Leptin receptor null mice with reexpression of LepR in GnRHR expressing cells display elevated FSH levels but remain in a prepubertal state

Abstract

Leptin signals energy sufficiency to the reproductive hypothalamic-pituitary-gonadal (HPG) axis. Studies using genetic models have demonstrated that hypothalamic neurons are major players mediating these effects. Leptin receptor (LepR) is also expressed in the pituitary gland and in the gonads, but the physiological effects of leptin in these sites are still unclear. Female mice with selective deletion of LepR in a subset of gonadotropes show normal pubertal development but impaired fertility. Conditional deletion approaches, however, often result in redundancy or developmental adaptations, which may compromise the assessment of leptin's action in gonadotropes for pubertal maturation. To circumvent these issues, we adopted a complementary genetic approach and assessed if selective reexpression of LepR only in gonadotropes is sufficient to enable puberty and improve fertility of LepR null female mice. We initially assessed the colocalization of gonadotropin-releasing hormone receptor (GnRHR) and LepR in the HPG axis using GnRHR-IRES-Cre (GRIC) and LepR-Cre reporter (tdTomato or enhanced green fluorescent protein) mice. We found that GRIC and leptin-induced phosphorylation of STAT3 are expressed in distinct hypothalamic neurons. Whereas LepR-Cre was observed in theca cells, GRIC expression was rarely found in the ovarian parenchyma. In contrast, a subpopulation of gonadotropes expressed the LepR-Cre reporter gene (tdTomato). We then crossed the GRIC mice with the LepR null reactivable (LepR^loxTB) mice. These mice showed an increase in FSH levels, but they remained in a prepubertal state. Together with previous findings, our data indicate that leptin-selective action in gonadotropes serves a role in adult reproductive physiology but is not sufficient to allow pubertal maturation in mice.

the adipocyte-derived hormone leptin signals energy sufficiency to the hypothalamic-pituitary-gonadal (HPG) axis and acts as a permissive factor for reproductive function (3, 7, 8, 20, 23, 39). Humans and mice with a loss-of-function mutation in the leptin (LEP/Lep) or leptin receptor (LEPR/Lepr) genes are obese, infertile, and remain in a sexually immature state (12, 24, 38, 44, 54). Administration of leptin to leptin-deficient subjects increases gonadotropin secretion and restores fertility (3, 8, 23). Leptin binds to cognate receptors (LepR) expressed in multiple tissues, including every node of the HPG axis, i.e., the hypothalamus, the anterior pituitary gland, and the gonads (1, 21, 42, 45, 53). Thus leptin might control reproductive physiology by acting at different levels of the HPG axis. However, studies using genetically modified mouse models have implicated the brain as the major player. Expression of LepR only in the brain of mice otherwise null for LepR is sufficient to restore reproductive function in males and females (16). Vice versa, deletion of LepR from hypothalamic neurons precludes sexual maturation and reproductive function (11, 40, 55). These observations initially diminished the interest in the physiological actions of leptin outside of the brain. However, recent findings showing that lack of leptin action only in LH-β+-gonadotropes also impairs fertility have reinvigorated the field. Female mice with deletion of LepR in luteinizing hormone β-subunit expressing cells (LH-β, which is exclusively expressed in a subset of gonadotropes) display subfertility demonstrated by increased time to pregnancy and decreased litter size (1).

Because reproduction is essential for species survival, multiple parallel systems may be in place to ensure reproductive success. In this regard, it is possible that the reduction, but not loss, of reproductive fitness in gonadotrope-specific LepR null mice (1) may have been obscured by the existence of redundant pathways or developmental adaptations. This is, in fact, a recurrent observation in the reproductive field. For example, global deletion of highly relevant genes in reproductive function results in small or undetectable phenotypes (34, 37, 46, 52). In the attempt to circumvent these issues and gain insights into leptin's physiological action in reproductive physiology, we adopted an alternative genetic approach. We used LepR null reactivable (LepR^loxTB) mice to conditionally reexpress endogenous LepR in gonadotropes (5, 13). The LepR^loxTB mice have a phenotype reminiscent of that of the LepR-deficient (db/db) mouse: they are obese, diabetic and infertile. Males and females remain in a prepubertal state, and no sexual maturation or reproductive capacity is attained (13). Using the Cre-loxP system, we reexpressed endogenous LepRs selectively in gonadotropes using the gonadotropin-releasing hormone (GnRH) receptor (GnRHR)-internal ribosome entry site (IRES)-Cre (GRIC) mouse model (50). We assessed whether leptin action only in those cells is sufficient to induce puberty and improve fertility in otherwise infertile LepR null female mice.

METHODS

Animals.

The GnRHR-IRES-Cre (GRIC) (50), the LepR-Cre (JAX mice, stock no. 008320) (17), the LepR^loxTB (kindly provided by Dr. Elmquist, UTSW Medical Center, Dallas, TX, available in JAX mice, stock no. 018989) (5), the R26 tdTomato (JAX mice, stock no. 007914) (36), the R26 enhanced green fluorescent protein (eGFP) (JAX mice, stock no. 004077) (25, 26) and db/db (JAX mice, stock no. 000697) mice were kept in the University of Michigan animal facility in a light- (12 h on/off) and temperature-controlled (21–23°C) environment with free access to water and food. Mice were fed phytoestrogen-reduced Harlan diet 2016 (16% protein/4% fat), except during breeding when mice were fed higher protein and fat phytoestrogen-reduced Harlan diet 2019 (19% protein/8% fat) (Teklad Global Rodent diet, Harlan Laboratories). All procedures and experiments were carried out in accordance with the guidelines established by the National Institutes of Health Guide for the Care and Use of Laboratory Animals and approved by the University of Michigan Committee on Use and Care of Animals (Animal Protocol no. 04380).

The GRIC mouse is a knock-in strain that coexpresses Cre-recombinase with the Gnrhr gene. The LepR-Cre line is also a knock-in strain with an IRES-Cre sequence inserted immediately 3′ of the stop codon of the Lepr gene. The LepR^loxTB mice have a loxP-flanked transcription-blocking (TB) cassette inserted between exons 16 and 17 of the Lepr gene, allowing the generation of mice lacking the long isoform of LepR in a conditional Cre recombinase-dependent approach. The ROSA26 (R26)-tdTomato and R26-eGFP mice carry targeted mutations of the R26 locus with a loxP-flanked TB cassette preventing the expression of CAG promoter-driven tdTomato or eGFP reporters, respectively. Cre-mediated excision of the loxP-flanked TB cassette allows expression of the red fluorescent protein variant tdTomato or of the eGFP.

All mice were tail-genotyped before and after experiments by extracting DNA (RED Extract-N-Amp Tissue PCR Kit catalog no. XNAT, Sigma, St. Louis, MO) and performing PCR. The primers used for genotyping are described in Table 1. The db/db mice were directly purchased from JAX mice and were not genotyped.

Table 1.

List of primers used for genotyping of mouse models

Mouse	Forward	Reverse	Source
GRIC	5′CTTTCCTAAACCCGTGCTTC 3′	5′TGATCTAAGGAGGAAGTAAAGAATCC 3′	Wen at al. (50)
LepR-Cre	5′TGCTTCTGTCCGTTTGCCGGT 3′	5′GTGAAACAGCATTGCTGTCAC 3′	stock no. 08320*
R26-tdTom	5′CTGTTCCTGTACGGCATGG 3′	5′GGCATTAAAGCAGCGTATCC 3′	stock no. 07914*
R26-eGFP	5′AAGTTCATCTGCACCACCG 3′	5′TCCTTGAAGAAGATGGTGCG 3′	stock no. 04077*
LepRloxTB	5′CAGTCTGGACCGAAGGTGTT 3′	5′TAGGGCCAAACCCACATTTA 3′	stock no. 18989*

^*Commercially available in JAX mice.

Perfusion and histology.

Mice were deeply anesthetized with isoflurane (Fluriso, Vet One, Boise, ID) and perfused intracardially with 10% buffered formalin (Sigma). Brains, pituitary gland, uterus, and ovaries were dissected. Brains were sectioned on a freezing microtome (30-μm sections, 5 series) in the frontal plane. Pituitary glands and ovaries were sectioned using a cryostat (14-μm sections, 3 series) or microtome (5-μm sections). The DsRed (tdTomato) was assessed in series of brain, pituitary gland, and ovary sections from GRIC and LepR-Cre reporter mice. The visualization of eGFP was performed after an amplification step using immunohistochemistry.

Leptin administration.

To evaluate the colocalization of LepR and GnRHR, a group of GRIC-tdTomato female mice (n = 4) was fasted overnight and received intraperitoneal leptin [5 μg/g, purchased from Dr. A. F. Parlow, Harbor-UCLA Medical Center, Torrance, CA, through the National Hormone and Peptide Program (NHPP)] to assess leptin-induced phosphorylation of STAT3 immunoreactivity (pSTAT3-ir), as described before (18, 19). Two hours after leptin treatment, mice were perfused, and brains and pituitary glands were dissected and sectioned using a freezing microtome (brains) or a cryostat (pituitary glands). Brain and pituitary gland sections were incubated in antisera against pSTAT3 raised in rabbit (1:2,000, Cell Signaling, Danvers, MA) at 4°C for 48–72 h. Sections were then incubated in biotin-conjugated donkey anti-rabbit secondary antisera (1:1,000, for 1 h; Jackson Laboratories, Bar Harbor, ME) followed by an avidin-biotin complex (1:500 for 1 h; Vector Laboratories, Burlingame, CA) and finally subjected to an immunoperoxidase reaction using 0.05% diaminobenzidine and 0.05% nickel sulfate as chromogens.

Immunofluorescence.

To assess the colocalization of LepR in gonadotropes (GnRHR expressing cells), the pituitary glands from LepR-Cre reporter mice (tdTomato, n = 4 males and n = 4 females) were sectioned on a cryostat (14-μm sections), mounted onto slides, and subjected to immunofluorescence analysis for LH-β (purchased from Dr. A. F. Parlow through the NHPP). Sections of the pituitary gland were rinsed in 0.1 M PBS, pH 7.4, and incubated overnight in anti-LH-β primary antisera raised in guinea pig (1:2,000). On the following day, sections were incubated in biotinylated secondary donkey anti-guinea pig antisera (1:1,000, Jackson Laboratories) for 1 h, followed by streptavidin AlexaFluor-488 (1:500, Invitrogen, Carlsbad, CA) for 1 h. Tissue was rinsed in PBS, dried at room temperature, and coverslipped with Fluoromount (EMS, Hatfield, PA).

Distribution of GRIC-eGFP was assessed in the pituitary glands and ovaries. Tissues were sectioned on a cryostat (14-μm sections), mounted onto slides, and submitted to immunofluorescence for GFP (antisera generated in chicken, Aves Laboratories, Tigard, OR). Slides were rinsed in PBS and incubated overnight in anti-GFP (1:5,000). On the following day, sections were incubated with AlexaFluor-488 conjugated secondary donkey anti-chicken antisera (1:500) for 1 h. Tissue was rinsed in PBS, dried at room temperature, and coverslipped with Vectashield antifade mounting medium with 4,6-diamidino-2-phenylindole (Vector Laboratories).

Endogenous reexpression of LepR in GnRHR cells.

Mice with expression of LepR only in GnRHR cells were generated by crossing the LepR^loxTB with GRIC mice. Mice homozygous for Lepr^loxTB allele (null for LepR long form) are obese, diabetic, and infertile. Hemizygous (LepR^loxTB/+) male mice were bred with GRIC females to generate our breeders. Female GRIC^+/− Lepr^loxTB/+ mice were crossed with male GRIC^+/+ Lepr^loxTB/+ mice to avoid germ-line activation of Cre recombinase by the male breeder (48). Genotypes of the resulting progeny were produced at the expected Mendelian ratio. Groups were divided into wild-type (control with no GRIC or LepR^loxTB allele), LepR^loxTB (control homozygous for LepR^loxTB allele and no GRIC allele) and GRIC LepR^loxTB (experimental mice). At the end of the experiment, genotypes were confirmed, and hypothalami, pituitary glands, and tail tips were processed with the Sigma kit and LepR^loxTB primers to assess Cre activity and DNA recombination (defined by adding the pDis Reac primer, 5′ CCC AAG GCC ATA CAA GTG TT 3′, band size = 600 bp).

The ovaries of wild-type, LepR^loxTB and GRIC LepR^loxTB mice were placed in 10% formalin (Sigma), stored at 4°C and submitted to the Unit for Laboratory Animal Medicine in vivo animal core of the University of Michigan for the standard paraffin embedding procedure and hematoxylin and eosin staining (5-μm sections). The presence of corpora lutea and follicles in different stages was evaluated. The uteri were weighed immediately after euthanasia, placed in 10% formalin, and photographed without further preparation.

Body weight and reproductive phenotyping.

Mice were weighed weekly between 5 and 15 wk of age. They were monitored for puberty onset [vaginal opening (VO)] and sexual maturation (until 10 mo of age). Females were further tested for fertility by breeding with sexually experienced males. Three trials of fertility testing were performed (n = 3–4/genotype). Each trial was set up to include three to four cages of mice. Each cage housed one LepR^loxTB female, one GRIC LepR^loxTB female, and one wild-type female for 4–6 wk. Fertility was assessed by the presence of live pups. The estrous cycles of wild-type females were monitored by vaginal cytology (6), and mice were euthanized during the diestrus phase. At the time of euthanasia, mutant mice were also assessed for uterus weight, and ovaries were collected to evaluate the presence of corpora lutea.

Quantitative PCR.

Adult wild-type (in diestrus), LepR^loxTB and GRIC LepR^loxTB female mice were deeply anesthetized with isoflurane and euthanized by decapitation. The hypothalamus and pituitary gland were rapidly dissected and frozen on dry ice. Hypothalamic blocks were limited by an incision 1 mm anterior to the optic chiasm and another immediately posterior to the mammillary bodies. Lateral limits were defined by the optic tract, and superior limits were defined by the dorsal tip of the third ventricle (14). Tissues were stored at −80°C until quantitative PCR (qPCR) was performed. Tissue was homogenized using Qiazol, and total RNA was isolated using the miRNeasy minikit (cat no. 217004, Qiagen, Germantown, MD). Samples were then quantified using an Epoch reader (Biotek, Suwanee, GA). Total RNA (500–750 ng) was treated with DNase (Qiagen catalog no. 79254) and reverse-transcribed into cDNA. The qPCR was performed using Integrated DNA Technologies PrimeTime qPCR Assays and TaqMan technology in a CFX96 (C1000, BioRad, Hercules, CA). Primers and references are described in Table 2. Changes in expression of the following genes were assessed: Gnrh1 and Gnrhr in the hypothalamus, and Gnrhr, Lhb, Fshb (follicle stimulating hormone), and Cga (glycoprotein hormone α-polypeptide) in the pituitary gland. The ribosomal protein S29 (Rps29 gene, a component of the ribosome 40S subunit) and β-actin were used as housekeeping genes (29). The qPCR data were analyzed by the ΔΔCT method.

Table 2.

List of primer/probe pairs used for qPCR studies

Gene	Sequence	Company	Reference
β Actin	F primer: 5′ GAT TAC TGC TCT GGC TCC TAG 3′	IDT	Assay no. Mm.PT.39a.22214843.g
	R primer: 5′ GAC TCA TCG TAC TCC TGC TTG 3′
	Probe: 5′ CTG GCC TCA /ZEN/CTG TCC ACC TTC C 3′
GnRH	F primer: 5′ GGG AAA GAG AAA CAC TGA ACA C 3′	IDT	Custom
	R primer: 5′ AGT ACA TTC GAA GTG CTG GG 3′
	Probe: 5′ AGT GGG CAA GGA GGT GGA TCA AAT 3′
GnRH R	F primer: 5′ TCA GCA TTG TCT TTG CAG GA 3′	IDT	Assay no. Mm.PT.45.16240237
	R primer: 5′ TCA CAC ATT GCG AGA AGA CTG 3′
	Probe: 5′ TGA TCT ACC TAG CAG ACG GCT CTG G 3′
RPS29	F primer: 5′ TGA AGG CAA GAT GGG TCA C 3′	IDT	Custom
	R primer: 5′ GCA CAT GTT CAG CCC GTA TT 3′
	Probe: 5′ AGT CAC CCA CGG AAG TTC GG 3′
LHβ	F primer: 5′ CCA GTC TGC ATC ACC TTC AC 3′	IDT	Assay # Mm.PT.45.5612498
	R primer: 5′ GAG GCA CAG GAG GCA AAG 3′
	Probe: 5′ AGT ACT CGG ACC ATG CTA GGA CAG T 3′
FSHβ	F primer: 5′ TTC AGC TTT CCC CAG AAG AG 3′	IDT	Assay no. Mm.PT.45.17694677
	R primer: 5′ TCC AGC ACC AGA ATA AGA TGC 3′
	Probe: 5′ AGC TAC GTC CTG TGC AGT CAG C 3′
CGA	F primer: 5′ AGC ATG ACC AGA ATG ACA GC 3′	IDT	Assay no. Mm.PT.58.31855537
	R primer: 5′ CCT CAG ATC GAC AAT CAC CTG 3′
	Probe: 5′ CCC TCA AAA AGT CCA GAG CTT GCA GA 3′

F, forward; R, reverse.

Hormone profiles.

The LH and FSH levels were assessed from plasma samples taken from the trunk blood at the time of death. After 45-min incubation at room temperature, the blood samples were centrifuged at 1,000 g for 20 min at 4°C. Serum samples were collected and stored at −20°C. Analyses of LH and FSH serum levels were performed at the University of Virginia Center for Research in Reproduction Ligand Assay and Analysis Core (Charlottesville, VA) using the EMD Millipore mouse/rat LH/FSH multiplex assay. The detection limits were 0.24 ng/ml for LH and 2.4 ng/ml for FSH.

Quantification, data analyses, and production of digital images.

Sections of brain, pituitary gland, and ovary were analyzed using an Axio Imager M2 microscope (Carl Zeiss, Jena, Germany). The distribution of single-labeled (pSTAT3-ir+ or tdTomato+) and dual-labeled (pSTAT3-ir+ and tdTomato+) neurons was assessed in the entire hypothalamus. Quantification of dual-labeled neurons (LepR-Cre tdTomato+ and LH-β-ir+) and the percentage of colocalization were determined in one representative section of the anterior pituitary gland. Distribution of GFP-ir (GRIC-eGFP mice) and tdTomato (LepR-tdTomato mice) was analyzed in the entire ovary. Statistical analysis was performed using GraphPad Prism 6 software. Comparison among groups was determined by one-way ANOVA, applying Geisser-Greenhouse correction for data variability followed by the Tukey post hoc multiple comparison test. Data are presented as means ± SE and α values (P < 0.05) were considered significant. Photomicrographs were produced by capturing images with a digital camera (Axiocam, Zeiss) mounted directly on the microscope using the Zen software. Adobe Photoshop CS6 image-editing software was used to integrate photomicrographs into plates. Only sharpness, contrast, and brightness were adjusted.

RESULTS

LepR expression in GnRHR expressing cells.

To determine the cell population and degree of colocalization of LepR and GnRHR, we evaluated the distribution of leptin-induced pSTAT3-ir in the hypothalamus and in the pituitary gland of GRIC reporter mice (tdTomato). In the hypothalamus, very few GRIC cells were observed in areas that express LepR or leptin-induced pSTAT3, in agreement with a previous report (49). Small numbers of GRIC-tdTomato neurons were found in the arcuate, ventromedial, and dorsomedial nuclei. Virtually no leptin-induced pSTAT3-ir and GRIC colocalization was observed in the adult female hypothalamus (n = 3, Fig. 1). Because we were unable to detect reliable leptin-induced pSTAT3-ir in sections from the pituitary gland, we used the LepR-Cre reporter mice (tdTomato) to map the degree of colocalization of LepR in gonadotropes (LH-β immunoreactive cells). We observed that ∼10% of LepR-Cre cells coexpress LH-β immunoreactivity and ∼5% of LH-β immunoreactive cells exhibited LepR-Cre activity (n = 3 males and n = 4 females, Fig. 2, A–D) in both males and females. In addition, ovarian theca cells express LepR (n = 5, Fig. 2E), but GRIC-reporter genes (tdTom or eGFP, n = 3), were sporadically observed in only a few cells of the ovarian parenchyma (Fig. 2F).

Fig. 1.

LepR and GnRHR (GRIC-reporter gene) are expressed in different hypothalamic cell populations. Bright-field and fluorescent images show the distribution of leptin-induced STAT3 phosphorylation (pSTAT3-ir) and GnRHR (GRIC-tdTomato) in the arcuate nucleus (Arc; A–C), in the ventromedial nucleus of the hypothalamus (VMH; D–E), and in the dorsomedial nucleus of the hypothalamus (DMH; G–I). 3V, Third ventricle. Scale bar: 200 μm.

Fig. 2.

Leptin receptor (LepR) is expressed in a subpopulation of cells expressing GnRHR in the pituitary gland. A–C: fluorescent images showing that subsets of LepR-expressing cells (LepR-Cre tdTomato; A) display LH-β immunoreactivity (LH-β-ir; B) in males (arrows indicate dual-labeled cells). C: merged. D: bar graphs showing the percentage of colocalization between LepR-tdTom and LH-β-ir in the pituitary gland of male and female mice (n = 3 males and n = 5 females). E and F: fluorescent images showing the distribution of LepR-reporter gene (tdTom; E) (arrows mark these cells) and GRIC-reporter gene (eGFP; F) (arrow indicates a cell in the parenchyma) in the mouse ovary. CL, corpus luteum; Gr, granulosa layer. Scale bar: 100 μm in A–C and 200 μm in E and F.

GRIC-LepR^loxTB mice show no improvement of the metabolic and the reproductive phenotypes.

To generate mice with endogenous reexpression of LepR selectively in GnRHR cells, we crossed the GRIC mouse with the LepR^loxTB mouse previously described (5, 13, 48, 50). For validation of the mouse model and Cre-induced DNA recombination, DNA was extracted from hypothalamus, pituitary gland, and tail tips, and then DNA recombination was tested using LepR^loxTB primers. Only the pituitary gland showed a detectable band indicating successful genomic recombination (Fig. 3A).

Fig. 3.

Reexpression of LepR selectively in GnRHR cells causes no change in body weight of LepR^loxTB mice. A: agarose gel demonstrating Cre-induced DNA recombination (higher band) of LepR^loxTB in the pituitary (but not in the hypothalamus and tail) of GRIC LepR^loxTB mice (n = 2). B: graph showing the progression of body weight of wild-type, LepR^loxTB, and GRIC LepR^loxTB female mice (n = 3–8 for each time point). *P < 0.05 and ****P < 0.0001 per one-way ANOVA, Tukey's post hoc multiple-comparison test.

Because lack of leptin signaling in gonadotropes only had a minor impact on male fertility (1) and because of germ line transgene activation in GRIC males, we focused our studies on female physiology. Three cohorts of GRIC-LepR^loxTB (n = 7) animals were evaluated and compared with LepR^loxTB (n = 17) and wild-type (n = 18) littermates. Due to leptin's role in the regulation of body weight and the deleterious effects of metabolic dysfunction in reproductive control (20, 22, 30, 35), we evaluated changes in body weight of GRIC-LepR^loxTB mice compared with LepR^loxTB and wild-type control littermates, from 5 to 15 wk of age. No difference between LepR^loxTB and GRIC LepR^loxTB mice was observed, but a similar increase in body weight over time for these two models compared with wild-type littermates was apparent (Fig. 3B).

Mice were weaned at 3 wk of age (postnatal day 21) and were monitored for VO as an external estrogen-dependent marker for puberty onset. At 4 wk of age (postnatal day 28), all wild-type littermate controls had shown VOs (n = 18), whereas LepR^loxTB (n = 17) and GRIC-LepR^loxTB (n = 7) mice never did achieve a developed opening up to 10 mo of age. Wild-type littermate controls displayed normal estrous cycles (data not shown), but we were unable to evaluate any change in vaginal cytology in LepR^loxTB or GRIC-LepR^loxTB mice due to the lack of VO. Because male odorants can induce sexual maturation in female rodents (47), we further characterized the reproductive phenotype of the females housed with a male of proven fertility. After 4–6 wk of mating, wild types (n = 10) were each able to become pregnant and produce a litter of live pups, but none of the LepR^loxTB (n = 10) nor the GRIC-LepR^loxTB (n = 7) animals showed any signs of pregnancy.

The ovaries of the LepR^loxTB and GRIC-LepR^loxTB mice contained follicles in different developmental stages, but no corpora lutea, indicating lack of ovulation. We also noticed higher numbers of atretic follicles in LepR^loxTB and GRIC-LepR^loxTB ovaries compared with wild type (Fig. 4, A–C). The uteri of LepR^loxTB and GRIC-LepR^loxTB mice were poorly developed (Fig. 4D), and their weights were significantly smaller than wild-type littermate controls at similar ages (20–30 wk old, Fig. 4E).

Fig. 4.

Reexpression of LepR selectively in GnRHR cells causes no improvement of the reproductive phenotype of LepR^loxTB mice. A–C: bright-field images showing hematoxylin and eosin stained sections of the ovary of controls in diestrus (A), LepR^loxTB (B), and GRIC LepR^loxTB (C) mice. Note the presence of corpus luteum (CL) only in the ovary of the control mouse. D: digital image showing the uterine morphology of controls in diestrus, LepR^loxTB, and GRIC LepR^loxTB mice. E: bar graphs comparing uterus weight of controls in diestrus (n = 11), LepR^loxTB (n = 11), and GRIC LepR^loxTB (n = 5) adult mice. No difference between uterus weight of LepR^loxTB and GRIC LepR^loxTB mice was observed. ****P < 0.001 compared with wild-type control mice per one-way ANOVA, Tukey's post hoc multiple comparison test. Scale bar: 1 mm.

FSH-β expression and FSH levels are increased in GRIC-LepR^loxTB mice.

No differences in hypothalamic GnRH and GnRHR mRNAs, as well as pituitary gland GnRHR and LH-β mRNAs expression, were observed among the genotypes (Fig. 5, A–D). However, we found that FSH-β and CGA mRNAs were increased in LepR^loxTB and in GRIC-LepR^loxTB mice compared with wild types (Fig. 5, E and F). No difference was observed between LepR^loxTB and GRIC-LepR^loxTB mice. The potential effect of the loxTB allele in these findings was evaluated by comparing the expression of gonadotrope subunits between LepR^loxTB and db/db female mice. No difference in Lhb, Fshb, and Cga expression was observed between both genotypes (Fig. 5G).

Fig. 5.

Increased FSH levels following endogenous reexpression of LepR in GnRHR cells. A and B: expression of GnRH (A) and GnRHR (B) in the hypothalamus of diestrus control (n = 7), LepR^loxTB (n = 6), and GRIC LepR^loxTB (n = 4) mice. C–F: expression of GnRHR (C), LH-β (D), FSH-β (E), and CGA mRNAs (F) in the pituitary gland of diestrus wild-type (n = 7), LepR^loxTB (n = 6), and GRIC LepR^loxTB (n = 4) mice. G: expression of LH-β, FSH-β, and CGA mRNAs in the pituitary gland of LepR^loxTB (n = 7) and db/db (n = 5) mice. All data were normalized to the housekeeping gene RPS29. H: serum levels of FSH in diestrus wild-type littermates (n = 14), LepR^loxTB (n = 12), and GRIC LepR^loxTB (n = 6) mice. Increase in FSH levels was observed in GRIC LepR^loxTB female mice compared with littermate controls in diestrus and LepR^loxTB female mice. *P < 0.05, **P < 0.01, and ***P < 0.001 compared with wild-type control mice per one-way ANOVA, Tukey's post hoc multiple-comparison test.

Serum LH levels were very low in all groups (mostly below the detection limit of the multiplex assay, i.e., 0.24 ng/ml), whereas higher circulating levels of FSH were observed in GRIC-LepR^loxTB compared with wild-type and LepR^loxTB littermates (Fig. 5H).

DISCUSSION

In this study, we used a combination of different mouse models to gain insight into the role of leptin action in gonadotropes. Using Cre-mediated recombination as a surrogate marker for LepR expression, we found that a subpopulation of gonadotropes expresses LepR. In ovaries, LepR is expressed in theca cells, whereas GRIC was rarely observed in cells of the ovarian parenchyma. No coexpression of leptin-induced pSTAT3 and GRIC was noticed in hypothalamic neurons. We found that endogenous reexpression of LepR selectively in gonadotropes (GRIC-LepR^loxTB mice) was not sufficient to induce puberty and improve fertility of female mice. However, interestingly, GRIC-LepR^loxTB mice have increased FSH levels.

The use of mouse models to interrogate complex physiological systems has become an important experimental approach in basic sciences. It has been particularly useful in areas in which standard methodologies have come across inherent difficulties. The physiology of the mouse pituitary gland is an example due to its size, anatomical location, and volume of hormone release. Because of these issues, the role of leptin direct action on gonadotropes has been difficult to determine.

Recent studies using mouse genetics have suggested that leptin signaling in gonadotropes is required for normal reproductive function. Conditional deletion of LepR in cells expressing LH-β delayed first pregnancy and decreased the number of pups per litter (1). The mechanisms underlying these effects are not completely understood, but the authors propose that the lack of leptin signaling altered GnRH binding sites and secretion of pituitary hormones. Among these hormones, a significant decrease in FSH levels and Fshb expression in pituitary gland was reported (1). Changes in growth or energy homeostasis were unremarkable. In agreement and as predicted from these findings, our mutant mice showed no change in body weight, discouraging any further evaluation of their metabolic phenotype. Because lack of leptin signaling in gonadotropes caused only minor impact on male fertility (1), and the production of the conditional gene reexpression requires a laborious breeding strategy due to male germ-line transgene activation in GRIC mouse, we focused our studies on female physiology.

The infertility of the leptin signaling-deficient mice has puzzled investigators for decades. Studies focusing on different reproductive organs indicate that the leptin-deficient ob/ob mice have normal development of the HPG axis until puberty, when sexual maturation is arrested. The ovarian morphology of juvenile ob/ob animals is comparable to that of juvenile wild-type mice, and gametogenesis can be induced following gonadotropin administration (32, 41). Reproductive hormones remain low throughout life, but ob/ob mice can ovulate and become fertile if levels of gonadotropins and sex steroids are maintained in physiological ranges (31). Castration increases gonadotropin secretion, although at a lower magnitude compared with controls, and the negative feedback action of sex steroids is exacerbated, also consistent with a prepubertal condition (33, 43).

Previous studies have shown that the leptin-deficient ob/ob mice have decreased circulating levels of gonadotropins and reduced pituitary content of LH. However, pituitary FSH content is increased in obese models (4, 43). In our mutant mice, we found that pituitary Lhb expression is not different from control or LepR^loxTB mice, but Fshb and Cga expression is increased in LepR^loxTB and in GRIC-LepR^loxTB females compared with controls in diestrus. Because the difference in Fshb and Cga expression between LepR^loxTB and GRIC-LepR^loxTB is not different, the role of restoration of LepR in transcript regulation is unlikely.

A dynamic change in leptin and LepR across the estrous cycle has been demonstrated (27). At midcycle or on estrogen stimulation, leptin rises, and leptin signaling is potentiated (15, 27). This effect appears to be correlated with the metabolic effects of estrogen in female rodents (2, 9, 10, 28). However, it is possible that the increase in leptin signaling at midcycle also has a physiological effect in reproductive function. It may amplify the LH surge and the FSH rise preceding ovulation. Using our genetic approach, we were unable to test this hypothesis due to lack of pubertal development. However, the increase in FSH levels in the GRIC-LepR^loxTB mice suggests that leptin action in gonadotropes may potentiate gonadotropin release (1). Previous studies have shown the majority of isolated gonadotropes express leptin-induced pSTAT3, and that mice with lack of leptin signaling in gonadotropes have decreased FSH levels (1). Using the reporter mice, we found that only a small subset of gonadotropes express LepR. The use of different approaches may explain the differences between the studies. Nevertheless, the results are complementary and reinforce the findings that leptin action in gonadotropes exerts a primary effect in adult, not prepubertal, mice and has a role in FSH secretion (1). Further studies using different models will be necessary to validate our findings and assess the mechanisms associated with the increase in FSH levels.

Little is known about the pituitary gland physiology of leptin signaling-deficient (ob/ob or db/db) mice. Initial studies have indicated that the GnRH action to stimulate FSH secretion is amplified in the pituitary of juvenile ob/ob mice, whereas its effect to induce LH secretion is blunted compared with controls (51). This may be due to the higher FSH content and expression and lower LH content in obese leptin signaling-deficient mice (43). Because previous studies have suggested that leptin action in gonadotropes may increase gonadotropin release by increasing GnRH binding sites, it is possible that the restoration of LepR in gonadotropes of the GRIC-LepR^loxTB mice has facilitated FSH release observed as increased FSH levels. Higher FSH, but not LH, secretion was observed, likely due to the low GnRH availability in LepR null mice. Again, additional studies are warranted to test this model.

Perspectives and Significance

Our studies indicate that endogenous reexpression of LepR in a subpopulation of gonadotropes increases FSH secretion. However, this increase was isolated and not sufficient to induce puberty and improve the infertility phenotype of the LepR^loxTB mice. Together with previous findings, our data indicate that leptin-selective action in gonadotropes has a role in adult reproductive physiology but is not sufficient to allow pubertal maturation in mice. Further studies will be necessary to determine the mechanisms by which leptin can directly modulate gonadotropin secretion.

GRANTS

This work was supported by the National Institute of Child Health and Human Development (R01-HD-069702 to C. F. Elias; HD-28934 for L. L. Burger) and by the Deutsche Forschungsgemeinschaft (SFB894 to U. Boehm).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

AUTHOR CONTRIBUTIONS

S.J.A. and B.C.B. performed experiments; S.J.A., D.G.-G., B.C.B., U.B., and C.F.E. analyzed data; S.J.A., D.G.-G., B.C.B., L.L.B., U.B., and C.F.E. interpreted results of experiments; S.J.A. prepared figures; S.J.A., D.G.-G., B.C.B., L.L.B., U.B., and C.F.E. edited and revised manuscript; S.J.A., D.G.-G., B.C.B., L.L.B., U.B., and C.F.E. approved final version of manuscript; C.F.E. conception and design of research; C.F.E. drafted manuscript.