Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2016 Jun 24;90(14):6453–6463. doi: 10.1128/JVI.00423-16

Identification of Respiratory Syncytial Virus Nonstructural Protein 2 Residues Essential for Exploitation of the Host Ubiquitin System and Inhibition of Innate Immune Responses

Jillian N Whelan a, Kim C Tran a, Damian B van Rossum b, Michael N Teng a,
Editor: D S Lylesc
PMCID: PMC4936147  PMID: 27147743

ABSTRACT

Respiratory syncytial virus (RSV) is a leading cause of lower respiratory tract infection in young children worldwide. The RSV nonstructural protein 2 (NS2) is a multifunctional protein that primarily acts to antagonize the innate immune system by targeting STAT2 for proteasomal degradation. We investigated the structural determinants of NS2 important for interaction with the host ubiquitin system to degrade STAT2 during infection. We found that NS2 expression enhances ubiquitination of host proteins. Bioinformatics analysis provided a platform for identification of specific residues that limit NS2-induced ubiquitination. Combinations of multiple mutations displayed an additive effect on reducing NS2-induced ubiquitination. Using a reverse genetics system, we generated recombinant RSV (rRSV) containing NS2 ubiquitin mutations, which maintained their effect on ubiquitin expression during infection. Interestingly, STAT2 degradation activity was ablated in the NS2 ubiquitin mutant rRSV. In addition, NS2 ubiquitin mutations decreased rRSV replication, indicating a correlation between NS2's ubiquitin function and antagonism of innate immune signaling to enhance viral replication. Our approach of targeting NS2 residues required for NS2 inhibition of immune responses provides a mechanism for attenuating RSV for vaccine development.

IMPORTANCE RSV has been circulating globally for more than 60 years, causing severe respiratory disease in pediatric, elderly, and immunocompromised populations. Production of a safe, effective vaccine against RSV is a public health priority. The NS2 protein is an effective target for prevention and treatment of RSV due to its antagonistic activity against the innate immune system. However, NS2-deleted RSV vaccine candidates rendered RSV overattenuated or poorly immunogenic. Alternatively, we can modify essential NS2 structural features to marginally limit viral growth while maintaining immune responses, providing the necessary balance between antigenicity and safety required for an effective vaccine. We coupled bioinformatics analysis with reverse genetics to introduce mutations into RSV's negative-sense genome. In this way we constructed rRSV NS2 ubiquitin mutants that limited NS2's ability to antagonize the innate immune system, thereby attenuating rRSV growth and increasing innate immune responses.

INTRODUCTION

Respiratory syncytial virus (RSV) is a global public health concern as the primary viral cause for lower respiratory tract infections in infants and young children worldwide. RSV is a member of the Pneumovirus genus of the Paramyxoviridae family of negative-sense, nonsegmented RNA viruses (1). A promoter-proximal transcription gradient directs the transcription of the 10 genes comprising the 15-kb RSV genome. The first two genes of the RSV genome, the nonstructural proteins (NS) NS1 and NS2, are the earliest and most abundantly expressed proteins upon infection. The 124-amino-acid NS2 protein is a nonessential protein that can be detected only within infected cells. Several functions have been described for NS2, with the most extensively described function being antagonism of the innate immune response during infection (2, 3).

RSV induces a considerably weaker innate immune response than other related viruses (4). This is partially due to NS2 inhibition of type I interferon (IFN-α/β) (3, 5, 6). NS2 targets the type I IFN response at several signaling events, the first of which blocks the induction of IFN-α/β expression through NS2 interaction with the cellular cytosolic receptor retinoic acid-inducible gene I (RIG-I) to limit its activation and subsequent transcription of IFN-α/β genes (7). In addition, NS2 alters expression levels of other signaling molecules that participate in type I IFN induction although the mechanism by which NS2 regulates these molecules is not well understood (7, 8). Downstream of IFN-α/β induction, NS2 also inhibits the type I IFN signaling cascade at the level of expression of signal transducer and activator of transcription 2 (STAT2) (5). STAT2 phosphorylation and association with STAT1 and interferon regulatory factor 9 (IRF9) trigger their nuclear translocation and transcription of antiviral genes. NS2 targets STAT2 for polyubiquitination and degradation via the proteasome (5, 6). While NS1 has been implicated in RSV-induced degradation of STAT2, NS2 is essential for its ubiquitination and proteasomal degradation during infection (9).

The ubiquitin (Ub) system is comprised of hundreds of proteins vital to cellular homeostasis. Initially, this system was thought to regulate protein expression levels by sending specific proteins to the proteasome for degradation, in addition to maintaining proper protein folding by targeting defective cellular proteins for degradation (10). In the past decade, numerous instances of host defense systems utilizing ubiquitin machinery for targeting foreign or pathogenic proteins for proteasomal degradation have been described (11). Ubiquitination is a reversible posttranslational modification in which the 8-kDa ubiquitin molecule is covalently conjugated to a target substrate protein. The three fundamental contributors to this enzymatic cascade are the E1-activating, E2-conjugating, and E3 protein ligase enzymes. Conjugation of a single ubiquitin moiety results in monoubiquitination, whereas conjugation of additional ubiquitin molecules to the initial ubiquitin generates polyubiquitin chains. Although proteasomal degradation is the best-studied role of ubiquitination, this modification participates in numerous cellular processes, including protein regulation, stability, localization, and trafficking and DNA repair and chromatin remodeling (1113). Since the ubiquitin system was first described, many additional components have been identified which perform individual roles within the E3 ligase complex to conjugate ubiquitin to substrate proteins (14, 15).

RNA viruses commonly encode multifunctional proteins that subvert host pathways and inhibit the immune response to enhance viral replication. The host ubiquitin system is one of several cellular systems commonly hijacked by viruses such that members of host E3 ligase complexes are assembled into complexes comprised of viral and cellular proteins. These E3 ligase complexes are thus reprogrammed to modify cellular and viral proteins in the interest of the virus (1621). RSV NS2 itself does not appear to function as an E1, E2, or E3 enzyme, suggesting that NS2 must co-opt host proteins for STAT2 ubiquitination (9).

We sought to further define the role of NS2 in targeting proteins for ubiquitination as a potential mechanism to understand how NS2 inhibits innate immune responses to enhance RSV replication. In this study, we show that NS2 expression induces increased ubiquitination of cellular proteins. We used bioinformatics analysis to identify NS2 residues critical to this NS2 function. Finally, we generated recombinant RSV bearing point mutations in NS2 that affect cellular ubiquitination and examined their effect on viral replication. Improved understanding of RSV NS2 interaction with the host during infection, as well as NS2 structural components essential for host interaction, will aid in elucidating key events of RSV pathogenesis that can be targeted for live attenuated vaccine development and therapeutic intervention.

MATERIALS AND METHODS

Cells.

293T human embryonic kidney cells (ATCC CRL-3216) were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco) with 5% fetal bovine serum (FBS). Human A549 pulmonary epithelial cells (ATCC CCL-185) were cultured in F-12 medium (Gibco) with 5% FBS. African green monkey kidney Vero cells (ATCC CCL-81) were cultured in minimal essential medium/Earle's balanced salt solution (MEM/EBSS; HyClone) with 5% FBS.

Plasmids and antibodies.

Human codon-optimized NS2 (Long strain) was provided by Michael Holtzman (Washington University School of Medicine) (5). Generation of the influenza virus hemagglutinin (HA)-tagged NS2 plasmid has been previously described (7). Human RSV (HRSV) NS2 subgroup B and bovine RSV (BRSV) NS2 genes and the NS2 gene of pneumonia virus mice (PVM) were synthesized and codon optimized by GenScript before being cloned using the BamHI and NotI restriction endonuclease sites of the pcDNA5 HA-tagged expression vector to replace HRSV NS2. All ubiquitin constructs were purchased from Addgene (Cambridge, MA) and contain an N-terminal HA tag in the pRK5 expression vector backbone. Rabbit polyclonal antisera against NS1 and NS2 antibodies were generated previously (7, 22). Biao He (University of Georgia) kindly provided the monoclonal antibody against HA (12CA5). The rabbit polyclonal antibody against RSV P protein was a gift from Paul Yeo (University Science Laboratories), and the rabbit polyclonal antibody against RSV N protein was a gift from Siba Samal (University of Maryland). Monoclonal antibodies against F protein for the plaque assay have been described previously (23). Rabbit polyclonal antibody against ubiquitin was purchased from Sigma (U5379) and used at a 1:100 dilution. Monoclonal antibody against β-actin was purchased from Sigma (A5319) and used at a 1:3,000 dilution. Horseradish peroxidase (HRP)-conjugated goat antibodies against rabbit IgG and mouse IgG were purchased from KPL (074-1506 and 074-1806, respectively) and used at a 1:6,000 dilution.

Primary amino acid sequence analysis.

To screen for amino acid residues in RSV NS2 which may play a role in the ubiquitination processes, we used a position-specific scoring matrix (PSSM)-based method described previously (2427). This adaptation of BLAST can aid in the prediction of noncanonical domains and in the isolation of amino acids with functional importance, particularly in a case, like that of NS2, where conventional BLAST approaches do not give any structural and/or functional information. Briefly, we used the NCBI Conserved Domain Database (http://www.ncbi.nlm.nih.gov/cdd) to curate 484 PSSMs related to ubiquitination systems. Human, sheep, and bovine NS2 were aligned with this specific PSSM library using reverse position-specific (rps)-BLAST with relaxed thresholds. All the positive alignments were recorded. Using the Smith-Waterman algorithm, alignments were reevaluated in each query sequence with PSSMs that were positive in rps-BLAST. Then, positional scores for each residue were calculated based on a substitution score with BLOSUM62. These values were summed for all alignments at each position to obtain a total raw residue score. We normalized each residue score by subtracting the average positional score across the entire sequence length; positional scores for human, sheep, and bovine NS2 were averaged together (see Fig. 5A, where high and low scores are indicated by shades of red and blue, respectively). For site-directed mutagenesis experiments, we chose five residues among the top 20 scoring residues (residue score of ≥50) and five residues below this threshold (i.e., possible negative controls). From the functional experiments it was determined that each of the five mutants selected above this threshold were loss-of-function mutations. Conversely, two out of five mutants selected below this threshold were without functional effect. Hence, in this implementation we cannot accurately predict negative controls based on these settings. That being said, it is reasonable to consider that the 15 untested residues in the top scoring positions may play structural/functional roles in ubiquitination processes.

FIG 5.

FIG 5

RSV NS2 ubiquitin mutants limit NS2-induced ubiquitination. (A) Adaptive-BLAST predictions for residues essential to HRSV and BRSV NS2-induced ubiquitination. Human, sheep, and bovine RSV NS2 amino acid sequences are shown, with predicted essential residues illustrated by red boxes (top 20 scoring residues). Black boxes indicate conserved human and bovine RSV NS2 residues selected for mutation to alanine (residues above the threshold are underlined). (B) 293T cells were transfected for 24 h with HA-ubiquitin or cotransfected with HA-NS2 WT or ubiquitin mutants. Data are representative of three experiments. (C) Densitometry analysis of the Western blot comparing ubiquitin expression to NS2 expression. Significance was calculated by Student's t test, with P values of ≤0.05 (*), ≤0.01 (**), ≤0.001 (***), and ≤0.0001 (****). Ave, average; AA, amino acid.

Construction of mutant NS2 expression plasmids.

PCR mutagenesis was performed as described previously using phosphorylated primer sets to produce deletion or point mutations in pcDNA5-HANS2 (7, 28). NS2 mutations were introduced with primers (Invitrogen) designed to generate the desired point mutation. NS2 mutants were amplified by PCR using the Deep Vent DNA polymerase (NEB), and the PCR amplicon was gel purified, ligated (NEB DNA ligase) to form a circular plasmid, and transformed into competent DH10B Escherichia coli cells. DNA preps were performed to purify the plasmid (GenElute HP plasmid miniprep kit; Sigma) and commercially sequenced to confirm the proper NS2 mutation(s) (Eurofins Genomics).

Transfections.

293T cells were transfected with plasmid DNA by incubating GeneJuice (Novagen) with DNA in serum-free DMEM for 20 min before DNA was added to 24-well plates containing DMEM supplemented with 5% FBS. Cells were incubated at 37°C for 24 h. Seventy-five nanograms of HA-tagged ubiquitin (HA-Ub; wild type [WT] or mutant) and 200 ng of HA-NS2 plasmid were transfected. pcDNA3 empty vector was used to ensure that equal amounts of DNA were transfected. 293T cells in 24-well plates were transfected with 100 ng of HA-ubiquitin for 8 h before infection at a high multiplicity of infection (MOI) of 3 PFU/cell for 14 h, for a total 24 h of transfection/infection.

Generation of recombinant RSV.

The RSV recombinant A2 (rA2) strain virus has been described previously. Recombinant RSVs (rRSVs) rA2, ΔNS1, and ΔNS2 (where ΔNS1 and ΔNS2 have deletions of NS1 and NS2, respectively) were derived from the wild-type RSV A2 strain (rA2) as previously described (2931). The rWT recombinant RSV (previously named rHA-NS2) was constructed from the pcDNA5-HANS2 expression vector, as described previously (7). NS2 mutant rRSVs were generated similarly by cloning the NS2 open reading frame (ORF) from the pcDNA5 constructs into a modified full-length antigenome cDNA (D53-HANS2) (7), followed by cotransfection into BSR/T7 cells with expression plasmids encoding codon-optimized RSV N, P, M2-1, and L genes (32, 33). Incorporation of NS2 mutations was confirmed by sequencing of cDNA prepared from isolated viral RNA.

Infections.

For protein expression, six-well plates of Vero and/or A549 cells were infected at a multiplicity of infection (MOI) of 3 for 20 h at 37°C before whole-cell lysate was harvested in 2× SDS sample buffer. For transfection-infection experiments, 24-well plates of 293T cells were infected for 14 h at 37°C. RNA was isolated from 24-well plates of A549 cells infected at an MOI of 3 for 22 h for real-time quantitative PCR (qPCR). Cells were either mock infected or infected at an MOI of 3 PFU per cell with the rRSV indicated on the figures in MEM with 5% FBS for 1 to 2 h before medium was replaced with new MEM with 5% FBS (Vero), F-12 medium supplemented with 5% FBS (A549), or DMEM with 5% FBS (293T). For multiple-step growth curves, six-well plates of A549 and Vero cells were infected in triplicate at an MOI of 0.01, and viral supernatant was harvested at approximately the same time from day 0 through day 5. To determine viral titers, plaque assays were performed in Vero cells, as described previously (32). Inoculum titers were measured to ensure equivalent infections.

Western blot analysis.

All proteins were detected from whole-cell lysate samples. At appropriate time points posttransfection or postinfection (p.i.), cells were harvested and washed once with phosphate-buffered saline (PBS). Cells were boiled at 95°C for 10 min in SDS sample buffer supplemented with 100 mM dithiothreitol (DTT). Proteins were separated by SDS-PAGE and transferred to a nitrocellulose membrane (GE Healthcare). Membranes were blocked overnight with 5% Blotto in 1× PBS. Primary and secondary antibodies were diluted in 5% Blotto in 1× PBS, and membranes were probed for at least 1 h with each antibody. Membranes were washed three times with 1× PBS with 0.1% Tween 20 (Sigma) for 10 min each wash. For detection of ubiquitin expression, membranes were blocked for 1 h in 5% bovine serum albumin (Calbiochem) in 1× Tris-buffered saline (TBS) with 0.1% Tween 20 before being probed with anti-ubiquitin antibody in 5% bovine serum albumin (Calbiochem) in 1× TBS with 0.1% Tween 20 overnight. Membranes were probed with secondary antibody for at least 1 h. Membranes were washed three times for 10 min each wash with 1× TBS with 0.1% Tween 20. Membranes were then incubated for 10 min with HRP substrate (Millipore Luminata Classico) before visualization of bands with a Bio-Rad Chemidoc XRS.

Quantitative reverse transcription-PCR (RT-PCR).

A549 cells were infected at an MOI of 3, and total RNA was harvested at 20 h postinfection in RNAzol RT (Molecular Research Center, Inc.) per the manufacturer's directions. First-strand cDNA was synthesized from 500 ng of RNA using random primers (iScript; Bio-Rad) in a volume of 20 μl. Real-time qPCR was performed on the cDNA samples using 10 μM concentrations of the primers indicated in Table 1 and a SYBR Green qPCR kit (SensiFast; Bioline) in a thermocycler (Chromo4; Bio-Rad) for 40 cycles.

TABLE 1.

Quantitative RT-PCR primers

Gene Primer sequencea
18S rRNA F: GTAACCCGTTGAACCCCATT
R: CCATCCAATCGGTAGTAGCG
IFN-β F: CTAACTGCAACCTTTCGAAGC
R: GGAAAGAGCTGTAGTGGAGAAG
ISG54 F: GGAGGGAGAAAACTCCTTGGA
R: GGCCAGTAGGTTGCACATTGT
a

F, forward; R, reverse.

Statistical analyses.

Densitometry was performed with Image Lab, version 5.0. Statistical significance was calculated by Student's t test using GraphPad Prism, version 6, with a 95% confidence interval.

RESULTS

Respiratory syncytial virus nonstructural protein 2 induces ubiquitination of host proteins.

To understand the interaction between RSV NS2 and the host ubiquitin system, we overexpressed HA-tagged ubiquitin (HA-Ub) in 293T cells and compared ubiquitin expression with that of cells coexpressing HA-Ub and HA-tagged NS2. Cotransfection of a constant amount of HA-Ub plasmid with increasing amounts of NS2 plasmid resulted in a dose-dependent increase in ubiquitination of a number of cellular proteins (Fig. 1A). The optimal concentration of NS2 for ubiquitination activity was determined to be 200 ng (denoted with an asterisk in Fig. 1A) and was therefore used for any future NS2 transfections. To ensure that enhanced ubiquitination by NS2 was not merely an artifact of ectopic overexpression, 293T cells were transfected with HA-Ub and subsequently infected with either wild-type recombinant RSV (rA2 or rWT rRSV) or rRSV with an NS1 or NS2 deletion (ΔNS1 or ΔNS2, respectively). Ubiquitin expression induced by the parental rA2 enhanced ubiquitination whereas infection with ΔNS2 resembled that of mock-infected cells (Fig. 1B). Infection with ΔNS1 also resulted in enhanced ubiquitination, despite lower viral gene expression, as evidenced by N and P levels (Fig. 1B, middle panel), indicating that this effect is specific to NS2. Enhanced ubiquitination was seen in rWT-infected cells, though to a slightly lower level than observed with rA2. The expression of NS1 and NS2 in infected cells was confirmed by Western blotting (Fig. 1B, bottom panel). The change in molecular weight of NS2 observed in rWT-infected cells compared to that in rA2- and ΔNS1-infected cells is a result of the HA tag (Fig. 1B, bottom panel). To further define NS2-induced ubiquitination, we sought to determine the type of ubiquitination induced by NS2 using ubiquitin mutant constructs. Figure 2A depicts the seven lysine residues in ubiquitin that are employed for polyubiquitin chain formation. Polyubiquitination using specific lysines (e.g., K48) often specifies the fate of the substrate protein. To determine if the NS2-induced ubiquitination favors a specific lysine conjugation, we used ubiquitin mutants that contain a single lysine residue (K6, K11, K27, K29, K48, or K63), while the remaining six lysines were mutated to arginine to prevent ubiquitin modification. Thus, polyubiquitination with these mutants can utilize only one particular lysine linkage. In addition, we included the K48R ubiquitin mutant, which eliminates K48-linked polyubiquitination for proteasomal degradation of proteins while preserving all of the other lysines, and the ubiquitin knockout (KO) mutant in which all seven lysine residues have been mutated to inhibit polyubiquitin chain formation entirely. We coexpressed NS2 in 293T cells with each HA-tagged ubiquitin mutant construct to compare NS2-induced ubiquitin expression patterns to those of wild-type ubiquitin (Ub WT) coexpression (Fig. 2B). While slight changes in overall expression levels were observed, ubiquitin banding patterns induced by NS2 coexpression with any of the ubiquitin mutants were consistent with banding patterns expressed by Ub WT. As expected, coexpression of NS2 with the K48 mutant resulted in proteasomal degradation of ubiquitinated proteins and therefore low ubiquitin expression. Notably, NS2 coexpression with the ubiquitin KO construct displayed banding patterns similar to those expressed with WT ubiquitin, suggesting that NS2 can stimulate monoubiquitination. Furthermore, our data suggest that NS2 is capable of inducing a variety of polyubiquitin arrangements independent of the position of the lysine linkage.

FIG 1.

FIG 1

RSV NS2 increases ubiquitin expression. (A) 293T cells were transfected for 24 h with a constant amount of HA-ubiquitin and increasing (2-fold) amounts of HA-NS2 (from 6.25 ng to 400 ng). (B) 293T cells were transfected with HA-ubiquitin for 8 h before either mock infection or infection with recombinant virus rA2, rWT (rHA-NS2), ΔNS1, or ΔNS2 at an MOI of 3 for 16 h.

FIG 2.

FIG 2

RSV NS2 induces monoubiquitination. (A) Map of ubiquitin with seven lysine residues labeled. Ubiquitin mutant constructs contain one or more lysine residues mutated to arginine. (B) 293T cells were transfected for 24 h with wild-type HA-ubiquitin (Ub) or HA-ubiquitin mutants, with NS2 cotransfected where indicated.

Mutation of NS2 residues required for ubiquitin function limits ubiquitination of host proteins.

We next wanted to determine the structural components necessary for the ubiquitin function of NS2. We generated NS2 truncation mutants containing deletions of 10 to 13 amino acids spanning the entire NS2 sequence. These NS2 truncations were coexpressed with HA-Ub to compare the ubiquitin expression levels and patterns induced by the NS2 truncations with those of wild-type NS2 (NS2 WT) (Fig. 3). All NS2 truncation mutants expressed detectable protein despite the deletion, indicating that the deletions did not result in structural instability. With the exception of the mutant with deletions of the first 10 N-terminal amino acids (NΔ10), the mutants all appeared to migrate in SDS-PAGE similarly to NS2 WT. Mutants with truncations of amino acids 21 to 30 (Δ21-30) through amino acids 75 to 84 (Δ75-84), as well as C-terminal truncation mutants Δ95-104 and CΔ10, displayed decreased host protein ubiquitination, suggesting that these residues are important for this function of NS2. N-terminal truncation mutants NΔ10 and Δ11-20 as well as the C-terminal truncation mutant Δ85-94 mimicked NS2 WT-induced ubiquitination, while the Δ105-114 mutant exhibited intermediate effects on NS2 function. This deletion analysis suggested that NS2's ubiquitination function requires the bulk of NS2's amino acid sequence, making precise determination of the NS2 structural components required for ubiquitination difficult.

FIG 3.

FIG 3

RSV NS2 truncations reduce NS2-induced ubiquitin expression. 293T cells were transfected for 24 h with HA-ubiquitin or cotransfected with a wild-type HA-NS2 or HA-NS2 truncation.

We next investigated whether this NS2 function is conserved among pneumoviruses. We coexpressed NS2 proteins from human RSV (HRSV) subgroups A and B, bovine RSV (BRSV), and pneumonia virus of mice (PVM) with HA-Ub in 293T cells and assessed their ability to induce ubiquitin expression as HRSV NS2 does (Fig. 4). Both HRSV subgroups A and B NS2 proteins induced ubiquitination of host proteins, as did BRSV NS2, which exhibits 84% sequence identity to HRSV NS2 (34). In contrast, PVM NS2, which has only 14% amino acid identity to HRSV NS2, was incapable of inducing cellular ubiquitination in this assay, indicating that this activity may be specific to RSV NS2 proteins (35).

FIG 4.

FIG 4

RSV NS2's effect on ubiquitin expression is conserved in bovine RSV NS2. 293T cells were transfected for 24 h with HA-ubiquitin or cotransfected with HRSV subgroup A NS2, HRSV subgroup B NS2, bovine RSV NS2, or NS2 of pneumonia virus of mice (PVM).

The sequence differences between BRSV and HRSV NS2 gave an indication of the residues likely not to be important in this activity; however, pinpointing specific amino acids essential for NS2-induced ubiquitination was not possible in this analysis. Therefore, we initiated a bioinformatics screen to identify NS2 residues essential for NS2 ubiquitination activity. As an expansion of a basic BLAST search of HRSV NS2, we implemented the Adaptive-BLAST algorithm to generate scores for each NS2 amino acid, determined by their sequence alignment to an extensive database of proteins involved in the host ubiquitin system (see Materials and Methods). Figure 5A illustrates the predicted impact of each NS2 residue on ubiquitin activity. Average positional scores for human, sheep, and bovine NS2 are presented above a multiple-sequence alignment of the same sequences. The bulk of the top 20 scoring residues (positional score of ≥50; red box) are clustered between amino acids 30 and 62, with select residues in more proximal regions. Taken together, our choice of residues to mutate was guided by the sequence analysis, the previously determined conservation, and physiochemical considerations. We chose five high-scoring and conserved residues (Fig. 5A, black boxes underlined) and five residues below this threshold (Fig. 5A, black boxes with no underlining) for mutagenesis to examine their roles in NS2-induced ubiquitination. Each of the residues was mutated to alanine in the HA-NS2 expression plasmid.

We evaluated the HA-tagged NS2 mutants by coexpressing them with HA-Ub in 293T cells and comparing their effects with the effect induced by NS2 WT (Fig. 5B). All NS2 mutants were expressed to high levels in 293T cells, and slight changes in expression levels compared with the NS2 WT level were shown by densitometry analysis not to affect ubiquitination (Fig. 5C). Several NS2 mutants dramatically limited ubiquitination, i.e., the T36A, L52A, P92A, and C105A mutants, showing a statistically significant decrease in cellular ubiquitination compared to that of NS2 WT. Several NS2 mutants displayed intermediate, though significantly decreased, levels of ubiquitination (P20A, C47A, F59A, and G74A), and the T31A and P110A mutations had no significant effect on NS2-induced ubiquitination. Remarkably, we did not observe a direct correlation between NS2 point mutants and their corresponding NS2 truncations in limiting ubiquitination, suggesting that some of the 10-amino-acid truncations may have had local effects on the secondary structure of NS2 which phenocopied the deletion of essential residues.

We then combined the three NS2 mutations exhibiting the greatest effect on ubiquitination—T36A, L52A, and P92A—to determine potential additive effects on reducing NS2-induced ubiquitination. Expression plasmids with distinct combinations of the three mutations were generated and assessed for their ability to induce cellular ubiquitination. The T36A mutant alone exhibited the greatest decrease in ubiquitination (Fig. 6A and B). Addition of the L52A and P92A mutations, either as double mutants with T36A or together as a triple mutant, did not significantly decrease the NS2 activity, implicating T36 as a key constituent behind NS2-induced ubiquitination.

FIG 6.

FIG 6

RSV NS2 ubiquitin combination mutants display an additive effect on NS2-induced ubiquitination. (A) 293T cells were transfected for 24 h with HA-ubiquitin or cotransfected with HA-NS2 WT or ubiquitin mutants. Data are representative of three experiments. (B) Densitometry analysis of the Western blot comparing ubiquitin expression to NS2 expression. Significance was calculated by Student's t test, with P values of ≤0.05 (*), ≤0.01 (**), ≤0.001 (***), and ≤0.0001 (****). TL, T36A L52A mutant.

Recombinant RSV containing NS2 ubiquitin mutations restores STAT2 expression and attenuates RSV growth during infection.

To assess the importance of the NS2-induced ubiquitination during infection, the T36A, L52A, and P92A mutants were inserted into rRSV, both as single and as combination mutants. We first evaluated protein expression by infecting A549 human lung adenocarcinoma cells with the NS2 mutant rRSV (Fig. 7A). The mutations had little effect on NS2 expression during infection (Fig. 7A, top panel). We detected differences in endogenous ubiquitination between rWT and NS2 ubiquitin mutant-infected cells. Specific ubiquitinated bands discernible in rWT-infected cells were either detected at lower levels or were entirely absent in NS2 mutant rRSV-infected cells, with the combination mutants showing greater effects than the single NS2 mutants (Fig. 7A, middle panel). To ensure that these differences were not due to antibody detection, 293T cells overexpressing HA-Ub were infected with rRSV NS2 ubiquitin mutants to examine the effects of the mutations on cellular ubiquitination (Fig. 7B). Similar to the effects in A549 cells, the combination NS2 mutant rRSV had a greater effect on cellular ubiquitination than the single mutants, with the triple mutant T36A L52A P92A (rTLP) inducing a level of ubiquitination similar to that of ΔNS2-infected cells. Interestingly, NS2's ability to target STAT2 for degradation was ablated during infection with NS2 mutant rRSV (Fig. 7A, bottom). The T36A mutation alone resulted in STAT2 levels similar to those in ΔNS2-infected cells. In addition, the combination mutants appeared to prevent STAT2 degradation. The L52A and P92A single mutants displayed an intermediate phenotype, with greater STAT2 expression than cells infected with WT rRSV but less than that of those infected with ΔNS2. Consequently, we further explored the involvement of NS2 residues T36, L52, and P92 in NS2 inhibition of type I IFN (IFN-α/β) responses during infection. We measured IFN-β and ISG54 mRNA levels in infected A549 cells by quantitative RT-PCR (qRT-PCR), comparing the single, double, and triple NS2 ubiquitination mutant rRSV with the rWT (Fig. 7C). We found that IFN-β and ISG54 expression induced by the NS2 mutant rRSVs was comparable to that of ΔNS2 and significantly more than that of either the rWT or rA2 virus, with two exceptions. The P92A double mutants (T36A P92A [rTP] and L52A P92A [rLP]) showed lower levels of IFN-β induction than the ΔNS2 and other NS2 mutants though these levels were significantly higher than those of the rA2 and rWT viruses.

FIG 7.

FIG 7

rRSV NS2 ubiquitin mutants affect host protein expression. (A) A549 cells were either mock infected or infected with the indicated rRSV HA-tagged NS2 viruses at an MOI of 3 for 22 h. (B) 293T cells were transfected with HA-ubiquitin for 8 h before mock infection or infection at an MOI of 3 for 16 h with the indicated rRSV. (C) Quantitative RT-PCR analysis with rRSV NS2 ubiquitin mutants.

To determine if the NS2 ubiquitin mutants alter viral replication, we performed multiple-step replication experiments in both A549 and Vero cells (Fig. 8). In A549 cells, the relative growth kinetics of the NS2 mutant rRSV resembled that of both the WT and ΔNS2, peaking at 3 or 4 days postinfection (p.i.) (Fig. 8A). However, all of the NS2 mutant rRSVs were attenuated, displaying peak titers intermediate between those of the WT and ΔNS2. The L52A mutant replicated to the highest peak titers (∼0.7 log PFU/ml lower than the WT) while all other mutants clustered between 1.0 and 1.5 log PFU/ml lower than the WT, with the triple mutant replicating to peak titers similar to those of ΔNS2 (Fig. 8A). Analysis of the peak titers showed that all the NS2 mutant rRSVs were significantly attenuated in A549 cells by day 4 (Table 1).

FIG 8.

FIG 8

Viral growth is attenuated by RSV NS2 ubiquitin mutants in A549 and Vero cells. A549 (A) and Vero (B) cells were infected at an MOI of 0.01, and supernatant was harvested for 5 days postinfection. Mean viral titers (y axis) and standard errors of the means are shown for the indicated day postinfection (x axis).

To determine if viral growth is decreased as a result of elevated type I interferon responses, we assessed growth kinetics of the NS2 mutant rRSV in Vero cells (Fig. 8B). As expected, the overall peak virus titers were higher in Vero cells, and the difference between rWT and ΔNS2 titers was decreased; however, the pattern of replication among the viruses was similar to that seen in A549 cells, with the NS2 mutant rRSV replicating to intermediate peak titers and the L52A mutant having the least attenuating effect. Table 2 shows that titers in Vero cells were also increased for all NS2 ubiquitin mutant viruses but that day 4 mean titers were again significantly attenuated in all NS2 mutant rRSVs, except rL52A, compared to rWT levels. Although the day 4 titers of some of the NS2 mutant viruses were less than the titer of ΔNS2, these differences were not significant except for the triple mutant.

TABLE 2.

Viral growth is attenuated by rRSV NS2 ubiquitin mutants in A549 and Vero cells

Virus Growth in A549 cellsa
Growth in Vero cellsa
Avg day 4 titer (log10 PFU/ml) P valueb Avg day 4 titer (log10 PFU/ml) P valueb
rWT 5.130 5.549
rT36A 4.103 0.0031** 5.030 0.0012**
rL52A 4.395 0.0011** 5.276 0.0612c
rP92A 3.930 0.0019** 4.929 0.0093**
rTL 3.756 0.0003*** 5.016 0.0160*
rTP 3.728 0.0010** 4.961 0.0005***
rLP 3.728 0.0003*** 4.950 0.0005***
rTLP 3.593 <0.0001**** 4.672 <0.0001****
ΔNS2 3.409 <0.0001**** 5.024 0.0007***
a

Cells were infected at an MOI of 0.01, and supernatant was harvested daily for 5 days postinfection.

b

P values were determined by Student's t test in comparison to results for the rWT virus. Levels of significance are indicated as follows: *, ≤0.05; **, ≤0.01; ***, ≤0.001; ****, ≤0.0001.

c

Not significant.

DISCUSSION

We show here that RSV NS2 induces ubiquitination of host proteins both by ectopic expression and in the context of virus infection. While NS2-induced STAT2 degradation requires K48-linked polyubiquitination, our studies with ubiquitin lysine mutants revealed that NS2 activity resulted in numerous ubiquitin arrangements, suggesting that RSV-induced ubiquitination has additional purposes during infection. We identified specific NS2 residues that are required for this ubiquitination as the first evidence of vital NS2 structural components. Infection with recombinant RSV viruses containing NS2 mutations that ablate NS2 ubiquitination activity showed that this function is important for viral replication and inhibition of innate immune responses.

Previously published data show that NS2 does not contain the putative consensus sequences necessary to act as an E1, E2, or E3 enzyme to directly ubiquitinate STAT2; therefore, it is likely that NS2 recruits host ubiquitin system proteins to conjugate ubiquitin to targeted proteins (9). In addition to targeting STAT2 for proteasomal degradation, NS2, as indicated by our data, can induce monoubiquitination of an array of cellular proteins. Additional studies must be done to elucidate the mechanism by which NS2 employs the host ubiquitin system; however, it appears that RSV, through NS2, utilizes this system for several distinct functions.

Replication of the NS2 mutant rRSV was attenuated in IFN-sufficient A549 cells even at early time points postinfection, which can be explained by the loss of STAT2 proteasomal targeting resulting in heightened innate immune signaling and subsequent attenuation of RSV growth. This is supported by an increase in IFN-β and ISG54 transcription observed during infection with NS2 mutant rRSVs compared to transcription levels in rWT infection. Interestingly, inconsistencies between IFN-β and ISG54 levels induced by both rTP and rLP NS2 mutants indicate that individual mutations may alter distinct IFN-antagonizing functions of NS2. Upstream of STAT2 degradation, NS2 inhibits type I IFN production by binding to the antiviral cytosolic receptor retinoic acid-inducible gene 1 (RIG-I) and blocking its downstream interaction with the mitochondrial antiviral signaling protein (MAVS) (7). NS2 residues important for STAT2 degradation would have a greater effect on ISG54 levels, while residues required for upstream inhibition of type I IFN production would affect IFN-β and subsequent ISG54 production. Limiting multiple NS2 functions would explain the additive effect demonstrated by combining the effective mutations.

In contrast to the attenuation phenotype exhibited in A549 cells, replication of the NS2 mutant rRSV in type I IFN-deficient Vero cells was not significantly different at early times postinfection; significant differences in viral replication were apparent only later in infection. This suggests that the ubiquitination function of NS2 plays a role in the virus life cycle independent of its IFN-antagonizing activity. It is possible that the NS2 residues important for ubiquitination (e.g., T36, L52, and P92) interact with cellular ubiquitin components to support alternative viral activities, such as replication or budding. While influenza virus manipulation of the host ubiquitin system to inhibit innate immune responses has been described extensively, a recent study identified a cellular ubiquitin ligase as an interaction partner of the influenza virus M2 protein required for viral budding and pathogenesis (36, 37). In addition, this interaction appears to stabilize influenza virus M2 by inhibiting its degradation. To identify additional NS2 functions dependent on NS2 exploitation of the ubiquitin system, we can implement our bioinformatics-driven NS2 mutagenesis approach that we have validated in regard to STAT2 degradation, inhibition of type I IFN induction, and RSV replication functions.

There is a notable difference in ubiquitin banding patterns between the HA-tagged ubiquitin overexpressed in 293T cells and those observed via endogenous ubiquitin detection in infected A549 cells. It is possible that a subpopulation of the ubiquitinated proteins detected in these two distinct systems is different. There are a number of important differences in these two experimental systems: (i) the method of detection of ubiquitinated proteins, (ii) the tissue of origin for 293T versus A549 cells, and (iii) the presence of the remaining RSV proteome. We have found substantial variation in the ability of anti-ubiquitin antibodies from different commercial vendors to detect ubiquitinated proteins. Probing of duplicate blots using different antibodies also can result in detection of different bands. The reasons for these differences are unclear. First, the detection of HA-tagged ubiquitin is more robust and consistent. Second, 293T cells are derived from human embryonic kidney cells while A549 cells are human lung carcinoma cells. This difference in tissue of origin likely results in a different spectrum of proteins being expressed in the two cell lines, which may result in the different banding patterns. Finally, other RSV proteins may themselves induce ubiquitination of a separate array of host proteins; alternatively, the expression of other RSV proteins during infection may augment NS2 targeting of specific proteins for ubiquitination. RSV NS1 and NS2 putative binding regions for heterodimerization have been proposed; thus, they may act synergistically to execute type I IFN inhibition activity or other unknown activity (38). Furthermore, infection of A549 cells triggers expression of numerous antiviral proteins that are not expressed in transfected 293T cells, which creates diverse cellular environments as targets for NS2-mediated ubiquitination. The differences in banding patterns in multiple cell lines support our hypothesis of general NS2-induced ubiquitination of a wide range of proteins for several distinct functions, and further studies will focus on identification of specific ubiquitinated proteins.

While the Ada-BLAST scores were relatively successful at defining residues that are or are not important for NS2-induced ubiquitination, two residues did not fit the predicted profile. F59 was a high-scoring residue that did not appear to be involved in NS2-induced ubiquitination while T36, which was predicted to not have an effect, was the most important residue for this function that we identified. Although T36 is not a high-scoring residue in the sequence analysis, mutation in this residue could change the local structure and H bonding of adjacent residues (e.g., H37), which could substantially impact the structure and function of NS2. Alternatively, our sequence analysis methods may not be sensitive enough to predict all of the functional residues in NS2 by score alone.

The RSV NS2 protein is a potential mutagenesis candidate for an RSV vaccine due to its primary function of inhibiting the immune response. Mutating NS2 residues required for NS2's ubiquitin function attenuated RSV growth to levels comparable to those of the NS2 deletion virus. Recently, Meng et al. used a codon usage deoptimization strategy to develop live attenuated RSV vaccine candidates by limiting expression of NS1 and NS2 (39). This method theoretically diminishes all NS protein functions though it would not completely ablate any particular activity. Indeed, the investigators show that STAT2 levels in cells infected with NS-deoptimized rRSV are ∼2-fold higher than in cells infected by WT rRSV and similar to those in mock-infected cells (39). In contrast, targeting the ubiquitination function of NS2 by mutagenesis resulted in viruses that induced noticeably more STAT2 in infected cells than in either WT rRSV- or mock-infected cells (Fig. 7). However, mutating NS2 alone may not suffice to produce an RSV vaccine candidate since RSV infection with recombinant NS2-deleted virus is overattenuated in adults and fails to produce an adequate immune response in children (40). By combining NS2 mutations with additional attenuating mutants, it may be possible to limit the interferon antagonist function of NS2 while being able to tune viral replication to develop a sufficiently attenuated and immunogenic vaccine. Additionally, RSV F and G protein surface expression in NS2 mutant rRSV remains intact to elicit a high antibody response, coupled with improved innate immune signaling which would ultimately lead to a robust adaptive immune response that is typically absent in both natural and vaccine-induced immune responses to RSV infection.

ACKNOWLEDGMENTS

J.N.W. acknowledges support from the University of South Florida Signature Research Doctoral Fellowship in Drug Design and Delivery. J.N.W. and M.N.T. acknowledge support from the Joy McCann Culverhouse Airway Diseases Research Center at the University of South Florida Morsani College of Medicine.

We thank Ruan Cox, Jr., and Eric M. Lewandowski for their help in cloning NS2 mutant expression plasmids.

Funding Statement

This work was funded in part by HHS|NIH| National Institute of Allergy and Infectious Diseases (NIAID) (AI081977 to M.N.T.).

REFERENCES

  • 1.Collins LP, Chanock Robert M, Murphy Brian R. 2001. Respiratory syncytial virus. Lippincott Williams and Wilkins, Philadelphia, PA. [Google Scholar]
  • 2.Teng MN. 2012. The non-structural proteins of RSV: targeting interferon antagonists for vaccine development. Infect Disord Drug Targets 12:129–137. doi: 10.2174/187152612800100170. [DOI] [PubMed] [Google Scholar]
  • 3.Spann KM, Tran KC, Chi B, Rabin RL, Collins PL. 2004. Suppression of the induction of alpha, beta, and lambda interferons by the NS1 and NS2 proteins of human respiratory syncytial virus in human epithelial cells and macrophages [corrected]. J Virol 78:4363–4369. doi: 10.1128/JVI.78.8.4363-4369.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Fontana JM, Bankamp B, Rota PA. 2008. Inhibition of interferon induction and signaling by paramyxoviruses. Immunol Rev 225:46–67. doi: 10.1111/j.1600-065X.2008.00669.x. [DOI] [PubMed] [Google Scholar]
  • 5.Lo MS, Brazas RM, Holtzman MJ. 2005. Respiratory syncytial virus nonstructural proteins NS1 and NS2 mediate inhibition of Stat2 expression and alpha/beta interferon responsiveness. J Virol 79:9315–9319. doi: 10.1128/JVI.79.14.9315-9319.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Ramaswamy M, Shi L, Varga SM, Barik S, Behlke MA, Look DC. 2006. Respiratory syncytial virus nonstructural protein 2 specifically inhibits type I interferon signal transduction. Virology 344:328–339. doi: 10.1016/j.virol.2005.09.009. [DOI] [PubMed] [Google Scholar]
  • 7.Ling Z, Tran KC, Teng MN. 2009. Human respiratory syncytial virus nonstructural protein NS2 antagonizes the activation of beta interferon transcription by interacting with RIG-I. J Virol 83:3734–3742. doi: 10.1128/JVI.02434-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Swedan S, Musiyenko A, Barik S. 2009. Respiratory syncytial virus nonstructural proteins decrease levels of multiple members of the cellular interferon pathways. J Virol 83:9682–9693. doi: 10.1128/JVI.00715-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Elliott J, Lynch OT, Suessmuth Y, Qian P, Boyd CR, Burrows JF, Buick R, Stevenson NJ, Touzelet O, Gadina M, Power UF, Johnston JA. 2007. Respiratory syncytial virus NS1 protein degrades STAT2 by using the elongin-cullin E3 ligase. J Virol 81:3428–3436. doi: 10.1128/JVI.02303-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Hochstrasser M. 1996. Ubiquitin-dependent protein degradation. Annu Rev Genet 30:405–439. doi: 10.1146/annurev.genet.30.1.405. [DOI] [PubMed] [Google Scholar]
  • 11.Jiang X, Chen ZJ. 2012. The role of ubiquitylation in immune defence and pathogen evasion. Nat Rev Immunol 12:35–48. doi: 10.1038/nri3111. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Clague MJ, Urbe S. 2010. Ubiquitin: same molecule, different degradation pathways. Cell 143:682–685. doi: 10.1016/j.cell.2010.11.012. [DOI] [PubMed] [Google Scholar]
  • 13.Schnell JD, Hicke L. 2003. Non-traditional functions of ubiquitin and ubiquitin-binding proteins. J Biol Chem 278:35857–35860. doi: 10.1074/jbc.R300018200. [DOI] [PubMed] [Google Scholar]
  • 14.Zimmerman ES, Schulman BA, Zheng N. 2010. Structural assembly of cullin-RING ubiquitin ligase complexes. Curr Opin Struct Biol 20:714–721. doi: 10.1016/j.sbi.2010.08.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dikic I, Wakatsuki S, Walters KJ. 2009. Ubiquitin-binding domains—from structures to functions. Nat Rev Mol Cell Biol 10:659–671. doi: 10.1038/nrm2767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gustin JK, Moses AV, Fruh K, Douglas JL. 2011. Viral takeover of the host ubiquitin system. Front Microbiol 2:161. doi: 10.3389/fmicb.2011.00161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Wang YE, Park A, Lake M, Pentecost M, Torres B, Yun TE, Wolf MC, Holbrook MR, Freiberg AN, Lee B. 2010. Ubiquitin-regulated nuclear-cytoplasmic trafficking of the Nipah virus matrix protein is important for viral budding. PLoS Pathog 6:e1001186. doi: 10.1371/journal.ppat.1001186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Liao TL, Wu CY, Su WC, Jeng KS, Lai MM. 2010. Ubiquitination and deubiquitination of NP protein regulates influenza A virus RNA replication. EMBO J 29:3879–3890. doi: 10.1038/emboj.2010.250. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yokota S, Okabayashi T, Yokosawa N, Fujii N. 2008. Measles virus P protein suppresses Toll-like receptor signal through up-regulation of ubiquitin-modifying enzyme A20. FASEB J 22:74–83. [DOI] [PubMed] [Google Scholar]
  • 20.Okumura A, Alce T, Lubyova B, Ezelle H, Strebel K, Pitha PM. 2008. HIV-1 accessory proteins VPR and Vif modulate antiviral response by targeting IRF-3 for degradation. Virology 373:85–97. doi: 10.1016/j.virol.2007.10.042. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ulane CM, Horvath CM. 2002. Paramyxoviruses SV5 and HPIV2 assemble STAT protein ubiquitin ligase complexes from cellular components. Virology 304:160–166. doi: 10.1006/viro.2002.1773. [DOI] [PubMed] [Google Scholar]
  • 22.Ling Z, Tran KC, Arnold JJ, Teng MN. 2008. Purification and characterization of recombinant human respiratory syncytial virus nonstructural protein NS1. Protein Expr Purif 57:261–270. doi: 10.1016/j.pep.2007.09.017. [DOI] [PubMed] [Google Scholar]
  • 23.Beeler JA, Coelingh KV. 1989. Neutralization epitopes of the F glycoprotein of respiratory syncytial virus: effect of mutation upon fusion function. J Virol 63:2941–2950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Chintapalli SV, Bhardwaj G, Patel R, Shah N, Patterson RL, van Rossum DB, Anishkin A, Adams SH. 2015. Molecular dynamic simulations reveal the structural determinants of fatty acid binding to oxy-myoglobin. PLoS One 10:e0128496. doi: 10.1371/journal.pone.0128496. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Hedgepeth SC, Garcia MI, Wagner LE II, Rodriguez AM, Chintapalli SV, Snyder RR, Hankins GD, Henderson BR, Brodie KM, Yule DI, van Rossum DB, Boehning D. 2015. The BRCA1 tumor suppressor binds to inositol 1,4,5-trisphosphate receptors to stimulate apoptotic calcium release. J Biol Chem 290:7304–7313. doi: 10.1074/jbc.M114.611186. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Hong YCS, Bhardwaj G, Zhang Z, Patterson RL, van Rossum DB. 2011. Adaptive-BLAST: a user-defined platform for the study of proteins. J Integr Omics 1:88–101. [Google Scholar]
  • 27.Ko K, Liu C, Rwebangira MR, Burge L, Southerland W. 2011. The development of a proteomic analyzing pipeline to identify proteins with multiple RRMs and predict their domain boundaries, p 374–381. In Chen B, Chen J, Chen X, Chen Y, Cho Y-R, Cui J, Haspel N, He J, Hsu H-H, Huang Y, Huang K, Jiang R, Khudyakov Y, Kwo CK, Li G, Li G-Z, Mandoiu I, Park T, Policriti A, Qin ZS, Reddy C, Ressom H, Satten G, Schonback C, Shehu A, Song M, Song X, Tseng V, Xiong Z, Yoo I, Zelikovsky A, Zhang G, Zhang J, Zho S, Zhao Z, Zheng J, Zhu D (ed), Proceedings of the 2011 IEEE International Conference on Bioinformatics and Biomedicine Workshops, Atlanta, GA. Institute of Electrical and Electronics Engineers, New York, NY. [Google Scholar]
  • 28.Teng MN, Whitehead SS, Collins PL. 2001. Contribution of the respiratory syncytial virus G glycoprotein and its secreted and membrane-bound forms to virus replication in vitro and in vivo. Virology 289:283–296. doi: 10.1006/viro.2001.1138. [DOI] [PubMed] [Google Scholar]
  • 29.Teng MN, Whitehead SS, Bermingham A, St Claire M, Elkins WR, Murphy BR, Collins PL. 2000. Recombinant respiratory syncytial virus that does not express the NS1 or M2-2 protein is highly attenuated and immunogenic in chimpanzees. J Virol 74:9317–9321. doi: 10.1128/JVI.74.19.9317-9321.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Teng MN, Collins PL. 1999. Altered growth characteristics of recombinant respiratory syncytial viruses which do not produce NS2 protein. J Virol 73:466–473. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Spann KM, Collins PL, Teng MN. 2003. Genetic recombination during coinfection of two mutants of human respiratory syncytial virus. J Virol 77:11201–11211. doi: 10.1128/JVI.77.20.11201-11211.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Collins PL, Hill MG, Camargo E, Grosfeld H, Chanock RM, Murphy BR. 1995. Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5′ proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine development. Proc Natl Acad Sci U S A 92:11563–11567. doi: 10.1073/pnas.92.25.11563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Hotard AL, Shaikh FY, Lee S, Yan D, Teng MN, Plemper RK, Crowe JE Jr, Moore ML. 2012. A stabilized respiratory syncytial virus reverse genetics system amenable to recombination-mediated mutagenesis. Virology 434:129–136. doi: 10.1016/j.virol.2012.09.022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Pastey MK, Samal SK. 1995. Nucleotide sequence analysis of the non-structural NS1 (1C) and NS2 (1B) protein genes of bovine respiratory syncytial virus. J Gen Virol 76:193–197. doi: 10.1099/0022-1317-76-1-193. [DOI] [PubMed] [Google Scholar]
  • 35.Sacco RE, Durbin RK, Durbin JE. 2015. Animal models of respiratory syncytial virus infection and disease. Curr Opin Virol 13:117–122. doi: 10.1016/j.coviro.2015.06.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Tripathi S, Pohl MO, Zhou Y, Rodriguez-Frandsen A, Wang G, Stein DA, Moulton HM, DeJesus P, Che J, Mulder LC, Yanguez E, Andenmatten D, Pache L, Manicassamy B, Albrecht RA, Gonzalez MG, Nguyen Q, Brass A, Elledge S, White M, Shapira S, Hacohen N, Karlas A, Meyer TF, Shales M, Gatorano A, Johnson JR, Jang G, Johnson T, Verschueren E, Sanders D, Krogan N, Shaw M, Konig R, Stertz S, Garcia-Sastre A, Chanda SK. 2015. Meta- and orthogonal integration of influenza “omics” data defines a role for UBR4 in virus budding. Cell Host Microbe 18:723–735. doi: 10.1016/j.chom.2015.11.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Gack MU, Albrecht RA, Urano T, Inn KS, Huang IC, Carnero E, Farzan M, Inoue S, Jung JU, Garcia-Sastre A. 2009. Influenza A virus NS1 targets the ubiquitin ligase TRIM25 to evade recognition by the host viral RNA sensor RIG-I. Cell Host Microbe 5:439–449. doi: 10.1016/j.chom.2009.04.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Swedan S, Andrews J, Majumdar T, Musiyenko A, Barik S. 2011. Multiple functional domains and complexes of the two nonstructural proteins of human respiratory syncytial virus contribute to interferon suppression and cellular location. J Virol 85:10090–10100. doi: 10.1128/JVI.00413-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Meng J, Lee S, Hotard AL, Moore ML. 2014. Refining the balance of attenuation and immunogenicity of respiratory syncytial virus by targeted codon deoptimization of virulence genes. mBio 5:e01704–14. doi: 10.1128/mBio.01704-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wright PF, Karron RA, Madhi SA, Treanor JJ, King JC, O'Shea A, Ikizler MR, Zhu Y, Collins PL, Cutland C, Randolph VB, Deatly AM, Hackell JG, Gruber WC, Murphy BR. 2006. The interferon antagonist NS2 protein of respiratory syncytial virus is an important virulence determinant for humans. J Infect Dis 193:573–581. doi: 10.1086/499600. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES