Skip to main content
Breast Cancer : Basic and Clinical Research logoLink to Breast Cancer : Basic and Clinical Research
. 2016 Jul 4;10:85–91. doi: 10.4137/BCBCR.S39649

Association Between Vascular Endothelial Growth Factor Gene Polymorphisms with Breast Cancer Risk in an Iranian Population

Maryam Rezaei 1,2, Mohammad Hashemi 1,2,✉, Sara Sanaei 2, Mohammad Ali Mashhadi 3, Mohsen Taheri 4
PMCID: PMC4933538  PMID: 27398026

Abstract

Breast cancer (BC) is one of the most causes of death in women worldwide. It affects Iranian female population approximately a decade earlier than those in other parts of the world. Previous studies have shown that vascular endothelial growth factor (VEGF) gene variants were associated with BC risk. The current study aimed to evaluate the impact of VEGF rs3025039 (+936C>T), rs2010963 (+405C>G), rs833061 (-460T>C), rs699947 (-2578C>A), and rs35569394 (18-bp I/D) polymorphisms on BC risk in an Iranian population in southeast of Iran. This case–control study was done on 250 BC patients and 215 healthy women. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) or PCR was used to genotype the polymorphisms. Our findings showed that VEGF rs699947 variant increased the risk of BC (OR = 1.71, 95% CI = 1.15–2.54, P = 0.009, CA vs CC; OR = 2.12, 95% CI = 1.14–3.93, P = 0.021, AA vs CC; OR = 1.78, 95% CI = 1.22–2.60, P = 0.004, CA+AA vs CC; OR = 1.47, 95% CI = 1.12–1.92, P = 0.005, A vs C). The VEGF rs3025039, rs2010963, rs833061, and rs35569394 variants were not associated with risk/protection of BC. In conclusion, our results proposed that VEGF rs699947 polymorphism may increase the risk of BC development. Furthers studies with larger sample sizes and different ethnicities are necessary to confirm our findings.

Keywords: vascular endothelial growth factor, VEGF, breast cancer, polymorphism

Introduction

Breast cancer (BC) is one of the most prevalent malignancies in women worldwide, which affects more than 1 million women annually.1,2 It comprises 21.4% of all cancers among Iranian females. Although the etiology of BC is entirely unknown, there is abundant evidence that genetic factors play key roles in the pathogenesis and progression of BC.3–6

The human VEGF gene is located on the short arm of chromosome 6 (6p12–p21) and consists of eight exons separated by seven introns that exhibit alternative splicing to form a family of proteins.7 VEGF, also known as VEGFA, is an important regulator of physiological angiogenesis during embryogenesis, skeletal growth, and reproduction functions. It is also involved in pathological angiogenesis associated with tumors.8,9 Angiogenesis is an important step in the development of cancer and is necessary for primary tumor growth, invasiveness, and metastases.8 Overexpression of VEGF was found in several tumor tissues.10–12 Breast cancer is among the well-known malignancies involving lymphangiogenesis, which is the recruitment of blood and lymphatic vessels, to a growing tumor.13 Evidence from in vitro and in vivo studies has shown that increased expression of VEGF is associated with tumor growth and metastasis. Moreover, the inhibition of VEGF signaling results in suppression of tumor-induced angiogenesis as well as tumor growth.14

Single nucleotide polymorphisms (SNPs) in the promoter, intron, exon, or untranslated regions (3′- and 5′-UTR) may affect the production or function of the corresponding protein. A number of SNPs have been designated in the VEGF gene, which have been described to be associated with differential VEGF expression.15–18 Two of these SNPs are located in the VEGF promoter region (−2578 and −1154),15,18 one SNP (+405) in exon 1 of the VEGF gene16 and a further SNP (+936) located in exon 8, corresponding to the 3′UTR region of the gene.17 In addition, other SNPs have also been defined, although an association with VEGF expression has not been revealed.16

Several studies investigated the VEGF genetic polymorphisms in BC in different ethnic groups and led to different conclusions.19–27 To the best of our knowledge, there are no reports concerning the impact of VEGF polymorphisms on BC risk in Iranian women. Hence, this study aimed to evaluate the possible association between VEGF rs3025039 (+936C>T), rs2010963 (+405C>G), rs833061 (−460T>C), rs699947 (−2578C>A), and rs35569394 (18-bp I/D) polymorphisms with risk/protection of BC in an Iranian population.

Patients and Methods

Patients

This population-based case–control study was done on 250 histologically confirmed BC patients admitted to Ali Ebneh Abitaleb Hospital (Iran) and 215 age-matched healthy women with no history of any types of cancer and not related to the patients.

The local ethics committee of Zahedan University of Medical Sciences approved the study, and written informed consent was obtained from all the subjects before enrollment. The research complied with the principles of the Declaration of Helsinki. Blood samples were collected from participants in tubes containing EDTA, and genomic DNA was extracted by the use of salting-out method.28

Genotyping

Genotyping of VEGF variants was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) or PCR methods. The primers used for detection of polymorphisms are listed in Table 1. PCR was done using commercially available Prime Taq premix (GeNet Bio, South Korea) according to the manufacturer’s recommended protocol. In each 0.20-mL PCR reaction tube, 1 μL of genomic DNA (~100 ng/mL), 1 μL of each primer (10 μM), 10 μL of 2X Prime Taq Premix, and appropriate amount of ddH2O were added. The PCR-cycling conditions were 5 minutes at 95°C, followed by 30 cycles of 30 seconds at 95°C, 30 seconds at 62°C for rs2010936, 63°C for rs3025039 and rs833061, 61°C for rs699947, 60°C for rs35569394, and 30 seconds at 72°C with a final extension step of 72°C for 5 min. The 10-μL of PCR product was digested by appropriate restriction enzymes (Table 1). The PCR products were electrophoresed on agarose gel containing 0.5 μg/mL ethidium bromide and visualized on a UV transilluminator.

Table 1.

Primers and restriction enzymes used in PCR-RFLP analysis for detection of VEGF polymorphisms.

VEGF POLYMORPHISMS PRIMER SEQUENCE (5′–>3′) RESTRICTION ENZYME FRAGMENT (bp)
+936C>T (rs3025039) F: ACACCATCACCATCGACAGA Hin1II C allele, 443; T allele, 311 + 132
R: TCTCCTCCTCTTCCCTGTCA
−460T>C (rs833061) F: TGAGTGTGTGCGTGTGGGGTTGAGCG HinpI T allele, 162; C allele, 137 + 25
R: AGAGCCGTTCCCTCTTTGCTAG
−2578C>A (rs699947) F: GGCCTTAGGACACCATACC BstyI C allele, 455; A allele, 209 +246
R: CACAGCTTCTCCCCTATCC
+405C/G (rs2010963) TTGCTTGCCATTCCCCACTTGA FaqI C allele, 469; G allele, 272 + 197
CCGAAGCGAGAACAGCCCAGAA
18-bp I/D (rs35569394) AAGATCTGGGTGGATAATCAGACT – I allele, 188; D allele, 170
AACTCTCCACATCTTCCCTAAGTG

To verify genotyping quality for each polymorphism, ~20% of random samples were regenotyped and the results confirmed the preceding genotyping outcomes.

Statistical analysis

The statistical analysis was done with statistical package SPSS version 20. Cases and controls were compared by chi-square test for categorical data or independent Student’s t-test for continuous data. The association between each variant and BC was evaluated by computing the odds ratio (OR) and 95% confidence interval (95% CI) from unconditional logistic regression analyses. For the cases, the chi-square test was used to estimate the association between each variant and the clinicopathological characteristics. Haplotype analysis was done using SNPStats software.29 The statistical level of significance was defined as P < 0.05.

Results

The study group consisted of 250 BC patients with an average age of 48.7 ± 11.0 years and 215 healthy women with a mean age of 50.4 ± 13.1 years. There was no significant difference between the groups concerning age (P = 0.144).

The genotype and allelic frequency of VEGF polymorphisms are listed in Table 2. The findings indicated that VEGF rs699947 variant increased the risk of BC in codominant (OR = 1.71, 95% CI = 1.15–2.54, P = 0.009, CA vs CC; OR = 2.12, 95% CI = 1.14–3.93, P = 0.021, AA vs CC) and dominant (OR = 1.78, 95% CI = 1.22–2.60, P = 0.004, CA+AA vs CC) inheritance models tested. The A allele increased the risk of BC (OR = 1.47, 95% CI = 1.12–1.92, P = 0.005) when compared with C allele. We found that the genotype and allele frequencies of VEGF rs3025039, rs2010963, rs833061, and rs35569394 variants were not associated with risk/protection of BC in our population.

Table 2.

VEGF gene polymorphisms in BC patients and control subjects.

POLYMORPHISMS BREAST CANCER n (%) CONTROL n (%) OR (95% CI) P-VALUE
rs3025039 (+936C>T)
Codominant
 CC 179 (71.6) 159 (74.0) 1.00 –
 CT 67 (26.8) 52 (24.2) 1.14 (0.75–1.74) 0.593
 TT 4 (1.6) 4 (1.8) 0.89 (0.22–3.61) 0.897
Dominant
 CC 179 (71.6) 159 (74.0) 1.00 –
 CT+TT 71 (28.4) 56 (26.0) 1.13 (0.75–1.70) 0.603
Recessive
 CC+CT 256 (98.4) 211 (98.2) 1.00 –
 TT 4 (1.6) 4 (1.8) 0.82 (0.20–3.33) 0.830
Allele
 C 425 (85.0) 370 (86.0) 1.00 –
 T 75 (15.0) 60 (14.0) 1.09 (0.75–1.57) 0.709
rs2010963 (+405C>G)
Codominant
 GG 101 (40.4) 73 (34.0) 1.00 –
 GC 102 (40.8) 106 (49.3) 0.69 (0.46–1.04) 0.081
 CC 47 (18.8) 36 (16.7) 0.94 (0.56–1.60) 0.893
Dominant
 GG 101 (40.4) 73 (34.0) 1.00 –
 GC+CC 149 (69.6) 142 (66.0) 0.76 (0.52–1.11) 0.178
Recessive
 GG+GC 203 (81.2) 179 (83.3) 1.00 –
 CC 47 (18.8) 36 (16.7) 1.51 (0.71–1.86) 0.628
Allele
 G 304 (60.8) 252 (58.6) 1.00 –
 C 196 (39.2) 178 (41.4) 0.91 (0.70–1.19) 0.503
rs833061 (−460T>C)
Codominant
 TT 69 (26.6) 66 (30.7) 1.00 –
 TC 148 (59.2) 131 (60.9) 1.08 (0.72–1.63) 0.753
 CC 33 (13.2) 18 (8.4) 1.75 (0.90–3.41) 0.102
Dominant
 TT 69 (26.6) 66 (30.7) 1.00 –
 TC+CC 181 (73.4) 149 (69.3) 1.16 (0.78–1.74) 0.479
Recessive
 TT+TC 217 (86.8) 197 (91.6) 1.00 –
 CC 33 (13.2) 18 (8.4) 1.66 (0.91–3.05) 0.103
Allele
 T 286 (57.2) 263 (61.2) 1.00 –
 C 214 (42.8) 167 (38.8) 1.18 (0.91–1.53) 0.229
rs699947 (−2578C>A)
Codominant
 CC 76 (30.4) 94 (43.7) 1.00 –
 CA 138 (55.2) 100 (46.5) 1.71 (1.15–2.54) 0.009
 AA 36 (14.4) 21 (9.8) 2.12 (1.14–3.93) 0.021
Dominant
 CC 76 (30.4) 94 (43.7) 1.00 –
 CA+AA 174 (69.6) 121 (56.3) 1.78 (1.22–2.60) 0.004
Recessive
 CC+CA 214 (85.6) 194 (90.2) 1.00 –
 AA 36 (14.4) 21 (9.8) 1.55 (0.88–2.75) 0.156
Allele
 C 290 (58.0) 288 (76.0) 1.00 –
 A 210 (42.0) 142 (33.0) 1.47 (1.12–1.92) 0.005
rs35569394 (18-bp I/D)
Codominant
 DD 78 (31.2) 52 (24.2) 1.00 –
 ID 135 (54.0) 134 (62.3) 0.67 (0.44–1.03) 0.069
 II 37 (14.8) 29 (13.5) 0.85 (0.47–1.55) 0.646
Dominant
 DD 78 (31.2) 52 (24.2) 1.00 –
 ID+II 172 (68.8) 163 (75.8) 0.70 (0.47–1.06) 0.098
Recessive
 DD+ID 213 (85.2) 186 (86.5) 1.00 –
 II 37 (14.8) 29 (13.5) 1.11 (0.66–1.88) 0.790
Allele
 D 291 (58.2) 238 (55.3) 1.00 –
 I 209 (41.8) 192 (44.7) 0.89 (−.69–1.16) 0.389

Note: OR (odds ratio) and 95% CI (confidence interval) was calculated by logistic regression analysis.

The results of haplotype analysis are given in Table 3. The findings indicated no statistically significant associations of VEGF haplotypes with BC risk.

Table 3.

Haplotype frequencies of VEGF polymorphisms in breast cancer (BC) and control subjects.

rs3025039 rs2010963 rs833061 rs699947 rs35569394 BC (FREQUENCY) CONTROL (FREQUENCY) OR (95% CI) P
C G T C D 0.2144 0.1999 1.00 –
C C T C D 0.154 0.1855 0.63 (0.32–1.25) 0.19
C G C A I 0.1269 0.1182 0.99 (0.49–1.99) 0.97
C C C A I 0.0526 0.0722 0.58 (0.24–1.39) 0.22
T G C A I 0.0637 0.0162 1.37 (0.58–3.19) 0.47
C G C C D 0.0468 0.0543 0.89 (0.38–2.11) 0.79
C G C C I 0.0295 0.0339 0.56 (0.18–1.73) 0.31
C G T A I 0.0276 0.0448 0.57 (0.20–1.67) 0.31
C C T C I 0.0292 0.0338 0.82 (0.30–2.27) 0.70
T G T C D 0.0157 0.0542 0.26 (0.06–1.10) 0.068
C G C A D 0.0392 0.0114 0.94 (0.27–3.31) 0.93
C G T C I 0.0157 0.0419 0.29 (0.06–1.38) 0.12
C C T A I 0.0313 0.0219 2.39 (0.68–8.44) 0.18
T C T C D 0.0326 0.0155 1.14 (0.19–6.83) 0.88
C C C C I 0.0173 0.0213 0.85 (0.16–4.44) 0.84
C C C C D 0.0069 0.0227 11.18 (0.64–196.77) 0.10
C C C A D 0.0269 0.0023 0.23 (0.02–2.10) 0.19
C C T A D 0.0185 0.0055 4.26 (0.11–158.25) 0.43

Note: Haplotype analysis was performed by SNPStats software that is available online.

The association between clinicopathological characteristics of BC patients with VEGF polymorphisms is shown in Table 4. Patients with rs3025039 CT genotype had a higher risk of developing ER negative (ER−) BC (OR = 2.39, 95% CI = 1.30–4.41, P = 0.007) than those with CC genotype.

Table 4.

Correlation between VEGF polymorphisms and clinicopathological characteristics of breast cancer (BC) patients.

VARIABLES rs3025039 (+936C>T) P rs2010963 (+405C>G) P rs833064 (−460T>C) P rs699947 (−2578C>A) P rs35569394 (18-bp I/D) P
CC CT TT GG GC CC TT TC CC CC CA AA DD ID II
Age (years) 0.322 0.956 0.124 0.030 0.213
 ≤50 56 22 0 33 34 15 28 40 9 32 39 9 23 46 7
 >50 98 41 4 59 56 27 34 85 24 33 87 22 41 77 26
Histological type 0.981 0.489 0.183 0.340 0.703
 Ductal carcinoma 118 44 3 61 72 32 47 91 25 52 88 25 48 88 27
 Others 49 18 1 31 25 14 16 47 6 17 44 8 19 41 9
Tumor size (cm) 0.328 0.733 0.342 0.025 0.420
 ≤2 62 23 0 37 33 15 23 50 8 32 48 6 25 50 9
 >2 91 40 3 52 57 27 39 75 23 33 76 24 38 73 23
TNM stage 0.469 0.670 0.487 0.059 0.718
 I 29 14 0 14 20 8 13 25 4 19 20 4 15 24 4
 II 64 23 2 46 33 17 30 49 14 32 48 11 25 49 15
 III 54 13 1 23 27 13 12 43 11 11 44 11 19 35 14
 IV 24 14 1 14 17 7 10 23 4 9 22 7 12 22 4
Grade 0.391 0.290 0.740 0.499 0.831
 I 36 7 1 14 21 6 13 25 7 16 20 8 16 22 6
 II 91 39 3 57 55 22 34 78 20 41 68 20 38 73 22
 III+IV 32 12 0 15 15 12 13 24 4 11 29 5 11 25 6
ER status 0.016 0.220 0.257 0.599 0.151
 Positive 111 29 3 54 66 25 44 78 22 46 76 21 45 73 24
 Negative 48 30 1 35 27 18 17 51 10 21 48 12 19 48 12
PgR status 0.666 0.801 0.190 0.005 0.634
 Positive 102 34 3 54 58 28 34 79 24 32 81 26 41 73 25
 Negative 57 24 1 35 34 14 27 49 8 35 42 7 23 47 11
HER2 status 0.119 0.862 0.062 0.012 0.103
 Positive 88 33 0 48 52 20 27 80 13 25 74 19 33 75 15
 Negative 81 31 4 49 45 24 36 60 20 46 60 13 37 54 22

Note: All the analyses were performed by chi-square test.

Regarding the rs699947 variant, patients with CA genotype were more prone to develop BC at age >50 years (OR = 2.16, 95% CI = 1.17–4.00, P = 0.0176) than those with CC genotype. Patients with rs699947 AA genotype had a higher risk of BC developing with tumor size >2 cm (OR = 3.88, 95% CI = 1.40–10.74, P = 0.0074) in comparison with CC genotype. Patients with rs699947 CA genotype had a lower risk of developing progesterone receptor negative (PgR−) BC (OR = 0.47, 95% CI = 0.26–0.87, P = 0.020) than those with CC genotype. In addition, patients with rs699947 CA and AA genotype significantly decreased the risk of developing HER2 negative BC (OR = 0.44, 95% CI = 0.24–0.79, P = 0.008 and OR = 0.37, 95% CI = 0.16–0.88, P = 0.031) than those with CC genotype. No significant association between VEGF rs2010963 (+405C>G), rs833061 (−460T>C), and rs35569394 (18-bp I/D) polymorphisms and clinicopathological characteristics of BC patients was found (P > 0.05).

Discussion

The present study investigated the potential impact of VEGF gene polymorphisms on the susceptibility and clinicopathological features of BC in an Iranian population in southeast of Iran. Our findings proposed that VEGF rs699947 variant significantly increased the risk of BC. The results did not support an association between rs3025039, rs2010963, rs833061, and rs35569394 variants of VEGF gene and BC risk.

We performed a stratified analysis by clinicopathological characteristics of BC patients, and our findings proposed that patients with rs3025039 CT genotype had a higher risk of developing ER− BC. Regarding the rs699947 variant, CA genotype increased the risk of developing BC in old individuals (age > 50 years), as well as in patients with tumor size >2 cm. However, patients with CA genotype had a lower risk of developing PgR− and HER negative BC. No other variants were associated with clinicopathological characteristics of the patients.

The −2578 C/C genotype of the VEGF promoter has been associated with higher levels of VEGF in blood mononuclear cells.18 It has been shown that −2578 C>A variant correlates with disease stages in which angiogenesis plays a critical role.30–32

The results of meta-analysis indicated that rs2010963 (+405C>G) and rs699947 (−2578C>A) variants of VEGF were not associated with BC susceptibility.33,34 The results of a meta−analysis performed by Li and Ju35 indicated that the functionally important +936 C/T polymorphism of VEGF is not associated with BC risk. The results of meta−analysis indicated that VEGF +936CC genotype and +936C allele increased the risk of BC and tumor growth, especially in Asians. VEGF −634G allele has no effect on BC susceptibility in all subjects, whereas decreases BC susceptibility in Asians and inhibits tumor growth.36

Kapahi et al25 investigated the impact of VEGF −2578C/A, −2549I/D, −460T/C, and −7C/T polymorphisms on BC in North Indian population. They found that II genotype of −2549I/D polymorphism significantly increased the risk of BC when compared with DD genotype. VEGF −2578AA genotype and A allele were found to be associated with increased risk of BC. The CC genotype and C allele of VEGF −460T/C variant significantly increased the risk of BC. The +405G>C and −1154G>A variants of VEGF were not associated with BC risk.20

No significant association between the +936 C/T polymorphism and BC risk was found in Moroccan women.19 However, the +936 C/T variant was associated with HER2/neu expression. In a meta-analysis performed by Chen et al21 revealed no significant association between VEGF −2578C/A and the risk of cancer. Subgroup analyses showed that the VEGF −2578C/A polymorphism is associated with colorectal and lung cancers but not with bladder and breast cancers. Furthermore, the polymorphism may decrease the risk of cancer in the Asian population. The results of a meta-analysis showed a significant association between VEGF +936C/T polymorphism and the risk of BC.26 It has been reported that VEGF −634G/C polymorphism is associated with increased BC risk and aggressiveness.27

Luo et al22 investigated the impact of VEGF −634 G/C, +936 C/T, and +1612 G/A polymorphisms on breast cancer in Chinese Han patients. They proposed that individual who carries +936 TT genotypes or 936 T−allele had a protective effect concerning the disease. They found that the −634CC genotype was significantly associated with high tumor aggressiveness. The +1612G/A polymorphism was not associated with BC risk. Rodrigues et al23 observed that women carriers of +936 CT+TT VEGF genotypes have a protective effect concerning BC. However, rs1109324, rs1547651, and rs833052 variants of VEGF were not associated with BC in Spanish population. The association between VEGF +936C/T, −1154A/G, −2578C/A, −634G/C, and −460T/C polymorphism and risk of BC was evaluated in a meta-analysis performed by Wang et al.24 The overall results of combined analyses revealed that five polymorphisms of VEGF were not associated with the risk of BC. VEGF −2578 A allele and A carrier genotypes have been shown to be associated with an increased risk of renal cell carcinoma (RCC).37

As the nature of breast carcinogenesis pathways is complex, there is no clear reason for the discrepancies in different studies. Ethnic, genetic, and/or environmental factors may interact in various ways to affect the risk of BC in different areas.

In conclusion, our findings revealed that VEGF rs699947 (−2578C>A) polymorphism was associated with the risk and clinicopathological characteristics of BC patients.

Footnotes

ACADEMIC EDITOR: Goberdhan P. Dimri, Editor in Chief

PEER REVIEW: Four peer reviewers contributed to the peer review report. Reviewers’ reports totaled 853 words, excluding any confidential comments to the academic editor.

FUNDING: MR received a dissertation grant (MSc thesis) from the Deputy for Research of Zahedan University of Medical Sciences. The authors confirm that the funder had no influence over the study design, content of the article, or selection of this journal.

COMPETING INTERESTS: Authors disclose no potential conflicts of interest.

Paper subject to independent expert single-blind peer review. All editorial decisions made by independent academic editor. Upon submission manuscript was subject to anti-plagiarism scanning. Prior to publication all authors have given signed confirmation of agreement to article publication and compliance with all applicable ethical and legal requirements, including the accuracy of author and contributor information, disclosure of competing interests and funding sources, compliance with ethical requirements relating to human and animal study participants, and compliance with any copyright requirements of third parties. This journal is a member of the Committee on Publication Ethics (COPE).

Author Contributions

Conceived and designed the experiments: MR, MH. Analyzed the data: MH, SS. Wrote the first draft of the manuscript: MR, MAM, MT. Contributed to the writing of the manuscript: MR, MH, SS, MAM, MT. Agree with manuscript results and conclusions: MR, MH, SS, MAM, MT. Jointly developed the structure and arguments for the paper: MR, SS, MAM, MT. Made critical revisions and approved final version: MH. All authors reviewed and approved of the final manuscript.

REFERENCES

  • 1.Bray F, Ren JS, Masuyer E, Ferlay J. Global estimates of cancer prevalence for 27 sites in the adult population in 2008. Int J Cancer. 2013;132(5):1133–1145. doi: 10.1002/ijc.27711. [DOI] [PubMed] [Google Scholar]
  • 2.Babu GR, Samari G, Cohen SP, et al. Breast cancer screening among females in Iran and recommendations for improved practice: a review. Asian Pac J Cancer Prev. 2011;12(7):1647–1655. [PubMed] [Google Scholar]
  • 3.Hashemi M, Fazaeli A, Ghavami S, et al. Functional polymorphisms of FAS and FASL gene and risk of breast cancer—pilot study of 134 cases. PLoS One. 2013;8(1):e53075. doi: 10.1371/journal.pone.0053075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Hashemi M, Eskandari-Nasab E, Fazaeli A, et al. Association between polymorphisms of glutathione S-transferase genes (GSTM1, GSTP1 and GSTT1) and breast cancer risk in a sample Iranian population. Biomark Med. 2012;6(6):797–803. doi: 10.2217/bmm.12.61. [DOI] [PubMed] [Google Scholar]
  • 5.Hashemi M, Eskandari-Nasab E, Fazaeli A, et al. Bi-directional PCR allele-specific amplification (bi-PASA) for detection of caspase-8 -652 6N ins/del promoter polymorphism (rs3834129) in breast cancer. Gene. 2012;505(1):176–179. doi: 10.1016/j.gene.2012.05.043. [DOI] [PubMed] [Google Scholar]
  • 6.Eskandari-Nasab E, Hashemi M, Rezaei H, et al. Evaluation of UDP-glucuronosyltransferase 2B17 (UGT2B17) and dihydrofolate reductase (DHFR) genes deletion and the expression level of NGX6 mRNA in breast cancer. Mol Biol Rep. 2012;39(12):10531–10539. doi: 10.1007/s11033-012-1938-8. [DOI] [PubMed] [Google Scholar]
  • 7.Vincenti V, Cassano C, Rocchi M, Persico G. Assignment of the vascular endothelial growth factor gene to human chromosome 6p21.3. Circulation. 1996;93(8):1493–1495. doi: 10.1161/01.cir.93.8.1493. [DOI] [PubMed] [Google Scholar]
  • 8.Ferrara N, Gerber HP, LeCouter J. The biology of VEGF and its receptors. Nat Med. 2003;9(6):669–676. doi: 10.1038/nm0603-669. [DOI] [PubMed] [Google Scholar]
  • 9.Ferrara N. VEGF and the quest for tumour angiogenesis factors. Nat Rev Cancer. 2002;2(10):795–803. doi: 10.1038/nrc909. [DOI] [PubMed] [Google Scholar]
  • 10.Nakamura M, Abe Y, Tokunaga T. Pathological significance of vascular endothelial growth factor A isoform expression in human cancer. Pathol Int. 2002;52(5–6):331–339. doi: 10.1046/j.1440-1827.2002.01367.x. [DOI] [PubMed] [Google Scholar]
  • 11.Nagata J, Kijima H, Hatanaka H, et al. Angiopoietin-1 and vascular endothelial growth factor expression in human esophageal cancer. Int J Mol Med. 2002;10(4):423–426. [PubMed] [Google Scholar]
  • 12.Nakasaki T, Wada H, Shigemori C, et al. Expression of tissue factor and vascular endothelial growth factor is associated with angiogenesis in colorectal cancer. Am J Hematol. 2002;69(4):247–254. doi: 10.1002/ajh.10061. [DOI] [PubMed] [Google Scholar]
  • 13.Schoppmann SF, Horvat R, Birner P. Lymphatic vessels and lymphangiogenesis in female cancer: mechanisms, clinical impact and possible implications for anti-lymphangiogenic therapies (Review) Oncol Rep. 2002;9(3):455–460. [PubMed] [Google Scholar]
  • 14.Ferrara N. Role of vascular endothelial growth factor in physiologic and pathologic angiogenesis: therapeutic implications. Semin Oncol. 2002;29(6 suppl 16):10–14. doi: 10.1053/sonc.2002.37264. [DOI] [PubMed] [Google Scholar]
  • 15.Brogan IJ, Khan N, Isaac K, Hutchinson JA, Pravica V, Hutchinson IV. Novel polymorphisms in the promoter and 5′ UTR regions of the human vascular endothelial growth factor gene. Hum Immunol. 1999;60(12):1245–1249. doi: 10.1016/s0198-8859(99)00132-9. [DOI] [PubMed] [Google Scholar]
  • 16.Watson CJ, Webb NJ, Bottomley MJ, Brenchley PE. Identification of polymorphisms within the vascular endothelial growth factor (VEGF) gene: correlation with variation in VEGF protein production. Cytokine. 2000;12(8):1232–1235. doi: 10.1006/cyto.2000.0692. [DOI] [PubMed] [Google Scholar]
  • 17.Renner W, Kotschan S, Hoffmann C, Obermayer-Pietsch B, Pilger E. A common 936 C/T mutation in the gene for vascular endothelial growth factor is associated with vascular endothelial growth factor plasma levels. J Vasc Res. 2000;37(6):443–448. doi: 10.1159/000054076. [DOI] [PubMed] [Google Scholar]
  • 18.Shahbazi M, Fryer AA, Pravica V, et al. Vascular endothelial growth factor gene polymorphisms are associated with acute renal allograft rejection. J Am Soc Nephrol. 2002;13(1):260–264. doi: 10.1681/ASN.V131260. [DOI] [PubMed] [Google Scholar]
  • 19.Rahoui J, Sbitti Y, Touil N, et al. The single nucleotide polymorphism +936 C/T VEGF is associated with human epidermal growth factor receptor 2 expression in Moroccan breast cancer women. Med Oncol. 2014;31(12):336. doi: 10.1007/s12032-014-0336-6. [DOI] [PubMed] [Google Scholar]
  • 20.James R, Ramesh G, Krishnamoorthy L, et al. Prevalence of +405G>C, −1154G>A vascular endothelial growth factor polymorphism in breast cancer. Indian J Clin Biochem. 2014;29(1):21–28. doi: 10.1007/s12291-013-0307-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Chen Q, Zhou Z, Shan L, et al. Association of the vascular endothelial growth factor −2578C/A polymorphism with cancer risk: a meta-analysis update. Biomed Rep. 2014;2(6):823–830. doi: 10.3892/br.2014.317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Luo T, Chen L, He P, et al. Vascular endothelial growth factor (VEGF) gene polymorphisms and breast cancer risk in a Chinese population. Asian Pac J Cancer Prev. 2013;14(4):2433–2437. doi: 10.7314/apjcp.2013.14.4.2433. [DOI] [PubMed] [Google Scholar]
  • 23.Rodrigues P, Furriol J, Tormo E, Ballester S, Lluch A, Eroles P. The single-nucleotide polymorphisms +936 C/T VEGF and −710 C/T VEGFR1 are associated with breast cancer protection in a Spanish population. Breast Cancer Res Treat. 2012;133(2):769–778. doi: 10.1007/s10549-012-1980-1. [DOI] [PubMed] [Google Scholar]
  • 24.Wang K, Liu L, Zhu ZM, Shao JH, Xin L. Five polymorphisms of vascular endothelial growth factor (VEGF) and risk of breast cancer: a meta-analysis involving 16,703 individuals. Cytokine. 2011;56(2):167–173. doi: 10.1016/j.cyto.2011.06.018. [DOI] [PubMed] [Google Scholar]
  • 25.Kapahi R, Guleria K, Sambyal V, et al. Association of VEGF and VEGFR1 polymorphisms with breast cancer risk in North Indians. Tumour Biol. 2015;36(6):4223–4234. doi: 10.1007/s13277-015-3059-1. [DOI] [PubMed] [Google Scholar]
  • 26.Yan Y, Liang H, Li T, et al. Vascular endothelial growth factor +936C/T polymorphism and breast cancer risk: a meta-analysis of 13 case-control studies. Tumour Biol. 2014;35(3):2687–2692. doi: 10.1007/s13277-013-1354-2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Sa-Nguanraksa D, Kooptiwut S, Chuangsuwanich T, Pongpruttipan T, Malasit P, O-Charoenrat P. Vascular endothelial growth factor polymorphisms affect gene expression and tumor aggressiveness in patients with breast cancer. Mol Med Rep. 2014;9(3):1044–1048. doi: 10.3892/mmr.2014.1890. [DOI] [PubMed] [Google Scholar]
  • 28.Hashemi M, Shahkar G, Simforoosh N, et al. Association of polymorphisms in PRKCI gene and risk of prostate cancer in a sample of Iranian Population. Cell Mol Biol (Noisy-le-grand) 2015;61(5):16–21. [PubMed] [Google Scholar]
  • 29.Solé X, Guinó E, Valls J, Iniesta R, Moreno V. SNPStats: a web tool for the analysis of association studies. Bioinformatics. 2006;22(15):1928–1929. doi: 10.1093/bioinformatics/btl268. [DOI] [PubMed] [Google Scholar]
  • 30.Jain L, Vargo CA, Danesi R, et al. The role of vascular endothelial growth factor SNPs as predictive and prognostic markers for major solid tumors. Mol Cancer Ther. 2009;8(9):2496–2508. doi: 10.1158/1535-7163.MCT-09-0302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Liu Q, Li Y, Zhao J, et al. Association of polymorphisms −1154G/A and −2578C/A in the vascular endothelial growth factor gene with decreased risk of endometriosis in Chinese women. Hum Reprod. 2009;24(10):2660–2666. doi: 10.1093/humrep/dep208. [DOI] [PubMed] [Google Scholar]
  • 32.Nasr HB, Chahed K, Bouaouina N, Chouchane L. Functional vascular endothelial growth factor −2578 C/A polymorphism in relation to nasopharyngeal carcinoma risk and tumor progression. Clin Chim Acta. 2008;395(1–2):124–129. doi: 10.1016/j.cca.2008.05.022. [DOI] [PubMed] [Google Scholar]
  • 33.Zhang M, Wu X, Wang X, et al. Lack of association between +405 G/C polymorphism in VEGF and breast cancer risk: a meta-analysis. J BUON. 2015;20(4):970–977. [PubMed] [Google Scholar]
  • 34.Zhang Y, Yu YF, Wang JZ, Jia H. Vascular endothelial growth factor +405G/C and −2578C/A polymorphisms and breast cancer risk: a meta-analysis. Genet Mol Res. 2015;14(3):8909–8918. doi: 10.4238/2015.August.3.14. [DOI] [PubMed] [Google Scholar]
  • 35.Li J, Ju Y. Association between the functional polymorphism of vascular endothelial growth factor gene and breast cancer: a meta-analysis. Iran J Med Sci. 2015;40(1):2–12. [PMC free article] [PubMed] [Google Scholar]
  • 36.Ma J, Hu W, Zhang P, et al. The association between VEGF +936C/T and −634G/C polymorphisms and breast cancer susceptibility, tumor growth, and metastases: evidence from 20,728 subjects. Cancer Invest. 2015;33(7):312–317. doi: 10.3109/07357907.2015.1044664. [DOI] [PubMed] [Google Scholar]
  • 37.Ajaz S, Khaliq S, Abid A, et al. Association of a single-nucleotide polymorphism in the promoter region of the VEGF gene with the risk of renal cell carcinoma. Genet Test Mol Biomarkers. 2011;15(9):653–657. doi: 10.1089/gtmb.2011.0029. [DOI] [PubMed] [Google Scholar]

Articles from Breast Cancer : Basic and Clinical Research are provided here courtesy of SAGE Publications

RESOURCES