Skip to main content
Cell Cycle logoLink to Cell Cycle
. 2015 Dec 29;15(3):413–424. doi: 10.1080/15384101.2015.1127472

Aurora A phosphorylation of WD40-repeat protein 62 in mitotic spindle regulation

Nicholas R Lim a,b, Yvonne Y C Yeap a,d, Ching-Seng Ang b, Nicholas A Williamson b, Marie A Bogoyevitch a,b, Leonie M Quinn c, Dominic C H Ng a,d,✉
PMCID: PMC4943692  PMID: 26713495

ABSTRACT

Mitotic spindle organization is regulated by centrosomal kinases that potentiate recruitment of spindle-associated proteins required for normal mitotic progress including the microcephaly protein WD40-repeat protein 62 (WDR62). WDR62 functions underlie normal brain development as autosomal recessive mutations and wdr62 loss cause microcephaly. Here we investigate the signaling interactions between WDR62 and the mitotic kinase Aurora A (AURKA) that has been recently shown to cooperate to control brain size in mice. The spindle recruitment of WDR62 is closely correlated with increased levels of AURKA following mitotic entry. We showed that depletion of TPX2 attenuated WDR62 localization at spindle poles indicating that TPX2 co-activation of AURKA is required to recruit WDR62 to the spindle. We demonstrated that AURKA activity contributed to the mitotic phosphorylation of WDR62 residues Ser49 and Thr50 and phosphorylation of WDR62 N-terminal residues was required for spindle organization and metaphase chromosome alignment. Our analysis of several MCPH-associated WDR62 mutants (V65M, R438H and V1314RfsX18) that are mislocalized in mitosis revealed that their interactions and phosphorylation by AURKA was substantially reduced consistent with the notion that AURKA is a key determinant of WDR62 spindle recruitment. Thus, our study highlights the role of AURKA signaling in the spatiotemporal control of WDR62 at spindle poles where it maintains spindle organization.

KEYWORDS: aurora A, c-jun N-terminal kinase, mitosis, phosphorylation, primary microcephaly

Introduction

Mitosis involves the faithful segregation of replicated chromosomes into daughter cells.1,2 Central to this process is the formation and maintenance of a microtubule-based spindle apparatus.3,4 At the onset of mitosis, centrosomes separate and the pericentriolar matrix expands through the co-ordinated activation and recruitment of spindle pole proteins.5-7 This leads to the formation of a microtubule organizing center that catalyzes the generation of a bipolar spindle.7,8 Centrosomal/spindle pole proteins also regulate microtubule flux, organize signaling and are integrated with cortical apparatus involved in spindle orientation.9-13 Therefore, aberrant spindle regulation leads to defects in spindle integrity and positioning and contributes to developmental diseases such as autosomal recessive primary microcephaly (MCPH).14 MCPH genes overwhelmingly encode centrosome-associated or spindle pole proteins, highlighting the contribution of mitotic spindle regulation to MCPH etiology.14,15

WD40-repeat protein 62 (WDR62; also known as MCPH2) is the second most commonly mutated MCPH-associated gene, with over 30 identified mutations leading to reduced brain size and a spectrum of cortical abnormalities.16-18 In support of a requirement for WDR62 in mammalian brain development, the depletion of WDR62 decreased mouse brain volume, reduced the proliferation of neural progenitor cells (NPCs) and increased spindle instability.19,20 Similarly, in utero depletion of WDR62 in embryonic mouse brain also caused premature differentiation of NPCs into immature neurons.19,21 In characterizing the mitotic functions of WDR62, the ectopic expression of mutant proteins recapitulating MCPH-associated gene changes resulted in perturbed localization to the spindle pole which suggests that the localization of WDR62 and its interacting partners at spindle poles is important for normal mitosis.16,22 WDR62 was first characterized as an interacting partner of c-Jun N-terminal kinases (JNK) involved in regulating stress signaling.23,24 Indeed, WDR62 was found to recruit JNK1 to the spindle pole where JNK activity is required for spindle regulation and metaphase progression.22 The WDR62-JNK1 complex is also involved in regulating NPC spindles in the developing neocortex.19 Thus, the significant roles for WDR62 in neurodevelopment may involve the spatiotemporal organization of mitotic signaling events at the spindle.

The regulation and subcellular localization of WDR62 is cell cycle dependent. Predominantly cytoplasmic during interphase, WDR62 association with spindle microtubules coincides with its increased phosphorylation and the activity of centrosomal kinases upon mitotic entry.21 Our recent studies revealed that mitotic Aurora A Kinase (AURKA) activity maintains WDR62 localization at the spindle pole.22 Activated by TPX2 upon nuclear envelope breakdown at the onset of mitosis, AURKA is a centrosomal and spindle-associated protein that regulates spindle architecture and stability to ensure mitotic progression.25-29 AURKA additionally has been found to regulate spindle orientation in Drosophila neural stem cells and mouse mammary epithelium.30-32 In the developing neocortex, mice compound heterozygous for AURKA and WDR62 had decreased brain size accompanied by increased mitotic index when compared to single heterozygous animals.20 An analysis of mouse embryonic fibroblasts and neural progenitor cells from hypomorphic mutant mice with reduced WDR62 expression revealed decreased mitotic expression of AURKA and TPX2 suggesting a role for WDR62 in maintaining the mitotic activation of AURKA.20 In contrast, the transient depletion of WDR62 in Hela cells did not alter AURKA activity and expression.22 Moreover, small molecule inhibition of AURKA activity abrogated WDR62 spindle pole localization,22 which suggests that WDR62 is also a downstream target of AURKA signaling. Thus, the complex signaling relationship between mitotic AURKA and WDR62 requires further characterization.

In this study, we generated WDR62 knockout cells using a CRISPR/Cas9 approach to determine the effect of wdr62 deletion on AURKA signaling. We assessed the contribution of AURKA-WDR62 signaling to spindle regulation and determined the extent of AURKA signaling to MCPH-associated WDR62 mutants. Our findings reinforce the importance of AURKA localized WDR62 in spindle and mitotic regulation.

Results

AURKA activity and levels are maintained in CRISPR/Cas9-edited WDR62 knockout cells

In previous studies, we utilised siRNA-mediated depletion of WDR62 to uncover roles in metaphase spindle maintenance.21 In addition, through specific inhibition of AURKA, we demonstrated that WDR62 functions were downstream of AURKA activity.21 To determine unequivocally WDR62's involvement in mitotic AURKA activation, we employed a CRISPR/Cas9 genome editing approach 33 to delete wdr62 (WDR62 KO) in AD293 cells. Genomic DNA sequencing indicated a single base-pair insertion leading to a frame-shift truncation and the loss of WDR62 protein which was verified by immunoblot analysis (Figure 1A, B). In addition, we confirmed that WDR62 expression levels in unedited control cells transfected in absence of sgRNA were unchanged compared to the parental AD293 cell line (Figure 1B).

Figure 1.

Figure 1.

WDR62 deletion by CRISPR/Cas9-sgRNA does not alter mitotic AURKA expression or phosphorylation. (A) Genomic sequence verification of a single-base insertion leading to a frame-shift deletion of the wdr62 gene. (B) AD293 (5×106) cells deleted of WDR62 (WDR62 sgRNA), unedited controls (control) and parental cells (AD293) were immunoblotted to determine WDR62 expression levels. Mean values are of densitometric measurements of mitotic pAURKA, AURKA and TPX2 bands normalized against tubulin loading. (n=3, error bars indicate SEM, ‘ns’ – not significant, P > 0.05, students t-test) (C) WDR62-deleted AD293 cells (KO) or unedited controls (con) were immunostained to evaluate WDR62 expression and localization on the mitotic spindle. D) WDR62-deleted AD293 cells (KO) or unedited controls (con) synchronised in mitosis (Noc, 350 nM, 16 h) or asynchronous (Async) were immunoblotted to determine AURKA expression/phosphorylation, TPX2 levels and with mitotic markers (Cyclin B1, pHH3). Quantitations are from 3 independent repeated densitometric measure of AURKA phosphorylation and expression and normalized against αtubulin expression as a loading control. (E) WDR62-deleted AD293 cells (KO) or unedited controls (control) were immunostained to evaluate the localization of total and active AURKA on the mitotic spindle. All scale bars represent 10 µm.

Confocal microscopy analysis of WDR62 KO cells revealed multipolar spindles, abnormal spindle morphology and reduced γ−tubulin at spindle poles (Figure 1C). These spindle defects were accompanied by chromosome misalignment defects (Figure 1C) and were consistent with our previous findings with siRNA-mediated knockdown of WDR62.21 We next assessed AURKA expression and activity in AD293 cells lacking WDR62. Asynchronous or mitotically arrested cells (Noc, 350 nM, 16 h) were assessed for AURKA expression. Mitotically arrested cells, indicated by an increase in the levels phospho-Histone H3 and cyclin B1, had elevated AURKA expression and phosphorylation (Thr288). Importantly, the expression and phosphorylation of AURKA were unchanged in WDR62 KO cells when compared to unedited control cells (Figure 1D). In addition our analysis indicated that the expression of TPX2, an AURKA co-activator, was unaltered in WDR62 KO cells compared to controls (Figure 1D). The metaphase spindle pole localization of active and total AURKA were also maintained in WDR62 KO cells (Figure 1E). Taken together, our findings in cultured human cells indicate that WDR62 was not required for the mitotic upregulation, activation and spindle localization of AURKA.

TPX2 and AURKA regulates WDR62 localization

We have previously shown that WDR62 is a downstream target of AURKA signaling with WDR62 and AURKA co-localization at the metaphase mitotic spindle.22 To extend those observations by probing their mechanistic relationship in the context of mitotic spindle regulation, here we investigated the extent to which AURKA and WDR62 were co-localized as cells progressed through mitosis. Upon mitotic entry in prophase, the majority of the WDR62 population was cytoplasmic, with a small fraction of WDR62 accumulating around separating centrosomes with low but distinct levels of AURKA (Figure 2A). In prometaphase, AURKA was detected both at the centrosomes and spindle pole and this coincided with the increased targeting of WDR62 from the cytoplasm to the spindle pole. Consistent with the notion that WDR62 is predominantly a spindle pole protein, spindle-localized WDR62 surrounded but did not substantially overlap with centrosomal AURKA (Figure 2A). By metaphase, WDR62 and AURKA exhibited a high degree of co-localization due to increased AURKA at the spindle pole and adjacent spindle microtubules, which persisted until anaphase transition (Figure 2A). Thus, WDR62 and AURKA co-localization precedes the initial decrease in AURKA activity at the metaphase to anaphase transition due to its degradation by the APC/C complex,34-36 WDR62 begins to diffuse away from the spindle pole to become largely cytoplasmic by telophase. Taken together, these data reinforce a high correlation between the spindle pole localization of both WDR62 and AURKA.

Figure 2.

Figure 2.

WDR62 spindle pole localization in mitosis is dependent on TPX2 expression. (A) Hela cells were fixed and the localization of endogenous WDR62 and AURKA determined at different stages of mitosis by immunofluorescence. Scale bars represent 10 µm. (B) HeLa cells transfected with TPX2 siRNA (siTPX2) or non-targeting control siRNA (siCon) were synchronized in mitosis (Noc, 350 nM, 16 h) before immunoblot analysis to confirm depletion of TPX2 expression and reduction of phosphorylated AURKA. AURKA or WDR62 expression levels were also evaluated. (C) HeLa cells transfected with TPX2 siRNA or non-targeting control siRNA (siCon) and the localization and expression of TPX2, AURKA and WDR62 determined by co-immunofluorecence staining. Scale bars represent 10 µm.

Our results suggest that AURKA activity might promote the spindle pole localization of WDR62 during prometaphase. As TPX2 is required to sustain AURKA activation following mitotic entry,25 we examined the effect of TPX2 depletion on WDR62 spindle localization. Immunoblotting of cells transiently depleted for TPX2 revealed decreased pAURKA (Thr288), while total AURKA and WDR62 levels were unperturbed in these cells (Figure 2B). This is consistent with a role for TPX2 as an AURKA co-activator, sustaining the autophosphorylated state of AURKA during mitosis.25 As a consequence, TPX2 depletion led to an arrest of cells in prometaphase (Figure 2C). In these cells, AURKA recruitment to the spindle pole was defective, although a subset of centrosomal AURKA was still observed. Similarly, WDR62 was not detected at the mitotic spindle pole following TPX2 depletion (Figure 2C). These data suggest TPX2 activation of AURKA is required for subsequent WDR62 recruitment to the mitotic spindle following mitotic entry.

AURKA phosphorylation of WDR62 is required for metaphase spindle maintenance and chromosome segregation

We next investigated whether AURKA signaling to WDR62 was required for mitotic spindle regulation. Analysis of spindle morphology of WDR62 KO cells revealed abnormal spindles in 48.4 ± 2.9% of cells, characterized by defective centrosome-spindle pole coupling (Figure 3A). The frequency of multipolar and monopolar spindles also increased marginally in cells lacking WDR62. In addition to mitotic defects, the loss of WDR62 increased the percentage of cells exhibiting chromosome alignment defects in metaphase from 1.3 ± 0.6% in control cells to 54.9 ± 0.2% in WDR62 KO cells (Figure 3B). The expression of wild-type WDR62 fully rescued the spindle morphology and chromosomal alignment defects in WDR62 KO cells, confirming that these defects were due specifically to the deletion of WDR62, and highlighting the role of WDR62 in maintaining spindle integrity.

Figure 3.

Figure 3.

AURKA phosphorylation of WDR62 is required for metaphase spindle regulation and chromosomal alignment. (A) WDR62-deleted AD293 cells (KO) were transfected with wild-type WDR62 (WT), Ser32/Ser33A (32/33A), Ser49/Thr50/Ser52A (49/50/52A), or Ser32/Ser33/Ser49/Thr50/Ser52A (5A) mutant, fixed and stained with γ-tubulin for metaphase spindle phenotype analysis (graphed). Representative images of spindle defects (multipolar, abnormal and monopolar) are shown on the left panels. (B) WDR62-deleted cells (KO) were transfected with wild-type WDR62 (WT), Ser32/Ser33A (32/33A), Ser49/Thr50/Ser52A (49/50/52A), or 5A mutant, fixed and stained with DAPI to analyze for chromosomal alignment defects (graphed). Representative images of normal and misaligned chromosomes in metaphase are shown on the left panels. “n” indicates number of cells scored. Scale bars represent 10 µm.

We next evaluated the contribution of AURKA-directed phosphorylation on WDR62 toward spindle regulation. Previously we identified multiple S/T residues within the WDR62 N-terminal region (Ser32/Ser33/Ser49/Thr50/Ser52) directly phosphorylated by purified AURKA in an in vitro kinase assay, that contributed to the spindle localization of WDR62.22 In an extension of those studies, we sought to determine the contribution of these residues to WDR62 function in spindle regulation. Thus, we reconstituted WDR62 KO cells with phospho-deficient mutants (Ser/Thr → Ala) for the combinations Ser32/Ser33 (32/33A) or Ser49/Thr50/Ser52 (49/50/52A) as well as a WDR62 mutant deficient in phosphorylation for all 5 Ser/Thr residues (5A) and compared rescue of spindle and chromosomal defects with WT WDR62. The expression of 49/50/52A or 32/33A mutants partially reversed the frequency of abnormal spindle and misaligned chromosomes in WDR62 KO cells (Figure 3). Abnormal spindles were observed in 36.4% ± 1.1% of 32/33A transfected cells and in 34.1% ± 2.1% of 49/50/52A transfected cells, a significant decrease from defects observed in 48.4% ± 2.9% of WDR62 KO cells (Figure 3A). Similarly, the transfection of WDR62 KOs with 32/33A and 49/50/52A reduced the chromosomal misalignment defects from 54.9% ± 0.2% to 36.4% ± 1.1% and 31.1% ± 0.9% respectively (Figure 3B). In contrast, reconstitution with the 5A mutant did not significantly alter the extent of spindle and chromosomal defects in WDR62 deleted cells. Therefore, our data suggest phosphorylation of both Ser32/Ser33 and Ser49/Thr50/Ser52 clusters contribute to WDR62 regulation of the mitotic spindle.

AURKA phosphorylation of WDR62 in mitosis

Our findings support AURKA activity as necessary to localize and direct WDR62 function at the spindle pole. In the absence of site-specific phosphorylated WDR62 antibodies, we exploited mass spectrometry with targeted label-free quantitation to confirm phosphorylation of these residues in the cellular context of mitosis. Isotopically labeled synthetic peptides were incorporated in our analysis of cellular phosphopeptides to allow for sequence confirmation and phosphopeptide quantification in different cellular conditions (Figure 4). In AD293 cells exogenously expressing WDR62 and synchronised in S phase (hydroxyurea, 5 mM), we detected modest levels of Ser49/Thr50 phosphorylation. In mitotically synchronised cells (Noc, 350 nM, 16 h), phosphorylation of WDR62 Ser49 and Thr50 increased 11.5 ± 1.8 fold (Figure 4A top and middle panels, quantified in 4B). Furthermore, the mitotic phosphorylation of WDR62 Ser49/ThrT50 was reduced by 58.2 ± 0.1% upon AURKA inhibition (MLN8237, 0.5 µM), indicating that AURKA contributes to phosphorylation of these sites during mitosis (Figure 4A). In contrast, phosphorylation of WDR62 Ser52 in mitotic cell extracts was comparable to S phase synchronized cells (data not shown). Although we were unable to detect the Ser32/Ser33-containing peptides from cell lysates following phosphoenrichment, preventing an assessment of WDR62 phosphorylation of these sites, our study confirmed AURKA-dependent mitotic phosphorylation of WDR62 on Ser49/Thr50 in cells, which is critical for spindle alignment and mitotic integrity.

Figure 4.

Figure 4.

Mitotic phosphorylation of WDR62 on Ser49 and Thr50 is dependent on AURKA activity. (A) WDR62 knockout cells (1×108 cells) were transfected with wild-type WDR62 and synchronised with hydroxyurea (top panel), nocodazole (middle panel), or synchronised with nocodazole and treated with MLN8237 (bottom panel). Cells were then lysed, trypsin-digested, spiked with equal amounts of synthetic peptide standard 46TRL(p)s(p)tASEETVQNR(13C15N)58, phospho-enriched, before quantitation using LC-MS/MS (n=3). Representative spectra of the endogenous and spiked synthetic peptides were obtained from the chromatographic peak apex. (B) Quantification of relative abundance of wild-type 46TRL(p)s(p)tASEETVQN58 peptide in S phase, M phase, and M phase with MLN8237-treated AD293 cells from (A). (n=3, error bars indicate SEM *P < 0.05, students t-test).

Previously we demonstrated JNK-dependent phosphorylation of WDR62 on the T1053 residue was also increased in response to mitotic synchronization and this negatively impacted WDR62 association with microtubules.22 To determine if AURKA targeting of WDR62 contributed to JNK-dependent phosphorylation, we immunoblotted AD293 cells expressing AURKA-resistant WDR62 mutant (5A) with a site-specific antibody that detects phosphorylation of WDR62 at the T1053 residue (Figure 5A). The removal of AURKA phosphorylation sites on WDR62 did not alter increased WDR62 T1053 phosphorylation in response to mitotic arrest when compared to identically treated cells expressing wild-type WDR62 (Figure 5A, B). Thus, AURKA phosphorylation of WDR62 in mitosis was not required for JNK targeting of WDR62 on the T1053 site.

Figure 5.

Figure 5.

AURKA signaling is not required for WDR62 T1053 phosphorylation in mitosis. (A) AD293 (WDR62 KO) cells transiently expressing GFP-tagged wild-type WDR62, WDR62-5A, WDR62 T1053A mutants or a vector expressing GFP only, Mitotically synchronized (Noc, 350 nM, 16 h) or asynchronous (As) cells were lysed and immunoblotted with a site specific phospho-(T1053) WDR62 antibody. GFP-fusion protein expression, mitotic status (cdc25 phosphorylation-dependent band shift) and protein loading (GAPDH) was also determined by immunoblotting. (B) Densitometric measurements of phospho-(T1053) WDR62 bands from were normalized for GFP expression and expressed as fold increases over asynchronous cells (As). Values represent mean + SEM (n=3, ‘ns’ – not significant, p > 0.05, students t-test).

AURKA does not signal to WDR62 MCPH mutants

A common characteristic of WDR62 MCPH mutations is impaired spindle pole localization.16 Therefore, we sought to determine if the pathogenic mutants were defective in their interactions with AURKA (Figure 6A). We transfected either wild-type WDR62 or one of several MCPH-associated WDR62 mutants (V65M, R438H or V1314RfsX18) into WDR62 KO cells, and evaluated mutant WDR62 interactions with endogenous AURKA by co-immunoprecipitation analysis. AURKA co-precipitated with myc-tagged wild type WDR62 as previously reported.20 In contrast, despite equivalent expression levels, the extent of MCPH-associated WDR62 mutant interactions with AURKA was substantially reduced compared to wild-type WDR62 (Figure 6A). In particular, AURKA interaction was not detected in complex with the WDR62 R438H mutant, one of the most commonly reported wdr62 MCPH mutations.16,37 We extended our analysis to the AURKA-dependent Ser49/Thr50 phosphorylation of WDR62 with MCPH-linked mutations. Assessment of the phosphorylation status of WDR62 Ser49/Thr50 using quantitative mass spectrometry revealed a 10.5-fold increase in phosphorylation in M-phase synchronized cells compared to S phase (Figure 6B). In contrast, we did not detect an increase in mitotically-stimulated WDR62 Ser49/Thr50 phosphorylation for V65M, R438H and V1314RfsX18 mutants (Figure 6B). Thus, AURKA phosphorylation of WDR62 MCPH mutants was deficient in the context of mitosis. We next investigated WDR62 T1053 phosphorylation by immunoblot analysis and found increased T1053 phosphorylation of MCPH-associated WDR62 mutants in response to mitotic synchronization (Figure 6C). Taken together, we conclude that MCPH-associated mutations are associated with disrupted AURKA signaling to WDR62 and compromised spindle localization and regulation while JNK signaling to WDR62 was not altered.

Figure 6.

Figure 6.

AURKA signaling to WDR62 is disrupted by MCPH mutations. (A) WDR62 deleted AD293 (WDR62 KO) cells were transfected with empty myc vector, myc-tagged wild-type WDR62 (wt-WDR62) or myc-tagged MCPH-associated WDR62 mutants (V65M, R438H and V1314RfsX18). Mitotically synchronized (Noc, 350 nM, 16 h) cell lysates were then immunoprecipitated with anti-myc and blotted for AURKA. (B) AD293 cells were transfected with WDR62 V65M, R438H or V1314RfsX18 mutants or wild-type WDR62 (wt-WDR62) , synchronised in S (hydroxyurea, 5 mM, 16 h) or M phase (Noc, 350 nM, 16 h), followed by quantitative phosphopeptide analysis by LC-MS/MS in presence of the spiked synthetic peptides. Representative extracted ion chromatogram of the 46TRL(p)s(p)tASEETVQN58 peptide in these samples are shown. Peaks corresponding to the peptide is highlighted in blue (n=3). (C) Asynchronous (As) or mitotically synchronized (Noc) WDR62 KO cells transiently expressing GFP-tagged WDR62 (wt-WDR62) or MCPH-associated WDR62 mutants (V65M, R438H and V1314RfsX18) were immunoblotted to determine WDR62 T1053 phosphorylation or GFP-fusion protein expression.

Discussion

The spindle association of WDR62 increases after mitotic entry and coincides with its elevated phosphorylation status.21 In this study, we revealed that mitotically increased AURKA-dependent phosphorylation of WDR62 is required for spindle pole accumulation and spindle maintenance. In addition, our observations that MCPH-associated WDR62 mutants were refractory to AURKA signaling suggest that the symptoms of microcephaly in humans may arise from defective AURKA-WDR62 signaling.

WDR62 is required for spindle regulation in dividing NPCs because its depletion causes a loss of proliferative capacity in the developing neocortex and reduced overall brain growth.16,18,21 Although it was recently demonstrated that AURKA and WDR62 functions are integrated in determining murine brain growth through regulation of NPC mitotic progression and that WDR62 regulated AURKA signaling, the nature of this signaling interaction was not fully resolved.20 Studies of murine embryonic fibroblasts and neural progenitors isolated from mice with hypomorphic WDR62 alleles revealed reduced AURKA activity and expression in mitotic cells suggesting WDR62 might regulate mitotic AURKA signaling.20 However, AURKA and TPX2 levels were also decreased in S-phase fibroblasts,20 when WDR62 localization was predominantly cytoplasmic,16,21 suggesting that WDR62 regulation of AURKA may be independent of its microtubule-associated functions. In contrast, we have demonstrated that mitotic activation of AURKA, protein levels of AURKA and TPX2 were not altered following siRNA-mediated depletion and CrispR/Cas9 sgRNA-mediated deletion of WDR62 in cultured human cells. The differences in the model systems employed in these studies, particularly our use of cultured WDR62 KO cells versus cells isolated from WDR62 hypomorphic mice with residual WDR62 levels, may account for these discrepancies. However, further mechanistic studies are required to determine how WDR62 provides feedback to signaling by AURKA.

In this study, we further delineated how phosphorylation can regulate the spindle pole recruitment of WDR62 following mitotic entry. Previously, we found that phosphorylation of WDR62 on a JNK target site, T1053, negatively regulated microtubule association as a T1053A non-phosphorylatable mutant decorated microtubules constitutively.22 In contrast, the specific inhibition of AURKA led to the loss of WDR62 spindle pole localization which preceded mitotic spindle collapse.22 Alanine replacement of the AURKA phosphorylation sites on WDR62 also attenuated spindle localization, providing evidence for spindle-localized AURKA-mediated phospho-regulation of WDR62.22 In turn, the spindle pole recruitment of AURKA depends on TPX2 activation upon nuclear envelope breakdown and the establishment of the Ran-GTP gradient.25,29,38 Alanine replacement of AURKA sites did not alter WDR62 T1053 phosphorylation. In addition, MCPH-associated WDR62 mutants retained mitotic phosphorylation on T1053. Thus, although AURKA activity is required of mitotic localization of WDR62, it may not be required for WDR62 signaling interactions with JNK. An outstanding question remains the relative contribution of WDR62 T1053 phosphorylation, if any, in negatively regulating microtubule association of AURKA-resistant or MCPH-associated WDR62 mutants.

In characterizing the mitotic-stage specific localization of both proteins, we observed WDR62 at the poles of the nascent mitotic spindle during prometaphase, which coincided with increased levels of AURKA at the spindle poles. AURKA, TPX2 and WDR62 exhibit a high degree of overlap at the spindle pole and adjacent microtubules during metaphase, before the decrease in WDR62 levels at the spindle poles in anaphase. Consistent with previous studies,29,39,40 TPX2 depletion led to an enrichment of prometaphase cells due to impaired AURKA localization to the poles of the nascent spindle to drive microtubule nucleation and elongation (Figure 2). In these TPX2-depleted prometaphase cells, WDR62 remains in the cytoplasm and undetectable at the poles. Analysis of AURKA/WDR62 spatial temporal dynamics and the TPX2 depletion phenotype builds on our previous observation that alanine replacement of AURKA phosphorylation sites on WDR62 attenuates metaphase spindle localization.22 These data indicate that AURKA potentiates the recruitment of WDR62 to the spindle pole and maintains its spindle localization up to anaphase.

Furthermore, we demonstrated that AURKA phosphorylation of WDR62 was required for mitotic spindle regulation. Spindle defects arising from WDR62 depletion are most frequently observed subsequent to spindle assembly in metaphase.21 The spindle defects in CRISPR-edited WDR62 KO cells could be rescued by ectopic expression of wild-type WDR62 but not WDR62 mutants with non-phosphorylatable AURKA target sites, highlighting the specific contribution of AURKA-mediated WDR62 phosphorylation to spindle maintenance. We further showed that AURKA phosphorylation of WDR62 Ser49 and Thr50 increased in mitosis while S52 phosphorylation was not detected. Phosphorylation of WDR62 Ser32 and Ser33 was beyond the limit of detection, however, based on our findings from functional rescue of spindle defects, it is likely that phosphorylation on WDR62 Ser32 and/or Ser33 contributes to WDR62 function in mitotic cells. In particular, the phospho-deficient mutant containing alanine-substitutions on Ser32 and Ser33 (32/33A) in combination did not fully rescue spindle abnormalities associated with WDR62 knockout suggesting a contribution by these specific residues for WDR62 function. Our findings reinforce WDR62 as a phosphorylation target and substrate of AURKA required for metaphase spindle regulation.

In this study, we also investigated AURKA signaling to WDR62 proteins that recapitulate pathogenic mutations identified in MCPH individuals. MCPH-associated WDR62 mutant proteins failed to accumulate at spindle poles during mitosis and remained cytoplasmic.16,22,37 Analysis of patient-derived lymphocytes from an individual with compound heterozygous mutations that included the c.1313G>A (p.R438H) mutation revealed expression of missense mutant protein with defective mitotic localization.37 This was consistent with the notion that a spindle localization deficit contributes to WDR62 pathomechanism and highlights the importance of mitotic specific functions in neurodevelopment. In co-immunoprecipitation studies we showed that interactions between AURKA and several MCPH-associated WDR62 mutants were compromised. In addition, mitotic phosphorylation of the AURKA target sites on WDR62 (Ser49 and Thr50) was not detected in MCPH mutant proteins. Interestingly, our analysis of missense mutations (V65M or R438H) and a truncating frameshift mutation (V1314RfsX18) revealed each were similarly defective in AURKA signaling. These mutations impact distinct regions of WDR62 but do not alter the AURKA binding site previously mapped to a region encompassing amino acid residues 1027-1138 of WDR62.20 This suggests that complex mechanisms may underlie WDR62 interactions with mitotic AURKA. Our findings highlight defective AURKA signaling as a shared characteristic of distinct MCPH-associated WDR62 mutants while the mechanistic basis underlying loss of AURKA interaction will require further study.

AURKA is a key centrosome and spindle-associated mitotic kinase that potentiates the activities of substrates involved in centrosome separation and bipolar spindle assembly. To summarize our current study, we have characterized AURKA phosphorylation mechanisms required for WDR62 spindle pole localization and spindle regulation- mechanisms disrupted by MCPH-associated mutations. WDR62 at the spindle pole mediates localization of JNK1 to establish high JNK activity at the spindle pole in neural stem cells.19,22 Although the potential downstream targets of this signaling complex are unknown, spindle microtubule regulatory phosphoproteins such as stathmin, which is also a previously defined JNK substrate,41 may link AURKA-WDR62 directed signaling with spindle architecture. In recent years, the development of potent inhibitors has additionally revealed a role for AURKA in the maintenance of spindle integrity, highlighting the need to understand the full extent of AURKA signaling as AURKA inhibitors make their way to clinic.42

Materials and methods

Antibodies, enzymes, inhibitors and reagents

Anti-WDR62 was from Bethyl laboratories (A301-560A). Gamma-tubulin (clone GTU-88), α-tubulin (DM1a) and AURKA phospho-Thr288 (SAB4300270) antibodies were from Sigma-Aldrich. Histone H2B phosphor-Ser10 (06-570) antibody was from Merck Millipore. Cyclin B1 (H433), Myc tag (764), and α-tubulin (5286) antibodies were from Santa Cruz. Horseradish peroxidase (HRP)-conjugated secondary antibodies were from Merck Millipore. Alexa Fluor conjugated secondary antibodies were obtained from Life Technologies. AURKA inhibitor MLN8237 was from SelleckChem. Cell culture reagents including DMEM and fetal bovine serum were from Invitrogen-GibcoBrl. Standard laboratory reagents were from Sigma-Aldrich.

Plasmids

Alanine substitutions of AURKA-mediated WDR62 Ser/Thr phosphorylation sites were generated by site-directed mutagenesis and Dpn1 digestion (Strategene). MCPH-associated WDR62 mutants were generated previously and cloned into pXJ40-Myc vector for transient transfection studies.22 Constructs were validated by restriction digestion and full sequencing analysis.

Cell culture, synchronisation and transient transfections

Human HeLa and AD293 cells were cultured in DMEM supplemented with 10% fetal bovine serum and 100 U/ml penicillin-streptomycin, at 37°C in a humidified 5% CO2 incubator. Cells were synchronised in S phase by hydroxyurea (5 mM, 16h). Cells were mitotically synchronised with nocodazole (350 nM, 16 h), collected by shake-off and washed in PBS, before cell lysis. For the inhibition of AURKA, mitotically synchronised cells were treated with MLN8237 (0.5 µM), before shake-off and lysis. Transient transfections were performed with Lipofectamine™ 2000 and Opti-MEM medium according to manufacturer's instructions.

CRISPR/Cas9-mediated generation of WDR62 knockout AD293 cells

A 20-bp sgRNA sequence (5′- CTAACCTGTGACCCCGGCAC -3′) targeting the second exon of wdr62 within the Homo Sapiens MCPH2 (C19orf14) locus was phosphorylated, annealed and ligated into pSpCas9(BB)-2A-Puro (PX459) (Addgene Plasmid #48139) using the method described previously.33 Plasmid constructs containing WDR62 sgRNA were verified by sequencing. pSpCas9(BB)-2A-Puro-WDR62 sgRNA was transfected into AD293 cells using Lipofectamine 2000 according to manufacturer specifications. A PX459 vector without an sgRNA targeting sequence was similarly transfected as a negative control. 24 hours post- transfection, stable cells were selected in the presence of puromycin (2.5ug/ml) for 72 hours. Puromycin-resistant cells were then reseeded into 96-well plates to isolate stable single-cell derived colonies. Selection media containing puromycin was replaced every 3-5 days for approximately 4 weeks before stable clones were transferred to 12-well plates for expansion. The expression of WDR62 was assessed by immunoblot analysis and indel mutations evaluate by sequencing of genomic DNA. Briefly, exon 2 of wdr62 was PCR amplified using Fwd-5′- GAACAAGTGTTAGCTGCTGGTGGATGGCGT -3′) and Rev-5′- GCACTCACTACATGCCAGGAACTGTTCTAG -3′ and amplified products analyzed for indel mutations by Sanger Sequencing.

Cell lysates, immunoblots and immunoprecipitation

Cells were lysed in RIPA buffer [150 mM NaCl, 100 mM Na3VO4, 50 mM Tris-HCl pH 7.3, 0.1 mM EDTA, 1% v/v Triton X-100, 1% w/v sodium deoxycholate and 0.2% w/v NaF] supplemented with protease inhibitors. Cell lysates were cleared by centrifugation (16,000 g, 10 min). Protein concentrations were determined by BCA assay and Laemmeli buffer was added. Proteins were separated by SDS-PAGE, transferred onto a polyvinylidene fluoride (PVDF) membrane and analyzed by immunoblotting. For immunoprecipitation experiments, cleared cell lysates were incubated with Myc antibodies conjugated to Protein-A agarose beads for 3 h at 4°C on an end-to-end rotator. After washing with lysis buffer, bound proteins were eluted with Laemelli buffer and separated by SDS-PAGE before immunoblotting.

Immunofluorescence imaging

Cells were cultured on uncoated glass coverslips, washed in PBS before fixing with either 4% w/v paraformaldehyde (20 min, room temperature) or ice-cold methanol (3 min, -20°C) as appropriate. Cells were then permeabilised with 0.2% w/v Triton X-100 in PBS, blocked with 10% v/v fetal calf serum, before incubation with primary antibodies and Alexa Fluor conjugated secondary antibodies diluted in 1% w/v BSA in PBS for 1 h each. Coverslips were mounted with Vectashield reagent (Vector Laboratories) and images were acquired on a Leica Sp5 confocal microscope equipped with 100 x/1.35 NA objective.

Label free quantitation of identified phosphopeptides

Myc-wtWDR62 and Myc-WDR62 mutants were transiently expressed in WDR62 KO cells. These cells were then synchronised in mitosis or S phase as described above, and treated with MLN8237 as appropriate, prior to cell lysate preparation. Equal amounts of protein cell lysate were added to equal volumes of denaturation solution containing 8 M urea and 25 mM triethylammonium bicarbonate (TEAB), followed by reduction with 10 mM TCEP and alkylation with 55 mM iodoacetamide. Samples were diluted with 25 mM TEAB to a final 1 M urea, followed by in-solution digest overnight at 37°C with sequencing-grade modified trypsin solution (Thermo Pierce). The tryptic digest was then quenched by the addition of formic acid to 1% v/v. Following solid-phase extraction (Oasis HLB catridge, Waters), the following synthetic peptides containing heavy labeled arginine (Mimotopes) were spiked: RGQpSpSPPPAPPICL(13C15N)R, TRLpSpTApSEETVQN(13C15N)R, TRLpSp-TASEETVQN(13C15N)R and TRLSTApSEETVQN(13C15N)R. The volume was reduced in vacuo, freeze dried overnight. Samples were resuspended in 100 mM TEAB, and 2 µl of each sample was analyzed by LC-MS/MS. The remaining volumes were enriched for phosphopeptides using titanium dioxide, and analyzed on a LTQ Orbitrap Elite (Thermo Scientific) coupled to an Ultimate 3000 RSLC nanosytem (Dionex) as previously described.22,43 The nanoLC system was equipped with an Acclaim Pepmap nano-trap column (Dionex) and an Acclaim Pepmap analytical column (Dionex) running on a 3–80% CH3CN-containing 0.1% formic acid gradient over 25 min. The LTQ Orbitrap Elite mass spectrometer was operated in the data-dependent mode, whereby spectra were acquired first in positive mode followed by either collision-induced activation (CID) or high energy collisional dissociation (HCD) on a targeted mass list corresponding to the endogenous and heavy spiked peptide. Peptides were fragmented using normalized collision energy of 35 and activation Q of 0.25 (CID) or activation time of 0.1 ms (HCD). The Orbitrap MS data was analyzed using Proteome Discoverer (Thermo Scientific version 1.4) with the Mascot search engine against theUniprot database. Variable modifications were phospho STY (+79.966) and Heavy Arginine (+10.008). A false discovery rate threshold of 1% was applied, and phosphopeptide identification was validated with PhosphoRS, requiring at least 90% confidence.44 Quantitation was carried out using the Quantitation node from Proteome Discoverer followed by manual validation of the MS spectra.

Abbreviations

AURKA

aurora kinase A

CRISPR

clustered regularly interspaced short palindromic repeats

JNK

c-jun N-terminal kinase

KO

knockout

MCPH

primary microcephaly

TPX2

targeting protein for Xklp2

WDR62

wd40-repeat protein 62

Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.

Funding

DCHN is supported by an Australian Research Council Future Fellowship (FT120100193). This work was supported by a National Health and Medical Research Council Project Grant (APP1046032), the William Buckland Foundation and Arthur & Mary Osborn Charitable Trust (CT21897, 21898).

References

  • 1.Lampson MA, Renduchitala K, Khodjakov A, Kapoor TM. Correcting improper chromosome-spindle attachments during cell division. Nat Cell Biol 2004; 6:232-37; PMID:14767480; http://dx.doi.org/ 10.1038/ncb1102 [DOI] [PubMed] [Google Scholar]
  • 2.Compton DA. Spindle assembly in animal cells. Annu Rev Biochem 2000; 69:95-114; PMID:10966454; http://dx.doi.org/ 10.1146/annurev.biochem.69.1.95 [DOI] [PubMed] [Google Scholar]
  • 3.Zimmerman WC, Sillibourne J, Rosa J, Doxsey SJ. Mitosis-specific anchoring of gamma tubulin complexes by pericentrin controls spindle organization and mitotic entry. Mol Biol Cell 2004; 15:3642-57; PMID:15146056; http://dx.doi.org/ 10.1091/mbc.E03-11-0796 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Oshimori N, Li X, Ohsugi M, Yamamoto T. Cep72 regulates the localization of key centrosomal proteins and proper bipolar spindle formation. EMBO J 2009; 28:2066-76; PMID:19536135; http://dx.doi.org/ 10.1038/emboj.2009.161 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bornens M. The centrosome in cells and organisms. Science 2012; 335:422-6; PMID:22282802; http://dx.doi.org/ 10.1126/science.1209037 [DOI] [PubMed] [Google Scholar]
  • 6.Jakobsen L, Vanselow K, Skogs M, Toyoda Y, Lundberg E, Poser I, Falkenby LG, Bennetzen M, Westendorf J, Nigg EA, et al.. Novel asymmetrically localizing components of human centrosomes identified by complementary proteomics methods. EMBO J 2011; 30:1520-35; PMID:21399614; http://dx.doi.org/ 10.1038/emboj.2011.63 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Kollman JM, Merdes A, Mourey L, Agard DA. Microtubule nucleation by gamma-tubulin complexes. Nat Rev Mol Cell Biol 2011; 12:709-21; PMID:21993292; http://dx.doi.org/ 10.1038/nrm3209 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Tanenbaum ME, Medema RH. Mechanisms of centrosome separation and bipolar spindle assembly. Dev Cell 2010; 19:797-806; PMID:21145497; http://dx.doi.org/ 10.1016/j.devcel.2010.11.011 [DOI] [PubMed] [Google Scholar]
  • 9.Dumont S, Mitchison TJ. Compression regulates mitotic spindle length by a mechanochemical switch at the poles. Curr Biol 2009; 19:1086-95; PMID:19540117; http://dx.doi.org/ 10.1016/j.cub.2009.05.056 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Waterman-Storer CM, Desai A, Bulinski JC, Salmon ED. Fluorescent speckle microscopy, a method to visualize the dynamics of protein assemblies in living cells. Curr Biol 1998; 8:1227-30; PMID:9811609; http://dx.doi.org/ 10.1016/S0960-9822(07)00515-5 [DOI] [PubMed] [Google Scholar]
  • 11.Errico A, Claudiani P, D'Addio M, Rugarli EI. Spastin interacts with the centrosomal protein NA14, and is enriched in the spindle pole, the midbody and the distal axon. Hum Mol Genet 2004; 13:2121-32; PMID:15269182; http://dx.doi.org/ 10.1093/hmg/ddh223 [DOI] [PubMed] [Google Scholar]
  • 12.Gaetz J, Kapoor TM. Dynein/dynactin regulate metaphase spindle length by targeting depolymerizing activities to spindle poles. J Cell Biol 2004; 166:465-71; PMID:15314063; http://dx.doi.org/ 10.1083/jcb.200404015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.McNally FJ. Mechanisms of spindle positioning. J Cell Biol 2013; 200:131-40; PMID:23337115; http://dx.doi.org/ 10.1083/jcb.201210007 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Thornton GK, Woods CG. Primary microcephaly: do all roads lead to Rome? Trends Genet 2009; 25:501-10; PMID:19850369; http://dx.doi.org/ 10.1016/j.tig.2009.09.011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Manzini MC, Walsh CA. What disorders of cortical development tell us about the cortex: one plus one does not always make two. Curr Opin Genet Dev 2011; 21:333-39; PMID:21288712; http://dx.doi.org/ 10.1016/j.gde.2011.01.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Nicholas AK, Khurshid M, Desir J, Carvalho OP, Cox JJ, Thornton G, Kausar R, Ansar M, Ahmad W, Verloes A, et al.. WDR62 is associated with the spindle pole and is mutated in human microcephaly. Nat Genet 2010; 42:1010-14; PMID:20890279; http://dx.doi.org/ 10.1038/ng.682 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Bilguvar K, Ozturk AK, Louvi A, Kwan KY, Choi M, Tatli B, Yalnizoğlu D, Tüysüz B, Cağlayan AO, Gökben S, et al.. Whole-exome sequencing identifies recessive WDR62 mutations in severe brain malformations. Nature 2010; 467:207-10; PMID:20729831; http://dx.doi.org/ 10.1038/nature09327 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Yu TW, Mochida GH, Tischfield DJ, Sgaier SK, Flores-Sarnat L, Sergi CM, Topçu M, McDonald MT, Barry BJ, Felie JM, et al.. Mutations in WDR62, encoding a centrosome-associated protein, cause microcephaly with simplified gyri and abnormal cortical architecture. Nat Genet 2010; 42:1015-20; PMID:20890278; http://dx.doi.org/ 10.1038/ng.683 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Xu D, Zhang F, Wang Y, Sun Y, Xu Z. Microcephaly-associated protein WDR62 regulates neurogenesis through JNK1 in the developing neocortex. Cell Rep 2014; 6:104-16; PMID:24388750; http://dx.doi.org/ 10.1016/j.celrep.2013.12.016 [DOI] [PubMed] [Google Scholar]
  • 20.Chen JF, Zhang Y, Wilde J, Hansen KC, Lai F, Niswander L. Microcephaly disease gene Wdr62 regulates mitotic progression of embryonic neural stem cells and brain size. Nat Commun 2014; 5:3885; PMID:24875059 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bogoyevitch MA, Yeap YY, Qu Z, Ngoei KR, Yip YY, Zhao TT, Heng JI, Ng DC. WD40-repeat protein 62 is a JNK-phosphorylated spindle pole protein required for spindle maintenance and timely mitotic progression. J Cell Sci 2012; 125:5096-109; PMID:22899712; http://dx.doi.org/ 10.1242/jcs.107326 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Lim NR, Yeap YY, Zhao TT, Yip YY, Wong SC, Xu D, Ang CS, Williamson NA, Xu Z, Bogoyevitch MA, et al.. Opposing roles for JNK and Aurora A in regulating WD40-Repeat Protein 62 association with spindle microtubules. J Cell Sci 2015; 128:527-40; PMID:25501809; http://dx.doi.org/ 10.1242/jcs.157537 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Cohen-Katsenelson K, Wasserman T, Khateb S, Whitmarsh AJ, Aronheim A. Docking interactions of the JNK scaffold protein WDR62. Biochem J 2011; 439:381-90; PMID:21749326; http://dx.doi.org/ 10.1042/BJ20110284 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Wasserman T, Katsenelson K, Daniliuc S, Hasin T, Choder M, Aronheim A. A novel c-Jun N-terminal kinase (JNK)-binding protein WDR62 is recruited to stress granules and mediates a nonclassical JNK activation. Mol Biol Cell 2010; 21:117-30; PMID:19910486; http://dx.doi.org/ 10.1091/mbc.E09-06-0512 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kufer TA, Sillje HH, Korner R, Gruss OJ, Meraldi P, Nigg EA. Human TPX2 is required for targeting Aurora-A kinase to the spindle. J Cell Biol 2002; 158:617-23; PMID:12177045; http://dx.doi.org/ 10.1083/jcb.200204155 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Carmena M, Ruchaud S, Earnshaw WC. Making the Auroras glow: regulation of Aurora A and B kinase function by interacting proteins. Curr Opin Cell Biol 2009; 21:796-805; PMID:19836940; http://dx.doi.org/ 10.1016/j.ceb.2009.09.008 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Joukov V, Walter JC, Nicolo A. The Cep192-organized aurora A-Plk1 cascade is essential for centrosome cycle and bipolar spindle assembly. Mol Cell 2014; 55:578-91; PMID:25042804; http://dx.doi.org/ 10.1016/j.molcel.2014.06.016 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Nikonova AS, Astsaturov I, Serebriiskii IG, Dunbrack RL Jr, Golemis EA. Aurora A kinase (AURKA) in normal and pathological cell division. Cell Mol Life Sci 2013; 70:661-87; PMID:22864622; http://dx.doi.org/ 10.1007/s00018-012-1073-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bird AW, Hyman AA. Building a spindle of the correct length in human cells requires the interaction between TPX2 and Aurora A. J Cell Biol 2008; 182:289-300; PMID:18663142; http://dx.doi.org/ 10.1083/jcb.200802005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Carvalho CA, Moreira S, Ventura G, Sunkel CE, Morais-de-Sa E. Aurora A triggers Lgl cortical release during symmetric division to control planar spindle orientation. Curr Biol 2015; 25:53-60; PMID:25484294; http://dx.doi.org/ 10.1016/j.cub.2014.10.053 [DOI] [PubMed] [Google Scholar]
  • 31.Bell GP, Fletcher GC, Brain R, Thompson BJ. Aurora kinases phosphorylate Lgl to induce mitotic spindle orientation in Drosophila epithelia. Curr Biol 2015; 25:61-8; PMID:25484300; http://dx.doi.org/ 10.1016/j.cub.2014.10.052 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Regan JL, Sourisseau T, Soady K, Kendrick H, McCarthy A, Tang C, Brennan K, Linardopoulos S, White DE, Smalley MJ. Aurora A kinase regulates mammary epithelial cell fate by determining mitotic spindle orientation in a Notch-dependent manner. Cell Rep 2013; 4:110-23; PMID:23810554; http://dx.doi.org/; http://dx.doi.org/ 10.1016/j.celrep.2013.05.044 [DOI] [PubMed] [Google Scholar]
  • 33.Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, et al.. Multiplex genome engineering using CRISPR/Cas systems. Science 2013; 339:819-23; PMID:23287718; http://dx.doi.org/ 10.1126/science.1231143 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Littlepage LE, Ruderman JV. Identification of a new APC/C recognition domain, the A box, which is required for the Cdh1-dependent destruction of the kinase Aurora-A during mitotic exit. Genes Dev 2002; 16:2274-85; PMID:12208850; http://dx.doi.org/ 10.1101/gad.1007302 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Crane R, Kloepfer A, Ruderman JV. Requirements for the destruction of human Aurora-A. J Cell Sci 2004; 117:5975-83; PMID:15536123; http://dx.doi.org/ 10.1242/jcs.01418 [DOI] [PubMed] [Google Scholar]
  • 36.Floyd S, Pines J, Lindon C. APC/C Cdh1 targets aurora kinase to control reorganization of the mitotic spindle at anaphase. Curr Biol 2008; 18:1649-58; PMID:18976910; http://dx.doi.org/ 10.1016/j.cub.2008.09.058 [DOI] [PubMed] [Google Scholar]
  • 37.Farag HG, Froehler S, Oexle K, Ravindran E, Schindler D, Staab T, Huebner A, Kraemer N, Chen W, Kaindl AM. Abnormal centrosome and spindle morphology in a patient with autosomal recessive primary microcephaly type 2 due to compound heterozygous WDR62 gene mutation. Orphanet J Rare Dis 2013; 8:178; PMID:24228726; http://dx.doi.org/ 10.1186/1750-1172-8-178 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Ozlu N, Srayko M, Kinoshita K, Habermann B, O'Toole ET, Muller-Reichert T, Schmalz N, Desai A, Hyman AA. An essential function of the C. elegans ortholog of TPX2 is to localize activated aurora A kinase to mitotic spindles. Dev Cell 2005; 9:237-48; PMID:16054030; http://dx.doi.org/ 10.1016/j.devcel.2005.07.002 [DOI] [PubMed] [Google Scholar]
  • 39.Tulu US, Fagerstrom C, Ferenz NP, Wadsworth P. Molecular requirements for kinetochore-associated microtubule formation in mammalian cells. Curr Biol 2006; 16:536-41; PMID:16527751; http://dx.doi.org/ 10.1016/j.cub.2006.01.060 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Barr AR, Gergely F. Aurora-A: the maker and breaker of spindle poles. J Cell Sci 2007; 120:2987-96; PMID:17715155; http://dx.doi.org/ 10.1242/jcs.013136 [DOI] [PubMed] [Google Scholar]
  • 41.Yip YY, Yeap YY, Bogoyevitch MA, Ng DC. cAMP-dependent protein kinase and c-Jun N-terminal kinase mediate stathmin phosphorylation for the maintenance of interphase microtubules during osmotic stress. J Biol Chem 2014; 289:2157-69; PMID:24302736; http://dx.doi.org/ 10.1074/jbc.M113.470682 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Katsha A, Belkhiri A, Goff L, El-Rifai W. Aurora kinase A in gastrointestinal cancers: time to target. Mol Cancer 2015; 14:106; PMID:25987188; http://dx.doi.org/ 10.1186/s12943-015-0375-4 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Thingholm TE, Jorgensen TJ, Jensen ON, Larsen MR. Highly selective enrichment of phosphorylated peptides using titanium dioxide. Nat Protoc 2006; 1:1929-35; PMID:17487178; http://dx.doi.org/ 10.1038/nprot.2006.185 [DOI] [PubMed] [Google Scholar]
  • 44.Taus T, Kocher T, Pichler P, Paschke C, Schmidt A, Henrich C, Mechtler K. Universal and confident phosphorylation site localization using phosphoRS. J Proteome Res 2011; 10:5354-62; PMID:22073976; http://dx.doi.org/ 10.1021/pr200611n [DOI] [PubMed] [Google Scholar]

Articles from Cell Cycle are provided here courtesy of Taylor & Francis

RESOURCES