Skip to main content
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2016 May 30;17(6):804. doi: 10.3390/ijms17060804

A Chloroplast-Localized Rubredoxin Family Protein Gene from Puccinellia tenuiflora (PutRUB) Increases NaCl and NaHCO3 Tolerance by Decreasing H2O2 Accumulation

Ying Li 1, Panpan Liu 1, Tetsuo Takano 2, Shenkui Liu 1,*
Editor: Setsuko Komatsu
PMCID: PMC4926338  PMID: 27248998

Abstract

Rubredoxin is one of the simplest iron–sulfur (Fe–S) proteins. It is found primarily in strict anaerobic bacteria and acts as a mediator of electron transfer participation in different biochemical reactions. The PutRUB gene encoding a chloroplast-localized rubredoxin family protein was screened from a yeast full-length cDNA library of Puccinellia tenuiflora under NaCl and NaHCO3 stress. We found that PutRUB expression was induced by abiotic stresses such as NaCl, NaHCO3, CuCl2 and H2O2. These findings suggested that PutRUB might be involved in plant responses to adversity. In order to study the function of this gene, we analyzed the phenotypic and physiological characteristics of PutRUB transgenic plants treated with NaCl and NaHCO3. The results showed that PutRUB overexpression inhibited H2O2 accumulation, and enhanced transgenic plant adaptability to NaCl and NaHCO3 stresses. This indicated PutRUB might be involved in maintaining normal electron transfer to reduce reactive oxygen species (ROS) accumulation.

Keywords: rubredoxin family protein, Puccinellia tenuiflora, ROS

1. Introduction

Nowadays, soil alkalinization is very severe. Salinity and alkalinity are major environmental stresses on soil that limit crop distributions and yields worldwide [1,2,3]. In Northeast China, the total area of alkaline saline soil is about 3.73 × 106 ha and is expanding at a rate of 1.4% annually, making it one of the three largest sodic-saline areas in the world [4,5]. In such soil, plants suffer adverse stress factors, such as Na+ and HCO3/CO32− ions, and high pH. These factors can directly affect nutrient uptake, organic acid balance, and ion homeostasis at a whole-plant level [6,7,8,9]. Research shows that only a small number of plants can complete their entire life cycle in highly alkaline areas. Puccinellia tenuiflora, a graminaceous and alkali-tolerant halophyte species, is one such plant. It can complete its life cycle in highly alkaline soil (pH 10). P. tenuiflora has evolved various strategies to adapt to saline or alkaline stress, such as maintaining ion balance, osmotic homeostasis adjustment, and removal of reactive oxygen species (ROS) [10,11,12,13,14,15]. Thus, it is considered a saline-alkali soil pioneer plant. To date, several stress-responsive genes in P. tenuiflora have been isolated and their biological functions have been tested [16,17,18,19,20,21]. P. tenuiflora is also considered an ideal model plant for discovering resistance genes and studying the resistance mechanism of halophytes.

Rubredoxin is a kind of non-heme iron protein that contains a [Fe(SCys)4] center. It is one of the simplest iron–sulfur (Fe–S) proteins, containing a single Fe atom and four S atoms [22]. Rubredoxin is mostly found in strict anaerobic bacteria, including bacteria, archaebacteria and a few microaerobic bacteria in nature [23,24,25,26,27]. Relatively few of these proteins have been found in plants. Research suggests rubredoxin proteins act as mediators of electron transfer for various enzymes in anaerobic bacteria [24,28,29,30]. Recently, a new pathway called the Super Oxide Reductase reaction(SOR) was identified that provides an alternative superoxide reduction pathway in anaerobic microorganisms. Rubredoxins of various anaerobes appear to act as an electron donor in the SOR reaction to reduce the production of O2 [31,32,33].

In our previous work, we identified some candidate salt-responsive genes in P. tenuiflora using the Full-length cDNA Over-eXpressor gene (FOX)-hunting system. This system is a very effective tool for plant functional gene research that does not require any knowledge of the genome of interest or genetic mapping. It has opened up novel approaches for elucidating the functions of genes that control metabolic pathways and determine plant morphological characteristics [34,35]. PutRUB was one of the genes we identified. In this study, we analyzed its expression under different stress conditions. The function of PutRUB in NaCl and NaHCO3-stress conditions was investigated in Arabidopsis transgenic the PutRUB gene. We hope these results will provide a theoretical basis for future exploration of the adaptation mechanism of P. tenuiflora.

2. Results and Discussion

2.1. Characteristics of PutRUB

The full-length cDNA of PutRUB was 1005 bp, with a 5′-UTR of 52 bp, an open reading frame (ORF) of 774 bp, and a 3′-UTR of 179 bp. From the ORF, we deduced that PutRUB encoded a 225-amino acid protein with a predicted molecular mass of 27.38 kDa and a theoretical pI of 9.85. The sequence contained an N-terminal signaling peptide with the most likely cleavage site between positions 22 and 23 (SHC-AD).

To study the phylogenetic relationships of PutRUB and other candidate rubredoxin proteins, we selected 31 complete protein sequences from 19 species to construct a phylogenetic tree. These included 13 candidate rubredoxin protein sequences from monocotyledons (3 from Zea mays: NP_001183375, AFW57239, AFW57238; 1 from Triticum urartu: EMS68403; 2 from Hordeum vulgare subsp.vulgare: BAJ94117, BAK07366; 3 from Brachypodium distachyon: XP_003573446, XP_010234369, XP_014756405; 2 from Oryza sativa Japonica Group: XP_015648775, XP_015615806; 2 from Zostera marina: KMZ75006, KMZ59555), 15 candidate proteins from other plants (2 from Medicago truncatula: XP_003610879, XP_013453352; 3 from Arabidopsis thaliana: NP_568342, NP_001078598, NP_568749; 2 from Glycine soja: KHN35119, KHN25601; 1 from Glycine max: NP_001235582; 1 from Eutrema salsugineum: XP_006400247; 1 from Arabidopsis lyrata subsp. lyrata: XP_002871751; 2 from Theobroma cacao: XP_007029491, XP_007038169; 1 from Phaseolus vulgaris: AGV54433; 1 from Populus trichocarpa: XP_002321763; 1 from Arabis alpina: KFK26723) and two from green algae (Synechococcus sp. PCC 7002: AAL78082, Ostreococcus tauri: XP_003080003) (Figure 1a). The results showed that PutRUB had the closest phylogenetic relationship with Z. mays NP_001183375, and had close relationships with most monocotyledonous plants.

Figure 1.

Figure 1

Phylogenetic analysis of PutRUB. (a) Amino acid sequence of PutRUB and phylogenetic trees analysis of 30 rubredoxin family protein sequences in plants; (b) The analysis of the amino acid sequence of PutRUB with rubredoxin family protein in Triticum urartu, Horeum vulgare, Oryza sativa Japonica Group, zea mays, Arabidopsis thaliana and Glycine soja.

Alignment of the amino acid sequence of PutRUB with sequences from T. urartu (EMS68403), H. vulgare subsp. vulgare (BAJ94117), O. sativa Japonica Group XP_015648775), Z. mays (NP_001183375), A. thaliana (AED92391.1) and G. soja (KHN35119) (Figure 1b) suggested PutRUB possessed characteristics common to rubredoxin family proteins in these plants and contained two domains. In the N-terminal region, there is a putative PDZ domain; in the the C-terminus, there is a rubredoxin domain. The PDZ domain is potentially involved in interactions of protein to protein [36,37]. The conserved regions of PutRUB and the phylogenetic tree suggested that PutRUB belonged to the rubredoxin family, but its function have yet to be elucidated.

2.2. Subcellular Localization of the PutRUB: GFP Fusion Protein

To determine the accurate subcellular localization of the PutRUB protein in plant cells, we used transgenic plants containing pBI121-PutRUB-GFP. The GFP signal was stably accumulated in the chloroplast (Figure 2).

Figure 2.

Figure 2

Subcellular localization of PutRUB in Arabidopsis protoplasts. (a) PutRUB: GFP within Arabidopsis protoplasts; (b) GFP within Arabidopsis protoplasts. The protoplasts were stained with MitoTracker Red. Scale bar = 10 µm.

2.3. Expression of the PutRUB Gene Is Induced by Abiotic Stresses

The steady-state mRNA levels of PutRUB in different tissues and under different stresses (NaCl, NaHCO3, CuCl2 and H2O2 treatments) were assayed with Semi-quantitative Polymerase Chain Reaction (RT-PCR) (Figure 3). PutRUB was accumulated in all tissues that we studied (Figure 3a). The highest expression levels were in leaves, while the lowest levels were in roots, indicating that PutRUB expression has tissue specificity. PutRUB was localized in chloroplasts, similarly to a rubredoxin in Synechococcus sp. PCC 7002, and had the highest expression in leaves. The Synechococcus sp. PCC 7002 rubredoxin is localized in chloroplasts and was confirmed to be involved in the building of the interpolypeptide (4Fe–4S) cluster Fx of PSI [38,39]. The above results suggested that PutRUB expression may be associated with photosynthesis.

Figure 3.

Figure 3

Expression pattern of the PutRUB gene by qRT-PCR. (a) PutRUB expression in Puccinellia tenuiflora tissues and PutRUB expression in Puccinellia tenuiflora seedlings under virous abiotic stress; (b) Puccinellia tenuiflora leaves and roots deal with NaCl and NaHCO3 stress.

Previous studies used the PutRUB gene to enhance the resistance of yeast to biotic and abiotic stresses [34]. In this paper, we analyzed the pattern of expression of the PutRUB gene under different abiotic stresses (Figure 3a). All of the stresses induced PutRUB expression, but the highest expression was observed under NaCl and NaHCO3 stresses. Subsequently, the expression of PutRUB was monitored over a time course under NaCl, NaHCO3, CuCl2 and H2O2 stresses (Figure 3b). Figure 3b shows that PutRUB was up-regulated in both roots and leaves by exposure to 200 mM NaCl, 200 mM NaHCO3, 150 µM CuCl2 and 6 mM H2O2, indicating that PutRUB may be involved in responses to these stresses.

2.4. Response to NaCl and NaHCO3 Stress in PutRUB Transgenic Plants

To analyze the function of PutRUB under NaCl and NaHCO3 stresses, we constructed transgenic Arabidopsis plants overexpressing PutRUB under the control of the strong constitutive CaMV 35S promoter. Three independent T1 and T3 generation transgenic A. thaliana lines were identified by PCR amplification and northern blot analysis (Figure 4). The results showed that each of these lines expressed PutRUB. Thus, independent transgenic plants overexpressing PutRUB (#1, #2, #3) were used for assays of the root length and fresh weight.

Figure 4.

Figure 4

Molecular detection of PutRUB in transgenic A. thaliana. (a) PCR amplification T1 transgenic A. thaliana lines (CK+ is plasmids of PutRUB, T1-#1, #2, #3, CK is wild A. thaliana lines); (b) Northern blot was used for examination of T3 transgenic A. thaliana lines.

We analyze the phenotypes (fresh weights and root lengths) of WT and transgenic seedlings in the presence and absence of NaCl and NaHCO3 (Figure 5a–f). Under 1/2MS medium, no differences were observed between the WT and PutRUB transgenic seedlings. When the NaCl and NaHCO3 concentration was increased, the growth of all seedlings was gradually retarded. Under stress treatments (100 and 125 mM NaCl; 1.5 and 3 mM NaHCO3), the root lengths and fresh seedling weights of the transgenic seedlings were significantly higher than those of the WT.

Figure 5.

Figure 5

Phenotypic analyses of PutRUB transgenic plants treated with NaCl, NaHCO3and H2O2. (a) Phenotypes of WT and PutRUB transgenic seedlings treated with 150 and 125 mM NaCl; (b) Effects of NaCl on the root length of wild-type (WT) and PutRUB transgenic plants; (c) Effects of NaCl on fresh weight of wild-type (WT) and PutRUB transgenic plants; (d) Phenotypes of WT and PutRUB transgenic seedlings treated with 1.5 and 13 mM NaHCO3; (e) Effects of NaHCO3 on the root length of wild-type (WT) and PutRUB transgenic plants; (f) Effects of NaHCO3on fresh weight of wild-type (WT) and PutRUB transgenic plants; (g) Phenotypes of WT and PutRUB transgenic seedlings treated with 2 and 14 mM H2O2; (h) Effects of H2O2 on the root length of wild-type (WT) and PutRUB transgenic plants; (i) Effects of H2O2 on fresh weight of wild-type (WT) and PutRUB transgenic plants. Single and double asterisks represent significant differences from WT at p < 0.05 and p < 0.01, respectively.

Salt and alkali stress are major abiotic stresses. To adapt to these stresses, plants have developed some sophisticated mechanisms to sense external pressure signals. Plants can change their physiological and morphological characteristics to adapt to adversity [9,40]. Multiple stresses often induce the same cell signal transduction pathways. All of these stresses will lead to a common adverse effect that is oxidative stress [41,42,43,44]. When transgenic lines were exposed to H2O2, they showed much better root and leaf growth than the WT, and their fresh weights and root lengths were higher than those of the WT (Figure 5g–i). Thus, we suspect PutRUB may play a vital role in reducing the damage from H2O2.

2.5. PutRUB Is Involved in Reducing of Reactive Oxygen Species (ROS) Detoxification

Staining with nitroblue tetrazolium (NBT) specifically tests superoxide radicals. NBT staining demonstrated that dealing with NaCl and NaHCO3 induced O2 accumulation in the leaves of PutRUB transgenic lines and WT plants (Figure 6a). In the presence of 100 and 125 mM NaCl, and 1.5 and 3 mM NaHCO3, less O2 was accumulated in the leaves of PutRUB plants than in the WT. We obtained similar results for measurements of H2O2 content. As shown in Figure 6b, under NaCl and NaHCO3 stresses, H2O2 accumulation in PutRUB transgenic lines was lower than in WT plants. These results suggest that PutRUB is involved in decreasing H2O2 accumulation in plants and plays important roles in response to NaCl stress and NaHCO3 stress.

Figure 6.

Figure 6

Physiological analyses of PutRUB transgenic seedlings treated with NaCl and NaHCO3. (a) Visualization of O2 by NBT staining in leaves of 3-week old transgenic seedlings treated in 1/2MS, 125 mM NaCl and 3 mM NaHCO3 for 12 h. The blue color represents the accumulation of O2; (b) H2O2 contents of 3-week-old transgenic seedlings treated with 1/2MS, 125 mM NaCl and 3 mM NaHCO3for 24 h. Experiments were repeated three times. Single and double asterisks represent significant differences from WT at p < 0.05 and p < 0.01, respectively.

Previous reports have shown that when plants are exposed to NaCl stress or oxidative stress, H2O2 and superoxide anions increase, injuring the plant cells [45]. Rubredoxins from Pyrococcus furiosus and Desulfovibrio vulgaris play an important role in sharp contrast to the role of superoxide dismutase, effectively reducing damage from O2 in superoxide detoxification [31,32,33]. AtRUB (At5g17170) plays an important role in the control of ROS detoxification in response to NaCl stress [37]. These results all show that rubredoxins are key players in plant tolerance and responses to oxidative stress. Rubredoxins are electron carriers for various enzymes that reduce the damage from oxidative stress and protect the normal microbial life cycle [30,31,46]. Therefore, we assume that PutRUB maintains normal electron transfer to enhance transgenic plant tolerance and reduce ROS accumulation under NaCl and NaHCO3 stresses.

3. Materials and Methods

3.1. Plant Materials and Stress Treatments

Wild-type of P. tenuiflora plants, organs/tissues (roots, stems, leaves, flowers and seeds) and mature seeds were collected from the AnDA experimental base of the Alkali Soil Natural Environmental Science Center (ASNESC), Northeast Forestry University (Harbin, China) in Songnen Plain in Northeast China. Plants were germinated in water for 3 weeks before stress treatments. Plants were harvested at 6, 12, 24 and 48 h after stress treatments and preserved at −80 °C for real-time PCR.

3.2. Phylogenetic Analysis

All protein sequences used for multiple alignments and phylogenetic analysis were extracted from the NCBI non-redundant protein sequences (nr) database using Blastp searches with an e-value cutoff of 1.0 × 10−6. The results were used to retrieve proteins with high similarity to the PutRUB protein. Then, we used CD search (PMID: 25414356) to analyze the conserved domains within these proteins [47]. Proteins with PDZ/PDZ signaling superfamily or rubredoxin-like superfamily domains were used for further analysis. Alignments of the protein sequences were created with ClustalW (ref) (European Molecular Biology Laboratory, Heidelberg, Germany) using the following parameters: gap opening penalty 10, gap extension penalty 0.2. An unrooted phylogenetic tree was constructed with MEGA 6 (Molecular Evolutionary Genetics Analysis version 6.0, Research Center for Genomics and Bioinformatics, Tokyo Metropolitan University, Hachioji, Tokyo, Japan.) using the maximum likelihood method, and analyses were analysis using the Poisson correction model [48]. We used Gamma distribution to model rate variation sites with shape parameter = 1 distribution to model rate variation sites (shape parameter = 1).

3.3. Constructs

The ORF of PutRUB was amplified from the P. tenuiflora cDNA library using the primers PutRUB-F and PutRUB-R. The gene was cloned using PutRUB-YE, PB-F and PutRUB-YE, PB-R (Table 1). The amplified product was digested with BamHI and XhoI, cloned into the plant expression vector pBI121 then sequenced, which was used for subsequent analysis.

Table 1.

All primers used for PCR analysis.

Primers Name Sequences (5′→3′)
PutRUB-F ATGGCTGCCACGCTCTCCTCTGT
PutRUB-R CTATTGCAGGCCATATACAAGCAG
PutRUB-YE,PB-F GGATCCATGGCTGCCACGCTCTCCTCTGT
PutRUB-YE,PB-R CTCGAGCTATTGCAGGCCATATACAAGCAG
PutRUB-GFP-FW GGTACCATGGCTGCCACGCTCTCCTCTGT
PutRUB-GFP-RV GGATCCTTGCAGGCCATATACAAGCAG
PutRUB-QPCR-F GTTCACCAAGACAGCCATCCAG
PutRUB-QPCR-R CAGTCAGCTTCCGTCCAAATCG
Put-Tubulin-F GTGTCAGCCATACTGTGCCAATC
Put-Tubulin-R TTGCTCATGCGGTCAGCAATACC

To construct GFP fusion proteins, PutRUB was amplified with the primers PutRUB-GFP-FW and PutRUB-GFP-RV (Table 1). The amplified product without the stop codon was digested with BamHI and KpnI, and cloned into the pEGFP vector (Invitrogen, Carlsbad, CA, USA). The constructed plasmid pEGFP-PutRUB-GFP was digested with BamHI and EcoRI, and cloned into the pYES2 vector to obtain the plasmid pYES2-PutRUB-GFP. Then the product was digested with BamHI and SacI, and cloned into the pBI121 vector to obtain the plasmid pBI121-PutRUB-GFP.

The constructs pBI121-PutRUB, pBI121-PutRUB-GFP and pBI121-GFP (control) were used to generate transgenic Arabidopsis by the floral dip method [49].

3.4. Subcellular Localization Assay

pBI121-GFP and pBI121-PutRUB-GFP were stably transformed into Arabidopsis. Protoplasts were extracted from transgenic leaves as described in [50]. An Axio Vision fluorescent microscopy system (Axio Imager Z2, Zeiss, Germany) was used to observe fluorescence.

3.5. Quantitative Real-Time PCR

Total RNA was extracted by TRIzol reagent (Invitrogen) and cDNA was synthesized with PrimeScript Reverse Transcriptase (Takara Bio, Shiga, Japan) used oligo dT as primer, referring to the manufacturer’s instructions. The cDNA were diluted 5 times with double distilled water for quantitative real-time PCR (qRT-PCR) as templates, with the primers: PutRUB-QPCR-F and PutRUB-QPCR-R1; Put-Tubulin-F and Put-Tubulin-R. The cDNA was amplified using TransStart Top Green qPCR SuperMix (TransGen Biotech) on a Stratagene Mx3000P QCR system (Agilent Technologies, Cold Spring, NY, USA).The comparative CT method was used to calculated relative expression levels, with the PutTubulin gene as an internal control.

3.6. Stress Response Analysis in Transgenic Arabidopsis

The plasmid pBI121-PutRUB was transformed into Arabidopsis by A. tumefaciens-mediated floral dipping. We isolated T0-generation seeds of A. thaliana on 1/2MS medium containing 50 mg·L−1 kanamycin, then collected T3 transgenic lines (T3 #1, #2, and #3). Transgenic seedlines were identified by PCR and northern blotting. The CTAB method were used to extract plant genomic DNA [51].

For abiotic stress treatment, WT and T3 generation transgenic Arabidopsis seeds were grown on 1/2MS agar plates for 7 days. The seedlings were then transferred to 1/2MS medium supplemented with different chemicals for stress treatments (100 and 125 mM NaCl, 1.5 and 3 mM NaHCO3, 2 and 4 mM H2O2); 1/2MS medium was used as a control. The seedlings were allowed to grow for 10 days (vertical culture, 16/8 h light/dark, temperature 22/18 °C), after which the fresh weights and root growth of the seedlings were measured. Statistical analyses were carried out using Student’s t-test.

3.7. ROS Detection

Three-week-old transgenic T2 generation seedlings of the PutRUB were cultivated on 1/2MS medium containing 125 mM NaCl and 3 mM NaHCO3 for 12 h at 22 °C, and the in situ accumulation of O2 was determined by histochemical staining with NBT. Briefly, in an amber-colored bottle, 0.1 g NBT was dissolved in 50 mM sodium phosphate buffer (pH 7.5) and the volume was increased up to 50 mL to get a 0.2% solution. The solution was mixed thoroughly using a magnetic stirrer. The NBT staining solution was prepared fresh before use. The seedlings were placed in test tubes and immersed in NBT staining solution to detect H2O2. The tubes were wrapped with aluminum foil and keep overnight at room temperature. Then, the chlorophyll was removed for proper visualization of the stain. This was done by immersing the seedlings in absolute ethanol and heating in a boiling water-bath for 10 min (or more if necessary, with intermittent shaking [52].

H2O2 levels were quantified by the absorbance at a wavelength of 415 nm using titanium sulfate precipitation as described in [53].

4. Conclusions

Here, we revealed that a chloroplast-localized rubredoxin family protein from P. tenuiflora might be involved in the plant response to environmental stresses. PutRUB overexpression increased growth and inhibited H2O2 accumulation under NaCl and NaHCO3 treatments. Our results indicate that PutRUB might be involved in maintaining normal electron transfer to enhance transgenic plant adaptability to adversity and reduce ROS accumulation under NaCl and NaHCO3 stresses.

Acknowledgments

This work was supported by the Heilongjiang Postdoctoral Scientific Research Developmental Fund (LBH-Q15010), Natural Science Foundation of Heilongjiang Provine (C201406), Fundamental Research Funds for the Central Universities (2572014BA20), the Open Project of Key Laboratory of Crop Germplasm Improvement and Cultivation in Cold Regions of Heilongjiang province (CGIC201204) and the Program for Changjiang Scholars and Innovative Research Team in University (IRT13053).

Author Contributions

Ying Li and Shenkui Liu conceived and designed the experiments; Ying Li performed the experiments; Ying Li analyzed the data; Panpan Liu contributed reagents/materials/analysis tools; Ying Li wrote the manuscript. Shenkui Liu, Tetsuo Takano revised and final approval of the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  • 1.Munns R., Tester M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008;59:651–681. doi: 10.1146/annurev.arplant.59.032607.092911. [DOI] [PubMed] [Google Scholar]
  • 2.Parida A.K., Das A.B. Salt tolerance and salinity effects on plants: A review. Ecotoxicol. Environ. Saf. 2005;60:324–349. doi: 10.1016/j.ecoenv.2004.06.010. [DOI] [PubMed] [Google Scholar]
  • 3.Tuteja N. Mechanisms of high salinity tolerance in plants. Methods Enzymol. 2007;428:419–438. doi: 10.1016/S0076-6879(07)28024-3. [DOI] [PubMed] [Google Scholar]
  • 4.Wang L., Seki K., Miyazaki T., Ishihama Y. The causes of soil alkalinization in the songnen plain of northeast china. Paddy Water Environ. 2009;7:259–270. doi: 10.1007/s10333-009-0166-x. [DOI] [Google Scholar]
  • 5.Zhang L.M., Liu X.G., Qu X.N., Yu Y., Han S.P., Dou Y., Xu Y.Y., Jing H.C., Hao D.Y. Early transcriptomic adaptation to Na2CO3 stress altered the expression of a quarter of the total genes in the maize genome and exhibited shared and distinctive profiles with nacl and high pH stresses. J. Integr. Plant Biol. 2013;55:1147–1165. doi: 10.1111/jipb.12100. [DOI] [PubMed] [Google Scholar]
  • 6.Chen W., Cui P., Sun H., Guo W., Yang C., Jin H., Fang B., Shi D. Comparative effects of salt and alkali stresses on organic acid accumulation and ionic balance of seabuckthorn (Hippophae rhamnoides L) Ind. Crops Prod. 2009;30:351–358. doi: 10.1016/j.indcrop.2009.06.007. [DOI] [Google Scholar]
  • 7.Miller G., Suzuki N., Ciftci-Yilmaz S., Mittler R. Reactive oxygen species homeostasis and signalling during drought and salinity stresses. Plant Cell Environ. 2010;33:453–467. doi: 10.1111/j.1365-3040.2009.02041.x. [DOI] [PubMed] [Google Scholar]
  • 8.Zhang X., Wei L., Wang Z., Wang T. Physiological and molecular features of Puccinellia tenuiflora tolerating salt and alkaline-salt stress. J. Integr. Plant Biol. 2013;55:262–276. doi: 10.1111/jipb.12013. [DOI] [PubMed] [Google Scholar]
  • 9.Zhu J.K. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 2002;53:247–273. doi: 10.1146/annurev.arplant.53.091401.143329. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Yu J., Chen S., Zhao Q., Wang T., Yang C., Diaz C., Sun G., Dai S. Physiological and proteomic analysis of salinity tolerance in Puccinellia tenuiflora. J. Proteome Res. 2011;10:3852–3870. doi: 10.1021/pr101102p. [DOI] [PubMed] [Google Scholar]
  • 11.Guo L.Q., Shi D.C., Wang D.L. The key physiological response to alkali stress by the alkali-resistant halophyte Puccinellia tenuiflora is the accumulation of large quantities of organic acids and into the rhyzosphere. J. Agron. Crop Sci. 2010;196:123–135. doi: 10.1111/j.1439-037X.2009.00397.x. [DOI] [Google Scholar]
  • 12.Guorong S., Yongzhen P., Hongbo S., Liye C., Xining Z., Haiyan M., Wenzhong C., Cunxu W. Does puccinelia tenuiflora have the ability of salt exudation? Colloids Surf. B Biointerfaces. 2005;46:197–203. doi: 10.1016/j.colsurfb.2005.11.003. [DOI] [PubMed] [Google Scholar]
  • 13.Peng Y.H., Zhu Y.F., Mao Y.Q., Wang S.M., Su W.A., Tang Z.C. Alkali grass resists salt stress through high [K+] and an endodermis barrier to Na+ J. Exp. Bot. 2004;55:939–949. doi: 10.1093/jxb/erh071. [DOI] [PubMed] [Google Scholar]
  • 14.Wang C.M., Zhang J.L., Liu X.S., Li Z., Wu G.Q., Cai J.Y., Flowers T.J., Wang S.M. Puccinellia tenuiflora maintains a low Na+ level under salinity by limiting unidirectional Na+ influx resulting in a high selectivity for K+ over Na+ Plant Cell Environ. 2009;32:486–496. doi: 10.1111/j.1365-3040.2009.01942.x. [DOI] [PubMed] [Google Scholar]
  • 15.Wang Y., Sun G., Suo B., Chen G., Wang J., Yan Y. Effects of Na2CO3 and NaCl stresses on the antioxidant enzymes of chloroplasts and chlorophyll fluorescence parameters of leaves of Puccinellia tenuiflora (Turcz.) scribn.et Merr. Acta Physiol. Plant. 2008;30:143–150. doi: 10.1007/s11738-007-0102-x. [DOI] [Google Scholar]
  • 16.Ardie S.W., Liu S., Takano T. Expression of the AKT1-type K+ channel gene from Puccinellia tenuiflora, putakt1, enhances salt tolerance in Arabidopsis. Plant Cell Rep. 2010;29:865–874. doi: 10.1007/s00299-010-0872-2. [DOI] [PubMed] [Google Scholar]
  • 17.Ardie S.W., Nishiuchi S., Liu S., Takano T. Ectopic expression of the K+ channel β subunits from Puccinellia tenuiflora (KPutB1) and rice (KOB1) alters K+ homeostasis of yeast and Arabidopsis. Mol. Biotechnol. 2011;48:76–86. doi: 10.1007/s12033-010-9349-3. [DOI] [PubMed] [Google Scholar]
  • 18.Ardie S.W., Xie L., Takahashi R., Liu S., Takano T. Cloning of a high-affinity K+ transporter gene PutHKT2;1 from Puccinellia tenuiflora and its functional comparison with OsHKT2;1 from rice in yeast and Arabidopsis. J. Exp. Bot. 2009;60:3491–3502. doi: 10.1093/jxb/erp184. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Chang-Qing Z., Shunsaku N., Shenkui L., Tetsuo T. Characterization of two plasma membrane protein 3 genes (PutPMP3) from the alkali grass, Puccinellia tenuiflora, and functional comparison of the rice homologues, OsLti6a/b from rice. BMB Rep. 2008;41:448–454. doi: 10.5483/BMBRep.2008.41.6.448. [DOI] [PubMed] [Google Scholar]
  • 20.Liu H., Zhang X., Takano T., Liu S. Characterization of a PutCAX1 gene from Puccinellia tenuiflora that confers Ca2+ and Ba2+ tolerance in yeast. Biochem. Biophys. Res. Commun. 2009;383:392–396. doi: 10.1016/j.bbrc.2009.04.042. [DOI] [PubMed] [Google Scholar]
  • 21.Wang X., Yang R., Wang B., Liu G., Yang C., Cheng Y. Functional characterization of a plasma membrane Na+/H+ antiporter from alkali grass (Puccinellia tenuiflora) Mol. Biol. Rep. 2011;38:4813–4822. doi: 10.1007/s11033-010-0624-y. [DOI] [PubMed] [Google Scholar]
  • 22.Cheng H., Markley J.L. NMR spectroscopic studies of paramagnetic proteins: Iron-sulfur proteins. Annu. Rev. Biophys. Biomol. Struct. 1995;24:209–237. doi: 10.1146/annurev.bb.24.060195.001233. [DOI] [PubMed] [Google Scholar]
  • 23.Lovenberg W., Sobel B.E. Rubredoxin: A new electron transfer protein from clostridium pasteurianum. Proc. Natl. Acad. Sci. USA. 1965;54:193–199. doi: 10.1073/pnas.54.1.193. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Terpolilli P.J.A., Coon M.J. Enzymatic omega-oxidation. 3. Purification and properties of rubredoxin, a component of the omega-hydroxylation system of Pseudomonas oleovorans. J. Biol. Chem. 1968;243:329–334. [PubMed] [Google Scholar]
  • 25.Klenk H.P., Clayton R.A., Tomb J.F., White O., Nelson K.E., Ketchum K.A., Dodson R.J., Gwinn M., Hickey E.K., Peterson J.D., et al. The complete genome sequence of the hyperthermophilic, sulphate-reducing archaeon Archaeoglobus fulgidus. Nature. 1997;390:364–370. doi: 10.1038/37052. [DOI] [PubMed] [Google Scholar]
  • 26.Das Gracas D.A., Ramos R.T.J., Araujo A.C.V., Zahlouth R., Carneiro A.R., Lopes T.S., Barauna R.A., Azevedo V., Schneider M.P.C., Pellizari V.H., et al. Complete genome of a methanosarcina mazei strain isolated from sediment samples from an amazonian flooded area. Genome Announc. 2013;1:804. doi: 10.1128/genomeA.00271-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Terpolilli J., Hill Y., Tian R., Howieson J., Brau L., Goodwin L., Han J., Liolios K., Huntemann M., Pati A., et al. Genome sequence of ensifer meliloti strain wsm1022; A highly effective microsymbiont of the model legume medicago truncatula a17. Stand. Genom. Sci. 2013;9:315–324. doi: 10.4056/sigs.4608286. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Park I.Y., Eidsness M.K., Lin I.J., Gebel E.B., Youn B., Harley J.L., Machonkin T.E., Frederick R.O., Markley J.L., Smith E.T., et al. Crystallographic studies of v44 mutants of clostridium pasteurianum rubredoxin: Effects of side-chain size on reduction potential. Proteins Struct. Funct. Bioinform. 2004;57:618–625. doi: 10.1002/prot.20243. [DOI] [PubMed] [Google Scholar]
  • 29.Hagelueken G., Wiehlmann L., Adams T.M., Kolmar H., Heinz D.W., Tummler B., Schubert W.D. Crystal structure of the electron transfer complex rubredoxin rubredoxin reductase of pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA. 2007;104:12276–12281. doi: 10.1073/pnas.0702919104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Chen L., Liu M.Y., LeGall J., Fareleira P., Santos H., Xavier A.V. Rubredoxin oxidase, a new flavo-hemo-protein, is the site of oxygen reduction to water by the “strict anaerobe” desulfovibrio gigas. Biochem. Biophys. Res. Commun. 1993;193:100–105. doi: 10.1006/bbrc.1993.1595. [DOI] [PubMed] [Google Scholar]
  • 31.Coulter E.D., Kurtz D.M., Jr. A role for rubredoxin in oxidative stress protection in desulfovibrio vulgaris: Catalytic electron transfer to rubrerythrin and two-iron superoxide reductase. Arch. Biochem. Biophys. 2001;394:76–86. doi: 10.1006/abbi.2001.2531. [DOI] [PubMed] [Google Scholar]
  • 32.Jenney F.E., Verhagen M.F.J.M., Cui X., Adams M.W.W. Anaerobic microbes: Oxygen detoxification without superoxide dismutase. Science. 1999;286:306–309. doi: 10.1126/science.286.5438.306. [DOI] [PubMed] [Google Scholar]
  • 33.Blake P.R., Park J.B., Bryant F.O., Aono S., Magnuson J.K., Eccleston E., Howard J.B., Summers M.F., Adams M.W.W. Determinants of protein hyperthermostability: Purification and amino acid sequence of rubredoxin from the hyperthermophilic archaebacterium pyrococcus furiosus and secondary structure of the zinc adduct by NMR. Biochemistry. 1991;30:10885–10895. doi: 10.1021/bi00109a012. [DOI] [PubMed] [Google Scholar]
  • 34.Li Y., Takano T., Liu S. Discovery and characterization of two novel salt-tolerance genes in Puccinellia tenuiflora. Int. J. Mol. Sci. 2014;15:16469–16483. doi: 10.3390/ijms150916469. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yu J., Chen S., Wang T., Sun G., Dai S. Comparative proteomic analysis of Puccinellia tenuiflora leaves under Na2CO3 stress. Int. J. Mol. Sci. 2013;14:1740–1762. doi: 10.3390/ijms14011740. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Meyer J. Iron-sulfur protein folds, iron-sulfur chemistry, and evolution. J. Biol. Inorg. Chem. 2008;13:157–170. doi: 10.1007/s00775-007-0318-7. [DOI] [PubMed] [Google Scholar]
  • 37.Zhu J., Fu X., Koo Y.D., Zhu J.K., Jenney F.E., Jr., Adams M.W., Zhu Y., Shi H., Yun D.J., Hasegawa P.M., et al. An enhancer mutant of Arabidopsis salt overly sensitive 3 mediates both ion homeostasis and the oxidative stress response. Mol. Cell. Biol. 2007;27:5214–5224. doi: 10.1128/MCB.01989-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Shen G., Antonkine M.L., van der Est A., Vassiliev I.R., Brettel K., Bittl R., Zech S.G., Zhao J., Stehlik D., Bryant D.A., et al. Assembly of photosystem I. II. Rubredoxin is required for the in vivo assembly of Fx in synechococcus sp. PCC 7002 as shown by optical and EPR spectroscopy. J. Biol. Chem. 2002;277:20355–20366. doi: 10.1074/jbc.M201104200. [DOI] [PubMed] [Google Scholar]
  • 39.Shen G., Zhao J., Reimer S.K., Antonkine M.L., Cai Q., Weiland S.M., Golbeck J.H., Bryant D.A. Assembly of photosystem I. I. Inactivation of the rubA gene encoding a membrane-associated rubredoxin in the cyanobacterium Synechococcus sp. PCC 7002 causes a loss of photosystem I activity. J. Biol. Chem. 2002;277:20343–20354. doi: 10.1074/jbc.M201103200. [DOI] [PubMed] [Google Scholar]
  • 40.Shinozaki K., Yamaguchi-Shinozaki K. Molecular responses to dehydration and low temperature: Differences and cross-talk between two stress signaling pathways. Curr. Opin. Plant Biol. 2000;3:217–223. doi: 10.1016/S1369-5266(00)00067-4. [DOI] [PubMed] [Google Scholar]
  • 41.Dat J., Vandenabeele S., Vranova E., Van Montagu M., Inze D., Van Breusegem F. Dual action of the active oxygen species during plant stress responses. Cell. Mol. Life Sci. 2000;57:779–795. doi: 10.1007/s000180050041. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Foyer C.H., Noctor G. Oxidant and antioxidant signalling in plants: A re-evaluation of the concept of oxidative stress in a physiological context. Plant Cell Environ. 2005;28:1056–1071. doi: 10.1111/j.1365-3040.2005.01327.x. [DOI] [Google Scholar]
  • 43.Gomez J.M., Hernandez J.A., Jimenez A., del Rio L.A., Sevilla F. Differential response of antioxidative enzymes of chloroplasts and mitochondria to long-term nacl stress of pea plants. Free Radic. Res. 1999;31:S11–S18. doi: 10.1080/10715769900301261. [DOI] [PubMed] [Google Scholar]
  • 44.Pawlak-Sprada S., Arasimowicz-Jelonek M., Podgorska M., Deckert J. Activation of phenylpropanoid pathway in legume plants exposed to heavy metals. Part I. Effects of cadmium and lead on phenylalanine ammonia-lyase gene expression, enzyme activity and lignin content. Acta Biochim. Pol. 2011;58:211–216. [PubMed] [Google Scholar]
  • 45.Laloi C., Mestres-Ortega D., Marco Y., Meyer Y., Reichheld J.P. The Arabidopsis cytosolic thioredoxin h5 gene induction by oxidative stress and its W-box-mediated response to pathogen elicitor. Plant Physiol. 2004;134:1006–1016. doi: 10.1104/pp.103.035782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Auchere F., Sikkink R., Cordas C., Raleiras P., Tavares P., Moura I., Moura J.J. Overexpression and purification of treponema pallidum rubredoxin; kinetic evidence for a superoxide-mediated electron transfer with the superoxide reductase neelaredoxin. J. Biol. Inorg. Chem. 2004;9:839–849. doi: 10.1007/s00775-004-0584-6. [DOI] [PubMed] [Google Scholar]
  • 47.Marchler-Bauer A., Derbyshire M.K., Gonzales N.R., Lu S., Chitsaz F., Geer L.Y., Geer R.C., He J., Gwadz M., Hurwitz D.I., et al. CDD: NCBI’S conserved domain database. Nucleic Acids Res. 2015;43:D222–D226. doi: 10.1093/nar/gku1221. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Zuckerkandl E., Pauling L. Evolutionary divergence and convergence in proteins a2-bryson, vernon. In: Vogel H.J., editor. Evolving Genes and Proteins. Academic Press; San Jose, CA, USA: 1965. pp. 97–166. [Google Scholar]
  • 49.Clough S.J., Bent A.F. Floral dip: A simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. Cell Mol. Biol. 1998;16:735–743. doi: 10.1046/j.1365-313x.1998.00343.x. [DOI] [PubMed] [Google Scholar]
  • 50.Yoo S.D., Cho Y.H., Sheen J. Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis. Nat. Protoc. 2007;2:1565–1572. doi: 10.1038/nprot.2007.199. [DOI] [PubMed] [Google Scholar]
  • 51.Sambrook J., Russell D.W., Sambrook J. The Condensed Protocols from Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press; Cold Spring Harbor, NY, USA: 2006, 800p. [Google Scholar]
  • 52.Hoffmann A., Hammes E., Plieth C., Desel C., Sattelmacher B., Hansen U.P. Effect of CO2 supply on formation of reactive oxygen species in Arabidopsis thaliana. Protoplasma. 2005;227:3–9. doi: 10.1007/s00709-005-0133-3. [DOI] [PubMed] [Google Scholar]
  • 53.Nag S., Saha K., Choudhuri M.A. A rapid and sensitive assay method for measuring amine oxidase based on hydrogen peroxide-titanium complex formation. Plant Sci. Int. J. Exp. Plant Biol. 2000;157:157–163. doi: 10.1016/S0168-9452(00)00281-8. [DOI] [PubMed] [Google Scholar]

Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES