 36.56 2114.88 ± 24.21 60.05 ± 3.25
FG160 F. b. Lanxi, Helongjiang 15-ADON 4236.92 ± 23.47 18455.36 ± 100.24 4741.94 ± 55.12 36.92 ± 3.67
FG161 F. b. Qinggang, Helongjiang 15-ADON 518.48 ± 12.25 5451.17 ± 85.63 1408.57 ± 23.23 74.67 ± 5.26
FG166 F. b. Zhenlai, Jilin 15-ADON 1496.17 ± 22.01 5324.07 ± 83.21 1386.40 ± 23.87 22.68 ± 2.98
FG167 F. b. Huachuan, Helongjiang 15-ADON 14.20 ± 1.25 236.46 ± 23.56 153.75 ± 9.68 29.61 ± 2.65
Open in a new tab

Key: F. g., Fusarium graminearum; F. m., Fusarium meridionale; F. b., Fusarium boothii.

3-ADON was detected in 65 isolates, which showed a mycotoxin-producing capacity ranging from 6.04 to 19,590.61 µg/g of dry hyphal weight. Among 13 isolates producing no 3-ADON, 10 were F. meridionale and eight were NIV-producing isolates. They were all distributed in Hubei, Sichuan, Guizhou, and Yunnan. A total of 23 isolates had a low mycotoxin-producing capacity (≤1000 µg/g of hypha), including 10 F. meridionale isolates, while 39 isolates had a moderate mycotoxin-producing capacity (1001–10,000 µg/g of dry hyphal weight), including 27 F. graminearum and 12 F. boothii isolates. Three isolates with a high mycotoxin-producing capacity (>10,000 µg/g of dry hyphal weight) were F. graminearum.

DON was detected in 51 isolates, which showed a mycotoxin-producing range of 13.35 to 19,795.33 µg/g of dry hyphal weight. A total of 27 isolates, including 21 F. meridionale, 4 F. graminearum, and two F. boothii isolates, did not produce DON. A total of 16 isolates had a low mycotoxin-producing capacity (≤1000 µg/g of hypha), whereas 31 isolates had a moderate mycotoxin-producing capacity (1001–10,000 µg/g of dry hyphal weight), including 20 F. graminearum and 11 F. boothii isolates. Meanwhile, four F. graminearum isolates had a high mycotoxin-producing capacity (>10,000 µg/g of dry hyphal weight) (Table 2).

ZEN was detected in 24 isolates, which showed a mycotoxin-producing capacity varying from 1.77 to 430.24 µg/g of dry hyphal weight. Of these isolates, 13 were F. graminearum, nine were F. boothii, and two were F. meridionale. However, 54 isolates did not produce ZEN (Table 2).

Overall, F. graminearum had the highest mycotoxin-producing capacity, followed by F. boothii and F. meridionale successively in the laboratory. F. graminearum and F. boothii isolates with a high mycotoxin producing capacity were distributed mainly in Northern China.

Isolates with different chemotypes produced different amounts of mycotoxin. According to molecular identification and mycotoxin assay, 15-ADON–producing isolates produced more 15-ADON than DON and 3-ADON. None of the 18 isolates carrying NIV-specific segment produced any DON and 16 of them did nor ZEN. Most NIV-producing isolates produced more 3-ADON than 15-ADON. Also, the isolates carrying both 15-ADON and NIV chemotype-specific segments produced more 3-ADON than 15-ADON (Table 2). As a result, the isolates with NIV chemotype-specific segments likely pose a greater risk to maize crops as well as to humans and livestock because 3-ADON is more toxic than 15-ADON.

3. Discussion

Many pathogenic Fusarium spp. can be found causing maize ear rot in China, but the majority of isolates are determined to be F. verticillioides and FGSC. According to the frequency of the isolation of these species from different regions, maize ear rot is most commonly caused by F. verticillioides, followed by FGSC. This result is similar to that reported by other previous studies of the predominant pathogens causing ear rot in China, but compared with the regional research, there are also differences [12,13,40].

Maize samples infected by F. verticillioides are often contaminated with FBs. With regard to the levels of fumonisins produced by the isolates, three of 82 isolates (0.037%) were unable to produce fumonisins, indicating the presence of phenotypic variability among the F. verticillioides isolates. Interestingly, FUM1, a key gene responsible for FB biosynthesis, was detected in all 82 isolates. This result was similar to that of previous studies. Sanchèz-Rangel et al. reported that some isolates of F. verticillioides from maize in Mexico possessed the FUM1 gene but did not produce fumonisins [41]. Several F. verticillioides isolates from Italy also carried the FUM1 gene but did not produce fumonisins [3]. These phenotypes could be explained by a mutation in the FUM cluster or by altered expression of the FUM genes.

In this study, the toxigenic capacity of isolates from different regions varied, indicating that under conditions of laboratory incubation the mycotoxin chemotype and toxigenic capacity of F. verticillioides may not be correlated with its region of origin. Actually, in addition to the particular isolate, mycotoxin synthesis in plants also depends heavily on environment (temperature, humidity, pH, and lighting) as well as crop rations in the field. Therefore, mycotoxin production in the laboratory primarily represents toxigenic potentiality.

The FGSC can cause various gramineous crops diseases and leads to a reduction in crop yield and quality. In recent years, a total of 16 species in FGSC have been identified [42,43,44]. In the present study, three species lineages were found in the FGSC isolates collected mainly from Northeast China, Huang-Huai-Hai region, and Southwest China, regions in which the environments vary greatly.

In the present study, a total of 3 toxigenic chemotypes produced by FGSC were detected and DON was the main one. All F. graminearum and F. boothii isolates were 15-ADON–producing isolates, but F. meridionale produced one or more isolates of 15-ADON, NIV, and 3-ADON, which indicated that lineage or species was related to the mycotoxin chemotype to a certain extent. The genetic identification (molecular identification) of 10 isolates disagreed with the UHPLC assay: four were 15-ADON isolates (FG039, FG147, FG151, and FG152) and six were NIV isolates (FG017, FG140, FG142, FG143, FG145, and FG146). No mycotoxin had been detected by UHPLC in these isolates. In addition, based on the UHPLC quantitative assay of mycotoxin production, some amount of DON, 3-ADON, or ZEN was detected in 15-ADON–producing isolates and some 15-ADON or 3-ADON was detected in NIV-producing isolates. This outcome may be related to the expression and regulation of the toxin gene.

In the present study, 15-ADON–producing isolates generated more 15-ADON than 3-ADON, whereas NIV-type isolates generated more 3-ADON than 15-ADON, which may be related to the prior expression of a certain mycotoxin. Some DON-producing isolates coproduced a certain amount of NIV, as observed by Sugiura et al. [45].The mycotoxin production varied greatly among isolates from different regions. The occurrence of Fusarium spp. isolates with strong toxicity or high mycotoxin production should be given particular attention. Furthermore, two isolates were found to carry both DON and NIV chemotype-specific segments, possibly resulting from recombination between the two chemotypes. Kim et al. reported that a F. graminearum isolate (A18) from corn generated a chimeric pattern containing features of both DON-specific and NIV-specific sequences [46], which was similar to FG102 and FG105. With regard to the isolates carrying diverse chemotype-specific regions, special care must be taken, since these isolates have the potential to produce a variety of mycotoxins.

In summary, F. verticillioides and FGSC were the predominant fungi causing maize ear rot in China and the latter contained F. graminearum, F. meridionale, and F. boothii. Most of the F. verticillioides isolates mainly produced highly toxic fumonisin B1. The analysis of the current Fusarium chemotypes showed that trichothecene genotype was 15-ADON in all F. graminearum and F. boothii isolates. The prevalent chemotype was NIV (76.2%), followed by 15-ADON (14.3%) and NIV + 15-ADON (9.5%) in F. meridionale. The toxogenic capacity of F. graminearum and F. boothii was higher than that of F. meridionale.

4. Materials and Methods

4.1. Sample Collection and Isolation

A total of 239 samples of maize ears or kernels showing ear rot (five affected maize ears or 500 g kernels for each sample) were collected from 110 counties and districts of 18 provinces in China between 2009 and 2014 (Table 3). All samples were collected from different villages or fields of different towns, counties (districts), cities, and provinces (municipalities). Approximately 20 seeds collected from the boundary between maize ear rot regions and healthy regions or 90 seeds (30 seeds for each petri dish) from 500 g of kernels sample were soaked in 20% sodium hypochlorite solution for three minutes and rinsed with sterile water three times. These seeds were dried with sterilized filter paper and placed on a poor-nutrient potato dextrose agar (half-PDA) (potato infusion 100 g, dextrose 20 g, agar 20 g, distilled water 1000 mL) plate to culture for three days at 25°C. Hyphae or colonies on half-PDA with the morphological characteristics of Fusarium were transferred to fresh media and the culture was subsequently purified for 5 to 7 days. Hyphae were inoculated onto Spezieller Nährstoffarmer Agar (SNA) medium and incubated for seven days [47]. After conidia were generated, a single spore was isolated on SNA medium by the plate dilution method. Finally, the single spore was transplanted onto a half-PDA plate to culture single-spore isolates.

Table 3.

Distribution of 239 affected maize ear and seed samples.

Province Number of Counties Province Number of Counties
Anhui 5 Inner mongoria 3
Beijing 2 Jilin 4
Gansu 2 Liaoning 5
Guizhou 6 Ningxia 3
Hebei 12 Shaanxi 14
Heilongjiang 8 Shandong 13
Henan 11 Shanxi 4
Hubei 4 Sichuan 7
Hunan 1 Yunnan 6
Open in a new tab

4.2. Identification of Pathogenic Fungi

The morphological identification of fungal cultures was conducted based on conidial morphology [47]. Subsequently, in order to confirm the morphological identification, all isolates were validated by species-specific PCR identification.

Mycelia were harvested by filtration through a filtering cloth, freeze-dried for 24 h, and then stored at −80 °C. The total genomic DNA of isolates was extracted from the mycelium, as described by Liu et al. [48]. Molecular identification was based on specific primers of different Fusarium spp. Primer sequences are listed in Table 4. The polymerase chain reaction (PCR) was carried out in a 20.0-µL receptacle containing 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.5 mM of each dNTP, 2.0 µM of each primer, 1.0 U Taq polymerase (Dingguo, Beijing, China), and 50 ng of DNA template. Reactions were performed using a GeneAmp PCR System 9700 thermal cycler (ABI, Norwalk, CT, USA) programmed for 94 °C for 4 min; followed by 35 cycles of 94 °C 40 s, 57 °C 40 s (56 °C for F. verticillioides), and 72 °C 40 s; and a final extension at 72 °C for 10 min.

Table 4.

Specific primers for Fusarium spp. used in this study.

Fungus Primer Sequence (5′–3′) Target Fragment (bp) Tm (°C) Reference
Fusarium spp. ItsF AACTCCCAAACCCCTGTGAACATA 431 58 [49]
ItsR TTTAACGGCGTGGCCGC
F. graminearum Fg16NF ACAGATGACAAGATTCAGGCACA 280 57 [50]
Fg16NR TTCTTTGACATCTGTTCAACCCA
F. culmorum Fc01F ATGGTGAACTCGTCCTGGC 570 59 [50]
Fc01R CCCTTCTTACGCCAATCTCG
F. oxysporum FoF1 ACATACCACTTGTTGCCTCG 340 58 [51]
FoR1 CGCCAATCAATTTGAGGAACG
F. verticillioides VER1 CTTCCTGCGATGTTTCTCC 578 56 [52]
VER2 AATTGGCCATTGGTATTATATATCTA
F. proliferatum PRO1 CTTTCCGCCAAGTTTCTTC 585 56 [52]
PRO2 TGTCAGTAACTCGACGTTGTTG
F. subglutinans SUB1 CTGTCGCTAACCTCTTTATCCA 631 56 [52]
SUB2 CAGTATGGACGTTGGTATTATATCTAA
Open in a new tab

The translation elongation factor (TEF)-1α gene sequences of FGSC isolates was analyzed. Isolates that had been determined as FGSC were further identified by the sequences of the TEF-1α gene, with primers of EF-1 (5′-ATGGGTAAGGARGACAAGAC-3′) and EF-2 (5′-GGARGTACCAGTSATCATGTT-3′) [53]. FGSC isolates were amplified at a 50.0-µL reaction system containing 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.5 mM of each dNTP, 2.0 µM of each primer, 1.0 U Taq polymerase, and 50 ng of DNA template. PCR was performed using the following parameters: 94 °C for 4 min; followed by 35 cycles of 94 °C 30 s, 53 °C 30 s, and 72 °C for 1 min, and a final extension at 72 °C for 10 min. To determine Fusarium species in FGSC, the sequences of the TEF-1α gene were compared with Fusarium sequences in the Fusarium Center’s database at Penn State [54]. Three standard strains were used as references to carry on homology BLAST (Table 5). Furthermore, using MEGA 5.0 software (ASU, Phoenix, Az, USA, 2011), a phylogenetic tree was constructed using the ML (Test Maximum Likelihood Tree) clustering method based on the TEF-1α gene sequences of FGSC isolates and standard reference strains (Figure S1) and the bootstrap analysis was performed with 1000 replicates for statistical support of branches [55].

Table 5.

The information of three standard reference strains in this study.

Taxon Collection Strain No. Accession No. Host Geographic Origin
F. graminearum VI 01028 AJ543588.1 Oat Norway
F. meridionale 28723 AF212436.1 Corn Nepal
F. boothii 26916 AF212444.1 Corn South Africa
Open in a new tab

4.3. Molecular Identification of Toxigenic Genes

Based on the molecular identification of all F. verticillioides isolates, the key gene FUM1 responsible for FB biosynthesis was detected by using the specific primers Fum5F (5′-GTCGAGTTGTTGACCACTGCG -3′) and Fum5R (5′-CGTATCGTCAGCATGATGTAGC -3′) [49]. The PCR reaction was performed in a 20.0-µL receptacle containing 10 mM Tris-HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.5 mM of each dNTP, 2.0 µM of each primer, 1.0 U Taq polymerase, and 50 ng of DNA template. Reactions were programmed for 94 °C for 4 min; followed by 35 cycles of 94 °C 40 s, 60 °C 40 s, and 72 °C 1 min; and a final extension was performed at 72 °C for 10 min.

A mycotoxin-producing gene Tri13 of FGSC was detected with primer Tri13P1/2. Primer sequences were TRi13P1 (5′-CTCSACCGCATCGAAGASTCTC-3′) and Tri13P2 (5′-GAASGTCGCARGACCTTGTTTC-3′). The PCR system and program were the same as above except for the annealing temperature of 58 °C. The amplified fragments of isolates producing NIV, 3-ADON, and 15-ADON were 859, 644, and 583 bp, respectively [56].

4.4. HPLC Detection of Mycotoxin Production

Equivalent Fusarium spp. were cut from half-PDA and placed in a sterilized conical flask with 150 mL of potato dextrose broth (PDB). Three flasks for each fungal isolate were inoculated. F. graminearum was grown in a 15-day shaking culture (120 rpm) in PDB with pH 3.0 at 25 °C. F. verticillioides was grown in a 15-day static culture in PDB with pH 8.0 at 25 °C [3,36]. The culture medium was filtered through Whatman GF/A glass fiber filter paper; filtrate was then stored at −80°C or sterilized under high pressure. Hyphae were collected, dried, and weighed. DON and ZEN production of FGSC was tested by UHPLC-quadrupole mass spectrometry. Samples were extracted by 80% acetonitrile water solution, purified via a multifunction decontamination column, isolated via a Waters ACQUITY UPLCTMBEH C18 chromatographic column, tested by multireaction ion monitoring of quadrupole mass spectrometry, and quantified by an external standard method [38]. The FBs production capacity of F. verticillioides was tested by immunoaffinity column purification/HPLC. The samples were purified with an immunoaffinity column to collect eluent. The eluent was dried with nitrogen and dissolved in 1.5 mL of 80% methanol solution. FBs were tested through a C18 reverse-phase liquid chromatography/fluorescence detector after o-phthaldialdehyde (OPA) derivation and quantified via an external standard method [36]. Statistical analysis was performed with SPSS10.0 software (SPSS Inc., Chicago, IL, USA, 2007).

Acknowledgments

This project was supported by the Modern Agro-industry Technology Research System (CARS-02) of the Ministry of Agriculture of China and the Grain Quality Safety and Risk Assessment Group in Science and Technology Innovation Project of the Chinese Academy of Agricultural Sciences.

Abbreviations

The following abbreviations are used in this manuscript:

3-ADON 3-acetyl-deoxynivalenol
15-ADON 15-deoxynivalenol
DON deoxynivalenol
FB fumonisin B
FGSC Fusarium graminearum species complex
HPLC high-performance liquid chromatography
LC-MS/MS liquid chromatography-tandem mass spectrometry
ML maximum likelihood
NIV nivalenol
OPA o-phthaldialdehyde
PCR polymerase chain reactions
PDA potato dextrose agar
SNA Spezieller Nährstoffarmer agar
TEF translation elongation factor
UHPLC-MS/MS ultra-high performance liquid chromatography-mass spectrometry
ZEN zearalenone
Open in a new tab

Supplementary Materials

The following are available online at www.mdpi.com/2072-6651/8/6/186/s1, Figure S1: The alignments of TEF-1α gene sequences of FGSC isolates and standard reference strains.

Click here for additional data file. (14.1MB, pdf)

Author Contributions

Xiaoming Wang, Canxing Duan and Zihui Qin conceived and designed the experiments; Canxing Duan, Zihui Qin and Zhihuan Yang performed the experiments; Canxing Duan, Zihui Qin and Weixi Li analyzed the data; Weixi Li, Suli Sun and Zhendong Zhu contributed reagents/materials/analysis tools; Canxing Duan and Xiaoming Wang wrote and revised the paper.

Conflicts of Interest

The authors declare no conflict of interest.

References

  • 1.Görtz A., Oerke E.C., Steiner U., Waalwijk C., Vries I., Dehne H.W. Biodiversity of Fusarium species causing ear rot of maize in Germany. Cereal Res. Commun. 2008;36:617–622. doi: 10.1556/CRC.36.2008.Suppl.B.51. [DOI] [Google Scholar]
  • 2.Sampietro D.A., Diaz C.G., Gonzalez V., Vattuone M.A., Ploper L.D., Catalan C.A., Ward T.J. Species diversity and toxigenic potential of Fusarium graminearum complex isolates from maize fields in northwest Argentina. Int. J. Food Microbiol. 2011;145:359–364. doi: 10.1016/j.ijfoodmicro.2010.12.021. [DOI] [PubMed] [Google Scholar]
  • 3.Covarelli L., Stifano S., Beccari G., Raggi L., Lattanzio V.M., Albertini E. Characterization of Fusarium verticillioides strains isolated from maize in Italy: Fumonisin production, pathogenicity and genetic variability. Food Microbiol. 2012;31:17–24. doi: 10.1016/j.fm.2012.02.002. [DOI] [PubMed] [Google Scholar]
  • 4.Brown D.W., Dyer R.B., McCormick S.P., Kendra D.F., Plattner R.D. Functional demarcation of the Fusarium core trichothecene gene cluster. Fungal Genet. Biol. 2004;41:454–462. doi: 10.1016/j.fgb.2003.12.002. [DOI] [PubMed] [Google Scholar]
  • 5.Alexander N.J., Proctor R.H., McCormick S.P. Genes, gene clusters, and biosynthesis of trichothecenes and fumonisins in Fusarium. Toxin Rev. 2009;28:198–215. doi: 10.1080/15569540903092142. [DOI] [Google Scholar]
  • 6.Yin S., Guo X., Li J., Fan L., Hu H. Fumonisin B1 induces autophagic cell death via activation of ERN1-MAPK8/9/10 pathway in monkey kidney MARC-145 cells. Arch. Toxicol. 2016;90:985–996. doi: 10.1007/s00204-015-1514-9. [DOI] [PubMed] [Google Scholar]
  • 7.Gelderblom W.C., Jaskiewicz K., Marasas W.F., Thiel P.G., Horak R.M., Vleggaar R., Kriek N.P. Fumonisins-novel mycotoxins with cancer-promoting activity produced by Fusarium moniliforme. Appl. Environ. Microbiol. 1998;54:1806–1811. doi: 10.1128/aem.54.7.1806-1811.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Larsen J.C., Hunt J., Perrin I., Ruckenbauer P. Workshop on trichothecenes with a focus on DON: Summary report. Toxicol. Lett. 2004;153:1–22. doi: 10.1016/j.toxlet.2004.04.020. [DOI] [PubMed] [Google Scholar]
  • 9.Aboul-Nasr M.B., Obied-Allah M.R. Biological and chemical detection of fumonisins produced on agar medium by Fusarium verticillioides isolates collected from corn in Sohag, Egypt. Microbiology. 2013;159:1720–1724. doi: 10.1099/mic.0.069039-0. [DOI] [PubMed] [Google Scholar]
  • 10.Winkler J., Kersten S., Meyer U., Stinshoff H., Locher L., Rehage J., Wrenzycki C., Engelhardt U.H., Danicke S. Diagnostic opportunities for evaluation of the exposure of dairy cows to the mycotoxins deoxynivalenol (DON) and zearalenone (ZEN): Reliability of blood plasma, bile and follicular fluid as indicators. J. Anim. Physiol. Anim. Nutr. 2015;99:847–855. doi: 10.1111/jpn.12285. [DOI] [PubMed] [Google Scholar]
  • 11.Logrieco A., Mulè G., Moretti A., Bottalico A. Toxigenic Fusarium species and mycotoxins associated with maize ear rot in Europe. Eur. J. Plant Pathol. 2002;108:597–609. doi: 10.1023/A:1020679029993. [DOI] [Google Scholar]
  • 12.Zhang X.F., Zou C.J., Cui L.N., Li X., Yang X.R., Luo H.H. Identification of pathogen causing maize ear rot and inoculation technique in Southwest China. Southwest China J. Agric. Sci. 2012;25:2078–2082. [Google Scholar]
  • 13.Qin Z.H., Ren X., Jiang K., Wu X.F., Yang Z.H., Wang X.M. Identification of Fusarium species and F. graminearum species complex causing maize ear rot in China. Acta Phytophy. Sin. 2014;41:589–596. [Google Scholar]
  • 14.Fu M., Li R., Guo C., Pang M., Liu Y., Dong J. Natural incidence of Fusarium species and fumonisins B1 and B2 associated with maize kernels from nine provinces in China in 2012. Food Addit. Contam. Part A Chem. Anal. Control Expo. Risk Assess. 2015;32:503–511. doi: 10.1080/19440049.2014.976846. [DOI] [PubMed] [Google Scholar]
  • 15.Rheeder J.P., Marasas W.F., Vismer H.F. Production of fumonisin analogs by Fusarium species. Appl. Environ. Microbiol. 2002;68:2101–2105. doi: 10.1128/AEM.68.5.2101-2105.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Baldwin T.T., Zitomer N.C., Mitchell T.R., Zimeri A.M., Bacon C.W., Riley R.T., Glenn A.E. Maize seedling blight induced by Fusarium verticillioides: Accumulation of Fumonisin B1 in leaves without colonization of the leaves. J. Agric. Food Chem. 2014;62:2118–2125. doi: 10.1021/jf5001106. [DOI] [PubMed] [Google Scholar]
  • 17.Brown D.W., Butchko R.A.E., Busman M., Proctor R.H. The Fusarium verticillioides FUM gene cluster encodes a Zn(II)2Cys6 protein that affects FUM gene expression and fumonisin production. Eukaryot. Cell. 2007;6:1210–1218. doi: 10.1128/EC.00400-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Glenn A.E., Zitomer N.C., Zimeri A.M., Williams L.D., Riley R.T., Proctor R.H. Transformation-mediated complementation of a FUM gene cluster deletion in Fusarium verticillioides restores both fumonisin production and pathogenicity on maize seedlings. Mol. Plant Microbe Interact. 2008;21:87–97. doi: 10.1094/MPMI-21-1-0087. [DOI] [PubMed] [Google Scholar]
  • 19.Proctor R.H., Plattner R.D., Desjardins A.E., Busman M., Butchko R.A.E. Fumonisin production in the maize pathogen Fusarium verticillioides: Genetic basis of naturally occurring chemical variation. J. Agric. Food Chem. 2006;54:2424–2430. doi: 10.1021/jf0527706. [DOI] [PubMed] [Google Scholar]
  • 20.Bottalico A., Perrone G. Toxigenic Fusarium species and mycotoxins associated with head blight in small-grain cereals in Europe. Eur. J. Plant Pathol. 2002;108:611–624. doi: 10.1023/A:1020635214971. [DOI] [Google Scholar]
  • 21.Merhej J., Richard-Forget F., Barreau C. Regulation of trichothecene biosynthesis in Fusarium: Recent advances and new insights. Appl. Microbiol. Biotechnol. 2011;91:519–528. doi: 10.1007/s00253-011-3397-x. [DOI] [PubMed] [Google Scholar]
  • 22.Duan C.X., Wang X.M., Song F.J., Sun S.L., Zhou D.L., Zhu Z.D. Advances in research on maize resistance to ear rot. Sci. Agric. Sin. 2015;48:2152–2164. [Google Scholar]
  • 23.Pestka J.J. Deoxynivalenol: Mechanisms of action, human exposure, and toxicological relevance. Arch. Toxicol. 2010;84:663–679. doi: 10.1007/s00204-010-0579-8. [DOI] [PubMed] [Google Scholar]
  • 24.Miller J.D., Greenhalgh R., Wang Y.Z., Lu M. Trichothecene chemotypes of three Fusarium species. Mycologia. 1991;83:121–130. doi: 10.2307/3759927. [DOI] [Google Scholar]
  • 25.McCormick S.P., Stanley A.M., Stover N.A., Alexander N.J. Trichothecenes: from simple to complex mycotoxins. Toxins. 2011;3:802–814. doi: 10.3390/toxins3070802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Burlakoti R.R., Estrada R., Rivera V.V., Boddeda A., Secor G.A., Adhikari T.B. Real-time PCR quantification and mycotoxin production of Fusarium graminearum in wheat inoculated with isolates collected from potato, sugar beet, and wheat. Phytopathology. 2007;97:835–841. doi: 10.1094/PHYTO-97-7-0835. [DOI] [PubMed] [Google Scholar]
  • 27.Burlakoti R.R., Ali S., Secor G.A., Neate S.M., McMullen M.P., Adhikari T.B. Comparative mycotoxin profiles of Gibberella zeae populations from barley, wheat, potatoes, and sugar beets. Appl. Environ. Microbiol. 2008;74:6513–6520. doi: 10.1128/AEM.01580-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Foroud N., MacMillan T., Ellis B., Eudes F. The role of trichothecene-chemotypes in Fusarium head blight disease spread in wheat. Cereal Res. Commun. 2008;36:489–490. [Google Scholar]
  • 29.Ward T.J., Clear R.M., Rooney A.P., O’Donnell K., Gaba D., Patrick S., Starkey D.E., Gilbert J., Geiser D.M., Nowicki T.W. An adaptive evolutionary shift in Fusarium head blight pathogen populations is driving the rapid spread of more toxigenic Fusarium graminearum in North America. Fungal Genet. Biol. 2008;445:473–484. doi: 10.1016/j.fgb.2007.10.003. [DOI] [PubMed] [Google Scholar]
  • 30.Jestoi M. Emerging Fusarium-mycotoxins fusaproliferin, beauvericin, enniatins, and moniliformin—A review. Crit. Rev. Food Sci. Nutr. 2008;48:21–49. doi: 10.1080/10408390601062021. [DOI] [PubMed] [Google Scholar]
  • 31.Yli-Mattila T., Gagkaeva T., Ward T.J., Aoki T., Kistler H.C., O’Donnell K. A novel Asian clade within the Fusarium graminearum species complex includes a newly discovered cereal head blight pathogen from the Russian Far East. Mycologia. 2009;101:841–852. doi: 10.3852/08-217. [DOI] [PubMed] [Google Scholar]
  • 32.Yli-Mattila T., Gagkaeva T. Molecular chemotyping of Fusarium graminearum, F. culmorum, and F. cerealis isolates from Finland and Russia. In: Gherbawy Y., Voigt K., editors. Molecular Identification of Fungi. Springer Verlag; Berlin, Germany; Heidelberg, Germany; New York, NY, USA: 2010. pp. 159–177. [Google Scholar]
  • 33.Pasquali M.F., Brochot C., Cocco E., Hoffmann L., Bohn T. Genetic Fusarium chemotyping as a useful tool for predicting nivalenol contamination in winter wheat. Int. J. Food Microbiol. 2010;137:246–253. doi: 10.1016/j.ijfoodmicro.2009.11.009. [DOI] [PubMed] [Google Scholar]
  • 34.Gang G., Miedaner T., Schuhmacher U., Schollenberger M., Geiger H.H. Deoxynivalenol and nivalenol production by Fusarium culmorum isolates differing in aggressiveness toward winter rye. Phytopathology. 1998;88:879–884. doi: 10.1094/PHYTO.1998.88.9.879. [DOI] [PubMed] [Google Scholar]
  • 35.Pasquali M., Beyer M., Logrieco A., Audenaert K., Balmas V., Basler R., Boutigny A.L., Chrpová J., Czembor E., Gagkaeva T., et al. A European database of Fusarium graminearum and F. culmorum trichothecene genotypes. Front. Microbiol. 2016;7:406. doi: 10.3389/fmicb.2016.00406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Krska R., Baumgartner S., Josephs R. The state of the art in the analysis of type-A and -B trichothecene mycotoxins in cereals. J. Anal. Chem. 2001;371:285–299. doi: 10.1007/s002160100992. [DOI] [PubMed] [Google Scholar]
  • 37.Li W.X., Zheng C.M., Wu L., Li X., Li J.M., Song J.K., Yang X.L., Wang B.J. Determining fumonisins in corn by high performance liquid chromatography with immunoaffinity column cleanup. Acta Agron. Sin. 2012;38:556–562. doi: 10.3724/SP.J.1006.2012.00556. [DOI] [Google Scholar]
  • 38.Escobar J., Loran S., Gimenez I., Ferruz E., Herrera M., Herrera A., Arino A. Occurrence and exposure assessment of Fusarium mycotoxins in maize germ, refined corn oil and margarine. Food Chem. Toxicol. 2013;62:514–520. doi: 10.1016/j.fct.2013.09.020. [DOI] [PubMed] [Google Scholar]
  • 39.Sun J., Li W.X., Zhang Y., Sun L.J., Dong X.L., Hu X.X., Wang B.J. Simultaneous determination of twelve mycotoxins in cereals by ultra-high performance liquid chromatography-tandem mass spectrometry. Acta Agron. Sin. 2014;40:691–701. doi: 10.3724/SP.J.1006.2014.00691. [DOI] [Google Scholar]
  • 40.Guo C., Wei H.Y., Guo M.K., He S.Q., Jin S.L., Chen H.M., Wang X.M., Guo J.G. Isolation, identification and biological characteristics of Fusarium verticillioides from maize ear rot samples in Gansu Province. Acta Phytopathol. Sin. 2014;44:17–25. [Google Scholar]
  • 41.Sanchèz-Rangel D., Sanjuan-Badillo A., Plasencia J. Fumonisin production by Fusarium verticillioides strains isolated from maize in Mexico and development of a polymerase chain reaction to detect potential toxigenic strains in grains. J. Agric. Food Chem. 2005;53:8565–8571. doi: 10.1021/jf0514827. [DOI] [PubMed] [Google Scholar]
  • 42.O’Donnell K., Ward T.J., Geiser D.M., Corby K.H., Aoki T. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet. Biol. 2004;41:600–623. doi: 10.1016/j.fgb.2004.03.003. [DOI] [PubMed] [Google Scholar]
  • 43.Starkey D.E., Ward T.J., Aoki T., Gale L.R., Kistler H.C., Geiser D.M., Suga H., Toth B., Varga J., O’Donnell K. Global molecular surveillance reveals novel Fusarium head blight species and trichothecene toxin diversity. Fungal Genet. Biol. 2007;44:1191–1204. doi: 10.1016/j.fgb.2007.03.001. [DOI] [PubMed] [Google Scholar]
  • 44.Lamprecht S.C., Tewoldemedhin Y.T., Botha W.J., Calitz F.J. Fusarium graminearum species complex associated with maize crowns and roots in the KwaZulu-Natal province of South Africa. Plant Dis. 2011;95:1153–1158. doi: 10.1094/PDIS-02-11-0083. [DOI] [PubMed] [Google Scholar]
  • 45.Sugiura Y., Watanabe Y., Tanaka T., Yamamoto S., Ueno Y. Occurrence of Gibberella zeae strains that produce both nivalenol and deoxynivalenol. Appl. Environ. Microbiol. 1990;56:3047–3051. doi: 10.1128/aem.56.10.3047-3051.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Kim H.S., Lee T., Dawlatana M., Yun S.H., Lee Y.W. Polymorphism of trichothecene biosynthesis genes in deoxynivalenol- and nivalenol-producing Fusarium graminearum isolates. Mycol. Res. 2003;107:190–197. doi: 10.1017/S0953756203007317. [DOI] [PubMed] [Google Scholar]
  • 47.Leslie J.F., Summerell B.A. The Fusarium Laboratory Manual. Blackwell; Iowa City, IA, USA: 2006. [Google Scholar]
  • 48.Liu D., Coloe S., Baird R., Pedersen J. Rapid mini-preparation of fungal DNA for PCR. J. Clin. Microbiol. 2000;38:471. doi: 10.1128/jcm.38.1.471-471.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Bluhm B.H., Flaherty J.E., Cousin M.A., Woloshuk C.P. Multiplex polymerase chain reaction assay for the differential detection of trichothecene- and fumonisin-producing species of Fusarium in cornmeal. J. Food Prot. 2002;65:1955–1961. doi: 10.4315/0362-028x-65.12.1955. [DOI] [PubMed] [Google Scholar]
  • 50.Nicholson P., Simpson D.R., Weston G., Rezanoor H.N., Lees A.K., Parry D.W., Joyce D. Detection and quantification of Fusarium culmorum and Fusarium graminearumin cereals using PCR assays. Physiol. Mol. Plant Pathol. 1998;53:17–37. doi: 10.1006/pmpp.1998.0170. [DOI] [Google Scholar]
  • 51.Mishra P.K., Fox R.T.V., Culham A. Development of a PCR-based assay for rapid and reliable identification of pathogenic Fusariam. FEMS Microbiol. Lett. 2003;218:329–332. doi: 10.1111/j.1574-6968.2003.tb11537.x. [DOI] [PubMed] [Google Scholar]
  • 52.Mulè G., Susca A., Stea G., Moretti A. A species-specific PCR assay based on the calmodulin partial gene for identification of Fusarium verticillioides, F. proliferatum and F. subglutinans. Eur. J. Plant Pathol. 2004;110:495–502. doi: 10.1023/B:EJPP.0000032389.84048.71. [DOI] [Google Scholar]
  • 53.Watanabe M., Yonezawa T., Lee K., Kumagai S., Sugita-Konishi Y., Goto K., Hara-Kudo Y. Molecular phylogeny of the higher and lower taxonomy of the Fusarium genus and differences in the evolutionary histories of multiple genes. BMC Evol. Biol. 2011;11 doi: 10.1186/1471-2148-11-322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Cyber-infrastructure for Fusarium. [(accessed on 5 March 2014)]. Available online: http://www.fusariumdb.org/index.php.
  • 55.Tamura K., Peterson D., Peterson N., Stecher G., Nei M., Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011;28:2731–2739. doi: 10.1093/molbev/msr121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Wang J.H., Li H.P., Qu B., Zhang J.B., Huang T., Chen F.F., Liao Y.C. Development of a generic PCR detection of 3-acetyldeoxy-nivalenol-, 15-acetyldeoxynivalenol- and nivalenol-chemotypes of Fusarium graminearum Clade. Int. J. Mol. Sci. 2008;9:2495–2504. doi: 10.3390/ijms9122495. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Click here for additional data file. (14.1MB, pdf)

Articles from Toxins are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES