Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Jul 1.
Published in final edited form as: Transfusion. 2016 Apr 4;56(7):1775–1785. doi: 10.1111/trf.13583

ADAMTS13 Autoantibodies Cloned from Patients with Acquired Thrombotic Thrombocytopenic Purpura: 2. Pathogenicity in an animal model

Eric M Ostertag 1, Khalil Bdeir 1, Stephen Kacir 1, Michelle Thiboutot 1, Gayathri Gulendran 1, Lenka Yunk 1, Vincent M Hayes 2, David G Motto 3, Mortimer Poncz 2, X Long Zheng 4, Douglas B Cines 1, Don L Siegel 1
PMCID: PMC4938757  NIHMSID: NIHMS762011  PMID: 27040023

Abstract

BACKGROUND

Acquired thrombotic thrombocytopenic purpura (TTP) is a potentially fatal disease in which ultra-large von Willebrand Factor (UL-VWF) multimers accumulate as a result of autoantibody inhibition of the VWF protease, ADAMTS13. Current treatment is not specifically directed at the responsible autoantibodies and in some cases is ineffective or of transient benefit. More rationale, reliable and durable therapies are needed, and a human autoantibody-mediated animal model would be useful for their development. Previously, TTP patient anti-ADAMTS13 variable region fragments (scFv’s) were cloned that inhibited ADAMTS13 proteolytic activity in vitro and expressed features in common with inhibitory IgG in patient plasma. Here, pathogenicity of these scFv’s is explored in vivo by transfecting mice with inhibitory antibody cDNA.

STUDY DESIGN AND METHODS

Hydrodynamic tail vein injection of naked DNA encoding human anti-ADAMTS13 scFv was used to create sustained ADAMTS13 inhibition in mice. Accumulation of UL-VWF multimers was measured and formation of platelet thrombi following focal or systemic vascular injury was examined.

RESULTS

Transfected mice expressed physiological plasma levels of human scFv and developed sustained ADAMTS13 inhibition and accumulation of unprocessed UL-VWF multimers. Induced focal endothelial injury generated platelet thrombi extending well beyond the site of initial injury, and systemic endothelial injury induced thrombocytopenia, schistocyte formation, platelet thrombi, and death.

CONCLUSIONS

These results demonstrate for the first time the ability of human recombinant monovalent anti-ADAMTS13 antibody fragments to recapitulate key pathologic features of untreated acquired TTP in vivo, validating their clinical significance and providing an animal model for testing novel targeted therapeutic approaches.

Keywords: Thrombotic thrombocytopenic purpura, ADAMTS13, von Willebrand Factor, microangiopathic hemolytic anemia, therapeutic plasma exchange, animal models

INTRODUCTION

Current therapeutic approaches to the treatment of antibody-mediated autoimmune disease are generally limited to the use of systemic immunosuppression with its attendant side effects rather than therapy that targets the pathogenic autoantibodies. To rectify this situation, there is a need to gain a better understanding of the repertoire of autoantibody expression within an individual patient and across multiple patients at a molecular level to delineate autoantibody clonality, epitope specificity, idiotypic relatedness, and functional significance in vivo. This knowledge may then lead to the design of animal models that can be used to test innovative therapies that specifically target pathogenic autoantibodies or the B-cells that produce them.

The acquired form of thrombotic thrombocytopenic purpura (TTP) is an example of an autoimmune disorder in which the majority of patients have reduced activity levels of the von Willebrand factor (VWF)-cleaving protease ADAMTS13 due to the development of autoantibodies that inhibit enzyme function.1–7 Decreased ADAMTS13 activity results in the accumulation of ultra-large VWF (UL-VWF) multimers that foster widespread platelet aggregation in the microcirculation when coincident with additional factors such as endothelial injury, and can lead to severe thrombocytopenia, microangiopathic hemolytic anemia, organ dysfunction, and death.8–10

Therapeutic plasma exchange (TPE) is first-line therapy for TTP, reducing mortality from ~90% to ~15%, but is inherently “non-specific” i.e., independent of autoantibody specificity. Even with earlier recognition of disease and initiation of TPE, and the use of additional non-specific interventions (e.g., corticosteroids, cyclosporin, rituximab, splenectomy),11–13 the mortality for patients diagnosed with TTP has not changed significantly since the initial introduction of TPE over 25 years ago.14 Alternative therapeutic approaches for TTP have been proposed including the infusion of excess quantities of recombinant ADAMTS13 to override autoantibody inhibition,15 and agents that would target UL-VWF multimers either by reducing their size or by blocking their interactions with platelets.16–20 However, it is not clear that these approaches would obviate the need for TPE and/or use of immunosuppressive medications, since these interventions do not diminish the binding or production of pathogenic inhibitors.21,22 Moreover, interventions that affect pathogenesis downstream of autoantibody-mediated ADAMTS13 inhibition have the potential downside of inhibiting normal hemostatic processes that are mediated through some of the same pathways.

Animal models of acquired TTP that employ patient-derived recombinant anti-ADAMTS13 autoantibodies would facilitate the development and testing of novel therapies, but none have been described.23 A number of currently available models for simulating acquired TTP in animals do not use antibodies at all, e.g. they trigger a TTP-like syndrome in mice by infusion of cleavage-resistant VWF24 or by the infusion of UL-VWF multimers that overwhelm endogenous ADAMTS13 capacity.25 Animal models of TTP that do employ antibodies to inhibit ADAMTS13 have been restricted to using xenoantibodies to ADAMTS13, e.g., polyclonal and polyspecific rabbit anti-ADAMTS13 antibodies in mice,26,27 or murine monoclonal antibodies in baboons.28 Animal models employing xenoantibodies may not be appropriate for testing agents that block the idiotopes of human anti-ADAMTS13 autoantibodies or for evaluating engineered forms of ADAMTS13 designed to be uninhibitable by TTP patient autoantibodies29,30 since human ADAMTS13 autoepitopes could not be assumed to be the same as the epitopes to which rabbit and mouse immune systems respond. Furthermore, intravascular injections of anti-ADAMTS13 antibody, regardless of antibody source, result in only transient decreases in ADAMTS13 activity (~24 hours), which does not faithfully simulate the continuous inhibition of ADAMTS13 seen during the acute and chronic phases of the human disease.

In an accompanying manuscript in this series44, we described the cloning and characterization of a large set of human monoclonal anti-ADAMTS13 antibody fragments from TTP patients, a subset of which inhibited ADAMTS13 proteolytic activity in vitro and expressed key features in common with inhibitory IgG in patient plasma. Here we test the clinical relevance of these antibodies by transfecting their cDNA into mouse hepatocytes by direct hydrodynamic tail vein plasmid gene transfer. We explore the effects of recombinant human autoantibodies expressed in vivo on murine ADAMTS13 activity, processing of murine UL-VWF multimers, and formation of murine platelet thrombi following focal or systemic vascular injury.

MATERIALS AND METHODS

Intraperitoneal injection of anti-ADAMTS13 scFv’s in mice

Two- to 3-month-old mice (C57BL/6 or CAST/Ei, Jackson Laboratory, Bar Harbor, ME) were anesthetized with ketamine/xylazine, and blood samples (50 µL) were obtained from jugular veins before and after intraperitoneal injection of 100 µL PBS containing 30 µg human anti-ADAMTS13 recombinant single chain variable region antibody fragments (scFv’s). ScFv were produced in Drosophila S2 cells as described44. Blood samples were taken at times indicated and anticoagulated with heparin. Plasma was separated from cells at 1500g for 15 min for ADAMTS13 activity assays.

Cloning scFv cDNA into pLIVE in vivo expression vector

The pLIVE plasmid expression vector (Mirus, Madison, WI), a vector driven by a liver-specific promoter composed of the minimal mouse albumin promoter and the mouse α-fetoprotein enhancer,31 was modified in its multiple cloning site to contain an immunoglobulin kappa-chain leader sequence upstream from Sfi I restriction sites and a V5-tag sequence to facilitate secretion of V5-tagged scFv antibody fragments from murine liver following hydrodynamic delivery. pLIVE vector was first digested with Nhe I and Xho I restriction enzymes and a double-stranded oligonucleotide formed from the annealing of “V5 FOR” (5’-CTAGCACTAGTGGCCAGGCCGGCCAGTTCGAAGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTACGCGTACCGGTTAGC-3’) and “V5 REV” (5’-TCGAGCTAACCGGTACGCGTAGAATCGAGACCGAGGAGAGGGTTAGGGATAGGCTTACCTTCGAACTGGCCGGCCTGGCCACTAGTG-3’) was ligated into the cut and gel-purified vector to introduce the 3’ Sfi I restriction site (bold), the V5 tag sequence (underlined), and a stop codon (italics). The resultant plasmid was digested with Nhe I and Sfi I and a second double-stranded oligonucleotide formed from the annealing of “LEAD FOR” (5’-CTAGCATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGGAGCTGCGGCCCAGGCGGCCCCATGGCCCGGGGTACCTACTAGTGGCCAGGC-3’) and “LEAD REV” (5’-TGGCCACTAGTAGGTACCCCGGGCCATGGGGCCGCCTGGGCCGCAGCTCCGTCACCAGTGGAACCTGGAACCCAGAGCAGCAGTACCCATAGCAGGAGTGTGTCTGTCTCCATG-3’) was ligated into the cut and gel-purified vector to introduce the immunoglobulin kappa-chain leader sequence (underline) and 5’ Sfi I restriction site (bold). To clone phage display-derived scFv cDNA, the desired scFv construct was removed from the pComb3X phagemid (Scripps Research Institute, La Jolla, CA) in which it had been originally isolated by phage display44 by Sfi I digestion, gel purified, ligated into Sfi I-digested and gel-purified pLIVE vector, and amplified in the XL1-Blue strain of E. coli (Agilent Technologies, Santa Clara, CA). Plasmid DNA for injection was purified using an endotoxin-free plasmid purification kit (Qiagen Inc., Valencia, CA).

Hydrodynamic gene delivery of human anti-ADAMTS13 scFv cDNA

ScFv-containing pLIVE plasmids (30 µg) were injected into tail veins of 2–3 month-old mice (C57BL/6 or CAST/Ei) following pLIVE manufacturer’s instructions. Briefly, mice were warmed by a heat lamp for several minutes and 30 µg of pLIVE/scFv DNA diluted in 2 mL TransIT-QR hydrodynamic delivery solution were injected in the tail over 4–7 seconds by syringe with a 30-gauge needle. Prior to and after DNA delivery, blood samples (~100 µL) were collected from the retro-orbital sinus under isofluorane anesthesia into heparinized capillary tubes and transferred to 10 µL of 1.9% sodium citrate. In vivo-expressed scFv’s were detected using an immunoprecipitation protocol similar to that used for scFv ADAMTS13 epitope mapping44 except that scFv’s were captured with anti-V5 agarose beads from 100 µL of plasma and eluted into 40 µL of PAGE reducing sample buffer, and 20 µL of each sample were analyzed by SDS-PAGE (Novex NuPAGE, Life Technologies). Western blotting was performed with HRP-conjugated anti-V5 antibody (Invitrogen, Life Technologies, Grand Island, NY) and chemiluminescent images (ECL, GE Healthcare Life Sciences) exposed on X-ray film were quantified using Image J software (http://rsb.info.nih.gov/nih-image/) normalizing to mouse plasma spiked with 20 ng of S2 cell-produced scFv 1–420. Quantification of in vivo-produced scFv 1–420 was performed by immunoprecipitation and Western blotting rather than Western blotting of plasma alone because the extraordinary high concentrations of albumin in mouse plasma distorted the electrophoretic mobility of plasma proteins including the scFv.

Arteriole laser injury in human scFv-expressing mice

Platelet thrombus formation in C57BL/6 mice injected >7 days earlier with scFv plasmids was imaged using an Olympus BX61WI microscope (Olympus, Center Valley, PA) with a 60×/0.9 numeric aperture water immersion objective and captured with a Cooke SensiCam CCD camera (Cooke, Auburn Hills, MI) coupled to a Lambda DG4 widefield excitation system (Sutter, Novato, CA)32. The microscope, camera, and DG4 were all controlled using Slidebook 5.0 software (Intelligent Imaging Innovations). F(ab’)2 fragments of rat anti-mouse CD41 (BD Pharmingen, San Diego, CA) were conjugated to Alexa488 according to the manufacturer’s instructions (Life Technologies). Labelled F(ab’)2 fragments were infused via jugular vein (0.1 mg/kg) immediately prior to first injury. Vascular injury was induced with a pulsed nitrogen dye laser (SRS NL100, Photonic Instruments, St. Charles, IL) focused on the vessel wall of arterioles (20–40 µm diameter) through the microscope objective. Analysis of time-lapse videos (750 frames per injury) was performed using Slidebook 5.0 (Intelligent Imaging Innovations, Denver, CO). After background fluorescence was subtracted from all images in one injury video, the resulting thrombus fluorescence was analyzed in the software to calculate an X/Y aspect ratio. A median filter was applied to each injury before taking the average of all injuries. P value for differences between control and experimental injury X/Y aspect ratios was determined using the Mann Whitney test (GraphPad Prism software, La Jolla, CA).

Shigatoxin challenge in scFv-expressing mice

CAST/Ei mice were injected with scFv plasmids and challenged 10 days later with Shigatoxin-2 (50 pg/g weight, Toxin Technology, Sarasota, FL) via tail vein. CBCs, Wright-stained blood smears, and hematoxylin-eosin-stained tissues were prepared as described.33

ADAMTS13 activity and VWF multimer analyses

Human and murine ADAMTS13 activities were measured using FRETS-VWF73 peptide as described44. For measurement of murine ADAMTS13 activity, 8 µL mouse plasma was added to 42 µL of substrate buffer and 50 µL of diluted FRETS-VWF73 reagent. For measurement of murine ADAMTS13 activity in the presence of human scFv, 4 µL of scFv at twice final desired concentration were mixed with 4 µL mouse plasma, incubated at 37°C for 15 min and assayed for ADAMTS13 activity with FRETS-vWF73 reagent as above. For ADAMTS13 “inhibitor assay” with plasma from scFv-expressing mice, murine ADAMTS13 activity was measured by incubating 4 µL normal human plasma with 4 µL heat-inactivated mouse plasma drawn several days post-pLIVE injection, incubating at 37°C for 30 min, then adding to FRETS-vWF73 buffer and substrate. Murine VWF multimers were visualized by Western blot as described.34

Study approval

Animal studies were approved by the University of Pennsylvania’s Institutional Animal Care and Use Committee.

RESULTS

Human anti-ADAMTS13 monoclonal antibodies inhibit murine ADAMTS13

In the accompanying manuscript in this series44, we described a set of human monoclonal anti-ADAMTS13 single chain antibody fragments (scFv’s) cloned from four unrelated TTP patients that displayed characteristics in vitro one would expect from disease-related pathogenic antibodies, e.g., ability to inhibit ADAMTS13 enzymatic activity, epitope specificities shared with patient plasma IgG, etc. To test the clinical relevance of these recombinant antibodies and to provide an in vivo system for studying the pathophysiology of TTP, we extended these in vitro findings to the development of a murine model of acquired TTP.

We first screened for the ability of our human scFv antibody fragments to inhibit the activity of murine plasma ADAMTS13 in vitro and found that the majority of scFv’s that inhibited human ADAMTS13 activity also inhibited murine ADAMTS13 (data not shown). Of the human scFv’s that crossreacted with murine ADAMTS13, we chose antibody clones 1–416, 1–420, 1–428, and 1–431 to pursue because characterization of these antibodies in vitro showed potent inhibition of ADAMTS13 activity, binding to human ADAMTS13 epitopes most commonly targeted by patient plasma IgG, and idiotopes shared by patient plasma IgG44.

Dose response inhibition curves with mouse plasma revealed 1–420 to be most potent (Fig. 1A) so it was chosen for evaluation in vivo. Mice were given intraperitoneal injections of 30 µg 1–420 and mouse plasma showed rapid inhibition of ADAMTS13 resulting in <10% pre-injection activity within ~2 hours (Figure 1B) which persisted for ~24 hours (Figure 1B, inset).

Fig. 1.

Fig. 1

Open in a new tab

Inhibition of murine ADAMTS13 by human anti-ADAMTS13. (A) Dose response curve showing residual murine ADAMTS13 activity when normal mouse plasma was mixed in vitro with increasing amounts of human ADAMTS13 inhibitory scFv’s 1–416, 1–420, 1–428, 1–431 or irrelevant anti-Rh(D) scFv negative control E1M2.43 (B) Time course of murine ADAMTS13 inhibition in vivo following intraperitoneal injection of scFv 1–420 (inset: over 24 hour period).

Transfection of mice with scFv cDNA leads to prolonged ADAMTS13 deficiency

We next wanted to create a state of sustained antibody-mediated ADAMTS13 deficiency to simulate TTP disease and observe the effect of such deficiency on thrombus formation in the settings of focal and systemic vascular injury. To accomplish this, the cDNA for scFv 1–420 was cloned into the pLIVE plasmid vector, a vector designed for the hydrodynamic gene transfer of naked DNA.31 We modified the vector to facilitate the insertion of phage display-derived scFv antibody fragment cDNA’s upstream of a liver-specific promoter composed of the minimal mouse albumin promoter and the mouse α-fetoprotein enhancer (Fig. 2). Tail vein injection of a 2-mL solution of pLIVE plasmid over 4 – 7 seconds delivers the scFv cDNA to mouse liver by hydrostatic force. Both control scFv cDNA and 1–420-containing plasmids initially led to a drop in ADAMTS13 activity in vivo for several days that was then followed by recovery of ADAMTS13 in the control group after the expected physiological effects of rapid hydrodynamic injection of a one blood volume-equivalent through the portal circulation to the liver resolved.31 Inhibition of ADAMTS13 activity by in vivo-expressed 1–420 persisted for over 2 weeks (Fig. 3A) and for as long as 3 months (data not shown).

Fig. 2.

Fig. 2

Open in a new tab

Schematic diagram of pLIVE plasmid vector modified for in vivo scFv expression. Shown are positions of Ig-kappa leader sequence, Sfi I restriction sites for inserting pComb3X-derived scFv construct, and V5-tag sequence.

Fig. 3.

Fig. 3

Open in a new tab

Inhibition of murine ADAMTS13 by in vivo-expressed human anti-ADAMTS13 scFv. (A) Time course of murine ADAMTS13 inhibition in vivo following hydrodynamic tail vein delivery into 2 pairs of mice with pLIVE plasmid containing scFv 1–420 cDNA (triangles and circles) or negative control human platelet factor 4 scFv X24-3 cDNA (diamonds and squares). (B) Western blot of plasma immunoprecipitated in vivo-expressed scFv drawn 7 days post scFv cDNA injection. Lanes 1–3 show negative control scFv X24-3 for 3 mice; lanes 4–6 show scFv 1–420 for 3 mice; lane 7 represents the amount of scFv 1–420 immunoprecipitated from an equivalent volume of mouse plasma spiked with 20 ng purified scFv 1–420 protein. (C) ADAMTS13 “inhibitor assay” performed on a 1:1 mix of normal human plasma and heat-inactivated murine plasma (56°C for 30 min to destroy endogenous mouse ADAMTS13) derived from 2 untransfected mice (left-hand set of bars), 2 mice transfected with control scFv plasmid (middle set of bars), and 5 mice transfected with plasmid containing scFv 1–420 cDNA (right-hand set of bars).

That the recombinant human antibodies were expressed in mouse plasma was confirmed by immunoprecipitation of scFv 7 days after scFv DNA vector injection (Fig. 4B). To estimate plasma levels of scFv in vivo, an aliquot of normal mouse plasma was spiked with 20 ng of recombinant 1–420, and immunoprecipitation was performed in parallel. Quantification using the spiked sample as a reference led to estimates of 0.4 – 0.8 µg/ml mouse plasma for scFv’s from 3 control mice and 0.4 – 10 µg/ml mouse plasma for 1–420 from 3 experimental mice. If the concentration of mouse plasma ADAMTS13 is similar to that in humans (~1 µg/ml),35,36 the stoichiometric ratio of scFv to ADAMTS13 was ~3 to ~5 except for one of the 1–420 mice in which it was ~10-fold higher. Excess unbound plasma scFv was affirmed by mixing plasma derived from cDNA-transfected mice 1:1 with normal human plasma, analogous to the “inhibitor assay” used clinically to diagnose patients with antibody-mediated ADAMTS13 deficiency (Figure 4C).3

Fig. 4.

Fig. 4

Open in a new tab

Platelet thrombus formation after cremaster arteriole injury in mice transfected with human anti-ADAMTS13 cDNA. (A) Intravital microscopy and time-lapse video illustrating formation of platelet thrombus over a 180-second period post laser injury. Platelets were labeled with Alexa488-conjugated F(ab’)2 fragments of anti-mouse CD41 in control scFv-transfected animal (normal ADAMTS13 activity, left panel) and scFv 1–420-transfected animal (<10% normal ADAMTS13 activity, right panel). Blood flow in direction of arrows. Bar represents 30 µm in all video frames. (Original videos in Supplementary Data.) (B) Length/width aspect ratios for platelet thrombi were averaged for 28 injuries in 5 control mice and 33 injuries in 7 scFv 1–420-transfected mice and plotted ±SEM as a function of time. Arterioles of 20–40 µm diameter were selected. To the right of each tracing, VWF multimer analyses of plasma from representative pair of control and ADAMTS13-inhibited mice shows accumulation of UL-VWF in scFv 1–420-transfected mouse.

Laser-induced vascular injury in scFv-transfected mice leads to elongated thrombi

The above data show that DNA transfection of human anti-ADAMTS13 antibodies using hydrodynamic delivery leads to rapid and stable ADAMTS13 inhibition in vivo. We next examined the effects of ADAMTS13 inhibition on the temporal and spatial aspects of platelet thrombus formation in these mice using the cremaster arteriole laser injury model (Figure 4A, Supplementary Videos 1 and 2).32 Thrombi in control mice enlarged spherically around the ~1 µm injury site to a diameter of ~30 µm and then remained relatively constant in size during the 3-minute observation period due to frequent embolization. In clear contrast, thrombi in ADAMTS13-inhibited mice grew in an asymmetrically elongating fashion to a length >80 µm beyond the injury site (P < 0.0001) consistent with the presence of strings of unprocessed UL-VWF multimers, although a contribution from adhesion of plasma VWF multimers to the damaged vasculature cannot be excluded. Length/width aspect ratio measurements of thrombi quantified these differences (Figure 4B). Agarose gel electrophoresis of plasma confirmed the presence of UL-VWF multimers in mice expressing 1–420 (Figure 4B, inset) relating the findings to underlying mechanism.

Shigatoxin challenge induces TTP phenotype in scFv-transfected mice

Though pathogenesis of TTP is linked to ADAMTS13 deficiency, the natural history of the disease suggests that additional genetic or environmental factors are required for disease onset.10 In murine models of congenital TTP, the administration of the bacterial agent Shigatoxin-2 was found to precipitate disease phenotype.33,37 To further test the clinical relevance of our cloned human scFv’s, we challenged mice expressing human anti-ADAMTS13 inhibitory antibodies by intravenous infusion of Shigatoxin-2. CAST/Ei strain mice, which have 5 times more circulating VWF and are sensitive to the development of TTP in an ADAMTS13 knock-out background,10 were injected with 1–420 or control antibody plasmid, given a sublethal dose of Shigatoxin-2 10 days later, and followed for 10 days. As shown in Figure 5A, 6 of 10 control mice survived and had normal platelet counts throughout the post-Shigatoxin-2 period. However, all (10/10) mice rendered ADAMTS13 deficient by 1–420 died by day 4 post-Shigatoxin-2 (half within 24–48 hours of injection, Figure 5B) and each suffered a fall in platelet count to less than one-third its starting value. Schistocytes were seen on peripheral blood smear, and thrombi were readily detected in brain, heart, and kidney, but not in control animals that had died concurrently or were sacrificed after Shigatoxin-2 challenge (Figure 5C). These experiments demonstrate that the in vivo expression of just the variable region of a single human anti-ADAMTS13 antibody suffices to mediate the most salient features of TTP in an animal model.

Fig. 5.

Fig. 5

Open in a new tab

Thrombocytopenia, thrombus formation, and death after injection of Shigatoxin-2 in mice transfected with human anti-ADAMTS13 cDNA. (A) Platelet counts in mice expressing control scFv (upper panel) and 1–420 scFv (lower panel) antibodies following Shigatoxin-2 (Stx-2) injection on Day 0. ADAMTS13 activities prior to Stx-2 injections are listed on the right-hand side of each panel. (B) Kaplan-Meier survival curves for mice expressing control scFv and scFv 1–420. P value determined using GraphPad Prism software (La Jolla, CA) and the log-rank Mantel-Cox test. (C) Peripheral blood smears (panels 1, 2) and organ histology (panels 3 through 8) in representative control scFv (left-hand panel set) and scFv 1–420 (right-hand panel set) expressing mice. Arrows in panel 2 point to schistocytes. Original magnifications, ×100; insets, ×500.

DISCUSSION

The goals of this study were to test the clinical relevance of antibodies cloned and characterized in vitro in the accompanying manuscript in this series44 and to develop an animal model of acquired TTP that could be useful for exploring the pathophysiology of disease. To our knowledge, this report is the first to describe human anti-ADAMTS13 autoantibodies that function in an animal model. Whether by injection of scFv protein (Fig. 1) or by in vivo expression of antibody mediated by hydrodynamic gene transfer of scFv DNA-containing plasmids (Figs. 3 and 4), murine ADAMTS13 proteolytic activity was inhibited, resulting in the accumulation of UL-VWF multimers. After triggering endothelial injury with Shigatoxin-2, key pathologic features of TTP were observed including thrombocytopenia, microangiopathic hemolytic anemia, formation of platelet thrombi in vital organs, and death (Fig. 5). As in patients with antibody-mediated ADAMTS13 deficiency, these mice exhibited sustained inhibition of ADAMTS13 (<5%) and “positive inhibitor assays”, i.e. their plasmas inhibited ADAMTS13 activity when mixed with normal human plasma (Figure 4C). The altered clot morphology revealed by focal arteriole injury via laser and intravital video-microscopy26,38,39 in the setting of prolonged autoantibody-mediated ADAMTS13 inhibition (Fig. 4) may illustrate the process by which clots extend linearly and cause the blockage of microvessels in patients with acquired TTP. We recognize that the role of platelets and other aspects of the pathophysiology of thrombosis in the laser injury model may differ in important ways from the sequence of events that lead to disseminated microvascular thrombi in TTP, and additional studies will be needed to identify the differences should they exist. Our observation that inhibition of ADAMTS13 function and the subsequent pathology that develops can be mediated by a monomeric antibody fragment lacking a constant region domain suggests that antibody-mediated clearance of ADAMTS13 or other effector functions conferred by IgG Fc domains may not be necessary for the expression of disease in patients.

To date, animal models of acquired TTP have been limited to the use of rabbit or mouse antibodies to human ADAMTS13 that produce transient enzyme inhibition.26–28 Such xenoantibodies would not be expected to necessarily primarily target human autoepitopes and, if so, would therefore not be helpful for testing novel therapies such as altered forms of recombinant ADAMTS13 that are engineered to be unrecognizable by human pathogenic autoantibodies.29,30 In point of fact, we would not expect that antibodies to human ADAMTS13 generated by mice would bind to the same epitopes as our clones 1–416, 1–420, 1–428, and 1–431 because these four human antibodies also crossreact with murine ADAMTS13 (Fig. 1). Tolerance mechanisms in healthy murine immune systems would not permit such antibodies to be made because they would be autoreactive.

Of the 51 anti-ADAMTS13 scFv antibodies previously described44, 1–416, 1–420, 1–428, and 1–431 were initially selected for evaluation here not only because of their ability to inhibit ADAMTS13 in vitro but because rabbit anti-idiotypic antisera raised to each of these scFv demonstrated the presence of crossreactive idiotypes in a number of unrelated patient plasma samples. Of the four antibodies, scFv 1–420 was then chosen to pursue in our animal model because it appeared most potent (Fig. 1). However, a recent study from our laboratory suggests that scFv 1–420 may in fact be the ideal example of a prototypical human TTP pathogenic antibody for use in an animal model because of its ability to significantly reduce or even largely eliminate the binding of polyclonal patient IgG to ADAMTS13 from 20 of 23 unrelated patients with acquired TTP.40 In addition, in this study, we used hydrogen-deuterium exchange mass spectrometry, the epitope for 1–420 was determined to near single amino acid resolution, and it was found that 1–420 bound to the same ADAMTS13 spacer domain loop segments that are required for binding of ADAMTS13 to VWF. This suggests that inhibitory antibody 1–420 functions by blocking enzyme/substrate engagement thus supporting its use in an animal model for guiding the design of altered ADAMTS13 molecules that would resist antibody binding but still allow VWF engagement and proteolysis.

The use of rapid, large volume intravenous injection of plasmid DNA for transfer of exogenous genes into mice is a much simpler approach than those employing viral vectors for transfection and avoids the laborious steps necessary for virus preparation and purification as well as safety concerns associated with systemic administration of recombinant virus to animals. There are numerous examples in the literature of hydrodynamic-based transfections of plasmid DNA in animals used to study the effects of in vivo-expressed transgenes such as those encoding recombinant enzymes, hormones, cytokines and other proteins41,42 but, to our knowledge, never antibody fragments. The approach we describe here could prove useful for exploring the pathophysiological effects of autoantibodies in other disorders where the antibodies, as in acquired TTP, may not require the expression of full-length IgG for bivalency or Fc domains for effector function. In addition to its utility for the study of acquired TTP, we anticipate that the sustained inhibition of ADAMTS13 mediated by anti-ADAMTS13 DNA transfection may prove useful in murine models of other disease states such as ischemic stroke, myocardial infarction, atherosclerosis, malignant (cerebral) malaria, and pre-eclampsia where perturbations in ADAMTS13 is believed to play a role in disease pathogenesis.

Supplementary Material

Supp Data
Supp Video S1
Download video file (8.4MB, mov)
Supp Video S2
Download video file (8.5MB, mov)

Acknowledgments

The authors acknowledge the late Carlos F. Barbas, III (Scripps Research Institute) for his seminal contributions to the field of antibody phage display and his invaluable mentorship.

Sources of support: This work was supported in part by NIH grants P50-HL81012 (D.L.S., D.B.C.), T32-HL007775 (L.Y.), R01-HL115187 (X.L.Z.), and P01-HL110860 (D.B.C. and M.P.), and funding from the National Blood Foundation (E.M.O.), Answering TTP Foundation (X.L.Z.), and the University of Pennsylvania ITMAT UL1RR025134 (D.L.S. and K.B.)

Footnotes

Conflict-of-interest disclosure: The authors declare that they have no conflicts of interest relevant to the manuscript submitted to TRANSFUSION.

REFERENCES

  • 1.Tsai HM, Lian EC. Antibodies to von Willebrand factor-cleaving protease in acute thrombotic thrombocytopenic purpura. N Engl J Med. 1998;339:1585–1594. doi: 10.1056/NEJM199811263392203. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Peyvandi F, Ferrari S, Lavoretano S, et al. von Willebrand factor cleaving protease (ADAMTS-13) and ADAMTS-13 neutralizing autoantibodies in 100 patients with thrombotic thrombocytopenic purpura. Br J Haematol. 2004;127:433–439. doi: 10.1111/j.1365-2141.2004.05217.x. [DOI] [PubMed] [Google Scholar]
  • 3.Zheng XL, Kaufman RM, Goodnough LT, et al. Effect of plasma exchange on plasma ADAMTS13 metalloprotease activity, inhibitor level, and clinical outcome in patients with idiopathic and nonidiopathic thrombotic thrombocytopenic purpura. Blood. 2004;103:4043–4049. doi: 10.1182/blood-2003-11-4035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Shelat SG, Smith P, Ai J, et al. Inhibitory autoantibodies against ADAMTS-13 in patients with thrombotic thrombocytopenic purpura bind ADAMTS-13 protease and may accelerate its clearance in vivo. J Thromb Haemost. 2006;4:1707–1717. doi: 10.1111/j.1538-7836.2006.02025.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Ferrari S, Scheiflinger F, Rieger M, et al. Prognostic value of anti-ADAMTS 13 antibody features (Ig isotype, titer, and inhibitory effect) in a cohort of 35 adult French patients undergoing a first episode of thrombotic microangiopathy with undetectable ADAMTS 13 activity. Blood. 2007;109:2815–2822. doi: 10.1182/blood-2006-02-006064. [DOI] [PubMed] [Google Scholar]
  • 6.Peyvandi F, Lavoretano S, Palla R, et al. ADAMTS13 and anti-ADAMTS13 antibodies as markers for recurrence of acquired thrombotic thrombocytopenic purpura during remission. Haematologica. 2008;93:232–239. doi: 10.3324/haematol.11739. [DOI] [PubMed] [Google Scholar]
  • 7.Hovinga JA, Lammle B. Role of ADAMTS13 in the pathogenesis, diagnosis, and treatment of thrombotic thrombocytopenic purpura. ASH Educ Program Book. 2012;2012:610–616. doi: 10.1182/asheducation-2012.1.610. [DOI] [PubMed] [Google Scholar]
  • 8.Bell WR, Braine HG, Ness PM, et al. Improved survival in thrombotic thrombocytopenic purpura-hemolytic uremic syndrome. Clinical experience in 108 patients. N Engl J Med. 1991;325:398–403. doi: 10.1056/NEJM199108083250605. [DOI] [PubMed] [Google Scholar]
  • 9.Moake JL. Thrombotic thrombocytopenic purpura: the systemic clumping "plague". Ann Rev Med. 2002;53:75–88. doi: 10.1146/annurev.med.53.082901.103948. [DOI] [PubMed] [Google Scholar]
  • 10.Desch KC, Motto DG. Thrombotic thrombocytopenic purpura in humans and mice. Arterioscler Thromb Vasc Biol. 2007;27:1901–1908. doi: 10.1161/ATVBAHA.107.145797. [DOI] [PubMed] [Google Scholar]
  • 11.Cataland SR, Jin M, Ferketich AK, et al. An evaluation of cyclosporin and corticosteroids individually as adjuncts to plasma exchange in the treatment of thrombotic thrombocytopenic purpura. Br J Haematol. 2007;136:146–149. doi: 10.1111/j.1365-2141.2006.06384.x. [DOI] [PubMed] [Google Scholar]
  • 12.Westwood JP, Webster H, McGuckin S, et al. Rituximab for thrombotic thrombocytopenic purpura: benefit of early administration during acute episodes and use of prophylaxis to prevent relapse. J Thromb Haemost. 2013;11:481–490. doi: 10.1111/jth.12114. [DOI] [PubMed] [Google Scholar]
  • 13.Sayani FA, Abrams CS. How I treat refractory thrombotic thrombocytopenic purpura. Blood. 2015;125:3860–3867. doi: 10.1182/blood-2014-11-551580. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Hovinga JA, Vesely SK, Terrell DR, et al. Survival and relapse in patients with thrombotic thrombocytopenic purpura. Blood. 2010;115:1500–1511. doi: 10.1182/blood-2009-09-243790. [DOI] [PubMed] [Google Scholar]
  • 15.Plaimauer B, Kremer Hovinga JA, Juno C, et al. Recombinant ADAMTS13 normalizes von Willebrand factor-cleaving activity in plasma of acquired TTP patients by overriding inhibitory antibodies. J Thromb Haemost. 2011;9:936–944. doi: 10.1111/j.1538-7836.2011.04224.x. [DOI] [PubMed] [Google Scholar]
  • 16.Chen J, Reheman A, Gushiken FC, et al. N-acetylcysteine reduces the size and activity of von Willebrand factor in human plasma and mice. J Clin Invest. 2011;121:593–603. doi: 10.1172/JCI41062. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Firbas C, Siller-Matula JM, Jilma B. Targeting von Willebrand factor and platelet glycoprotein Ib receptor. Expert Rev Cardiovasc Ther. 2010;8:1689–1701. doi: 10.1586/erc.10.154. [DOI] [PubMed] [Google Scholar]
  • 18.Mayr FB, Knobl P, Jilma B, et al. The aptamer ARC1779 blocks von Willebrand factor-dependent platelet function in patients with thrombotic thrombocytopenic purpura ex vivo. Transfusion. 2010;50:1079–1087. doi: 10.1111/j.1537-2995.2009.02554.x. [DOI] [PubMed] [Google Scholar]
  • 19.Feys HB, Roodt J, Vandeputte N, et al. Inhibition of von Willebrand factor-platelet glycoprotein Ib interaction prevents and reverses symptoms of acute acquired thrombotic thrombocytopenic purpura in baboons. Blood. 2012;120:3611–3614. doi: 10.1182/blood-2012-04-421248. [DOI] [PubMed] [Google Scholar]
  • 20.Bartunek J, Barbato E, Heyndrickx G, et al. Novel antiplatelet agents: ALX-0081, a Nanobody directed towards von Willebrand factor. J Cardiovasc Transl Res. 2013;6:355–363. doi: 10.1007/s12265-012-9435-y. [DOI] [PubMed] [Google Scholar]
  • 21.Turner N, Nolasco L, Moake J. Generation and breakdown of soluble ultralarge von Willebrand factor multimers. Semin Thromb Hemost. 2012;38:38–46. doi: 10.1055/s-0031-1300950. [DOI] [PubMed] [Google Scholar]
  • 22.Chapman K, Yuen S. Therapy for thrombotic thrombocytopenia purpura: past, present, and future. Semin Thromb Hemost. 2014;40:34–40. doi: 10.1055/s-0033-1363165. [DOI] [PubMed] [Google Scholar]
  • 23.Vanhoorelbeke K, De Meyer SF. Animal models for thrombotic thrombocytopenic purpura. J Thromb Haemost. 2013;11(Suppl 1):2–10. doi: 10.1111/jth.12255. [DOI] [PubMed] [Google Scholar]
  • 24.Morioka Y, Casari C, Wohner N, et al. Expression of a structurally constrained von Willebrand factor variant triggers acute thrombotic thrombocytopenic purpura in mice. Blood. 2014;123:3344–3353. doi: 10.1182/blood-2013-10-531392. [DOI] [PubMed] [Google Scholar]
  • 25.Schiviz A, Wuersch K, Piskernik C, et al. A new mouse model mimicking thrombotic thrombocytopenic purpura: correction of symptoms by recombinant human ADAMTS13. Blood. 2012;119:6128–6135. doi: 10.1182/blood-2011-09-380535. [DOI] [PubMed] [Google Scholar]
  • 26.Chauhan AK, Motto DG, Lamb CB, et al. Systemic antithrombotic effects of ADAMTS13. J Exp Med. 2006;203:767–776. doi: 10.1084/jem.20051732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Chauhan AK, Goerge T, Schneider SW, et al. Formation of platelet strings and microthrombi in the presence of ADAMTS-13 inhibitor does not require P-selectin or beta3 integrin. J Thromb Haemost. 2007;5:583–589. doi: 10.1111/j.1538-7836.2007.02361.x. [DOI] [PubMed] [Google Scholar]
  • 28.Feys HB, Roodt J, Vandeputte N, et al. Thrombotic thrombocytopenic purpura directly linked with ADAMTS13 inhibition in the baboon (Papio ursinus) Blood. 2010;116:2005–2010. doi: 10.1182/blood-2010-04-280479. [DOI] [PubMed] [Google Scholar]
  • 29.Jian C, Xiao J, Gong L, et al. Gain-of-function ADAMTS13 variants that are resistant to autoantibodies against ADAMTS13 in patients with acquired thrombotic thrombocytopenic purpura. Blood. 2012;119:3836–3843. doi: 10.1182/blood-2011-12-399501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Zheng XL. ADAMTS13 and von Willebrand factor in thrombotic thrombocytopenic purpura. Annu Rev Med. 2015;66:211–225. doi: 10.1146/annurev-med-061813-013241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Liu F, Song Y, Liu D. Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA. Gene Ther. 1999;6:1258–1266. doi: 10.1038/sj.gt.3300947. [DOI] [PubMed] [Google Scholar]
  • 32.Neyman M, Gewirtz J, Poncz M. Analysis of the spatial and temporal characteristics of platelet-delivered factor VIII-based clots. Blood. 2008;112:1101–1108. doi: 10.1182/blood-2008-04-152959. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Jin SY, Xiao J, Bao J, et al. AAV-mediated expression of an ADAMTS13 variant prevents shigatoxin-induced thrombotic thrombocytopenic purpura. Blood. 2013;121:3825–3829. doi: 10.1182/blood-2013-02-486779. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Laje P, Shang D, Cao W, et al. Correction of murine ADAMTS13 deficiency by hematopoietic progenitor cell-mediated gene therapy. Blood. 2009;113:2172–2180. doi: 10.1182/blood-2008-08-173021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Soejima K, Nakamura H, Hirashima M, et al. Analysis on the molecular species and concentration of circulating ADAMTS13 in blood. J Biochem. 2006;139:147–154. doi: 10.1093/jb/mvj013. [DOI] [PubMed] [Google Scholar]
  • 36.Rieger M, Ferrari S, Kremer Hovinga JA, et al. Relation between ADAMTS13 activity and ADAMTS13 antigen levels in healthy donors and patients with thrombotic microangiopathies (TMA) Thromb Haemost. 2006;95:212–220. doi: 10.1160/TH05-08-0550. [DOI] [PubMed] [Google Scholar]
  • 37.Motto DG, Chauhan AK, Zhu G, et al. Shigatoxin triggers thrombotic thrombocytopenic purpura in genetically susceptible ADAMTS13-deficient mice. J Clin Invest. 2005;115:2752–2761. doi: 10.1172/JCI26007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Chauhan AK, Walsh MT, Zhu G, et al. The combined roles of ADAMTS13 and VWF in murine models of TTP, endotoxemia, and thrombosis. Blood. 2008;111:3452–3457. doi: 10.1182/blood-2007-08-108571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Chauhan AK, Kisucka J, Brill A, et al. ADAMTS13: a new link between thrombosis and inflammation. J Exp Med. 2008;205:2065–2074. doi: 10.1084/jem.20080130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Casina VC, Hu W, Mao JH, et al. High-resolution epitope mapping by HX MS reveals the pathogenic mechanism and a possible therapy for autoimmune TTP syndrome. Proc Natl Acad Sci U S A. 2015;112:9620–9625. doi: 10.1073/pnas.1512561112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Bonamassa B, Hai L, Liu D. Hydrodynamic gene delivery and its applications in pharmaceutical research. Pharm Res. 2011;28:694–701. doi: 10.1007/s11095-010-0338-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Suda T, Liu D. Hydrodynamic delivery. Adv Genet. 2015;89:89–111. doi: 10.1016/bs.adgen.2014.10.002. [DOI] [PubMed] [Google Scholar]
  • 43.Chang TY, Siegel DL. Genetic and immunological properties of phage-displayed human anti-Rh(D) antibodies: implications for Rh(D) epitope topology. Blood. 1998;91:3066–3078. [PubMed] [Google Scholar]
  • 44.Ostertag E, Kacir S, Thiboutot M, Gulendran G, Zheng XL, Cines DB, Siegel DL. ADAMTS13 autoantibodies cloned from patients with acquired thrombotic thrombocytopenic purpura: 1. Structural and functional characterization in vitro. Transfusion. doi: 10.1111/trf.13584. in press. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Data
NIHMS762011-supplement-Supp_Data.pdf (42.5KB, pdf)
Supp Video S1
Download video file (8.4MB, mov)
Supp Video S2
Download video file (8.5MB, mov)

RESOURCES