Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Jul 15.
Published in final edited form as: Cell Rep. 2016 Jun 23;16(2):432–443. doi: 10.1016/j.celrep.2016.06.007

Microbiota-regulated IL-25 increases eosinophil number to provide 1 protection during Clostridium difficile infection

Erica L Buonomo 1, Carrie A Cowardin 1, Madeline G Wilson 1, Mahmoud M Saleh 1, Patcharin Pramoonjago 3, William A Petri Jr 1,2,3,4
PMCID: PMC4945404  NIHMSID: NIHMS793474  PMID: 27346351

Summary

Clostridium difficile infection (CDI) is the most common cause of hospital-acquired infection in the United States. Host susceptibility and the severity of infection are influenced by disruption of the microbiota and the immune response. However, how the microbiota regulates immune responses to mediate CDI outcome remains unclear. Here, we investigated the role of the microbiota-linked cytokine IL-25 during infection. Intestinal IL-25 was suppressed during CDI in humans and mice. Restoration of IL-25 reduced CDI-associated mortality and tissue pathology even though equivalent levels of C. difficile bacteria and toxin remained in the gut. IL-25 protection was mediated by gut eosinophils, as demonstrated by an increase in intestinal eosinophils and a loss of IL-25 protection upon eosinophil depletion. These findings support a mechanism whereby the induction of IL-25-mediated eosinophilia can reduce host mortality during active CDI. This work may provide targets for future development of microbial or immune-based therapies.

Graphical abstract

graphic file with name nihms793474u1.jpg

Buonomo et. al find that IL-25, a microbiota-regulated cytokine, reduces mortality during C. difficile infection. IL-25 expression is reduced during human and mouse infection, but repletion of its signal leads to an eosinophil-dependent reduction in intestinal tissue damage. This work may provide targets for future microbial or immune-based therapies.

Introduction

Clostridium difficile infection (CDI) is currently the leading cause of hospital-acquired infection and gastroenteritis-associated deaths in the United States (Lessa et al., 2015). As a result, it has been listed as one of three ‘Urgent Threats’ by the Center for Disease Control and Prevention (CDC). Despite therapy, C. difficile causes an estimated 453,000 infections, 83,000 relapses, and 29,300 deaths annually, stressing the need for better treatment and management options (Lessa et al., 2015). This Gram-positive, spore forming anaerobic bacterium infects the colon when the normal microbiota has been disrupted, primarily through antibiotic use. Following colonization, the release of chief virulence factors, toxins A and B, causes epithelial cell rounding and death compromising the integrity of the intestinal barrier. Therapy involves treatment with antibiotics such as vancomycin, fidaxomicin, or metronidazole (Cowardin and Petri Jr., 2014). In addition to effectively targeting C. difficile, these antibiotics can inhibit the reestablishment of beneficial endogenous flora, which may in part explain the high numbers of relapses and deaths associated with this disease.

CDI symptoms range from mild diarrhea to life threatening pseudomembranous colitis and toxic megacolon. Recent studies indicate that increased inflammatory markers, such as IL-8, are more accurate at predicting poor patient outcome than increased bacterial burden, suggesting that the type and/or intensity of the immune response may control the severity of the disease.(El Feghaly et al., 2013a and El Feghaly et al., 2013b). In fact, numerous studies support a dual role for the immune response to CDI. For instance, innate mediators such as MyD88 signaling, innate lymphoid cells (ILCs), leptin, and IL-22 have each been observed to play a protective role during CDI in mice, yet inflammasome-driven IL-23 signaling is deleterious during CDI in mice (Abt et al., 2015; Buonomo et al., 2013; Cowardin et al., 2015; Geiger et al., 2014; Hasegawa et al., 2014; Jarchum et al., 2012; Madan et al., 2014; Ryan et al., 2011). Together, these studies support a multifaceted role for the immune response during CDI.

In addition to the immune response, the status of the microbiota plays a fundamental role during CDI. The protective capabilities of a healthy microbiota to both inhibit and resolve disease is emphasized by the lack of host susceptibility to C. difficile in the presence of an intact microbiota, and the recently demonstrated efficacy of fecal transplants in preventing relapses(Britton and Young, 2014). Despite the central role of both the microbiota and the immune response to regulate disease pathogenesis, the role of the microbiota in influencing the host immune response during CDI is unclear. Crosstalk between the microbiota and the immune system is critical for shaping both the immune response and the microbial composition of the gut.

One example of this relationship is the cytokine IL-25, which is dependent on the microbiota, as germ free and antibiotic treated mice show decreased IL-25 production (Zaph et al., 2008). IL-25 is an inducer of type 2 immune responses and increased levels correlate with decreased IL-23 expression (Kleinschek et al., 2007; Zaph et al., 2008). IL-25 is capable of inducing type 2 responses characterized by eosinophil, basophil, and mast cell accumulation systemically and at local sites of inflammation (Fallon et al., 2006; Fort et al., 2001; Franzè et al., 2011). Although type 2 immunity is typically examined in the context of asthma, allergy, and helminth infection, the consequences of type 2 effector functions are versatile and can mediate pathogenic, protective, or regulatory responses given the environmental contexts (Saenz et al., 2008). In human CDI, low eosinophil numbers are a risk factor for persistent diarrhea or death and recurrent disease (Crook et al., 2012). These observations prompt the possibility that microbiota regulation of IL-25 and type 2 immune responses may influence disease severity during CDI. Furthermore, it uncovers a potential therapeutic target, which may help to guide future prebiotic and fecal transplant cocktail development to enhance IL-25 and type 2 responses. Since IL-25 is regulated by the microbiota and is expressed inversely to the cytokine IL-23, which is deleterious during CDI, we hypothesize that IL-25 is down-regulated during CDI. Increasing its levels might thus reduce disease severity through influencing the immune response.

Results

IL-25 is regulated by the microbiota and suppressed during human and murine Clostridium difficile infection (CDI)

The presence of a healthy microbiota has been shown to both prevent susceptibility to and resolve active Clostridium difficile infection (CDI). The expression of the type 2 cytokine IL-25 is dependent on the microbiota as demonstrated by its diminished expression in antibiotic treated and germ free mice (Zaph et al., 2008). Therefore, we hypothesized that IL-25 protein expression is decreased during CDI. To evaluate IL-25 protein regulation during human CDI, we stained colon biopsies of CDI negative (−) and CDI positive (+) patients (Figure 1A, Table S1) and scored for IL-25 staining (Figure 1B). Significant reductions in IL-25 expression were observed in CDI patients when compared to controls.

Figure 1. IL-25 was suppressed during human and murine Clostridium difficile infection (CDI). Related to Table 1.

Figure 1

(A) Representative histology of human colonic biopsies from CDI negative (−) (n=9) and CDI positive (+) (n=5) patients stained for IL-25 protein expression (Scale = 50 μM). (B) Histology was scored for IL-25 expression; four independent blinded scorers; *p value<0.05

(C) Representative immunohistochemical staining for IL-25 in ceca of C57BL/6J mice that were untreated (UT), antibiotic treated (ABX), or infected with C. difficile (Scale = 100 μM).

(D) IL-25 protein in mouse cecal tissue measured by ELISA. Data represents two combined experiments; n= 5–8 mice per group per experiment; mean +/− SEM; p value from antibiotic treated *< 0.05, p value from untreated #<0.05, ##<0.005, ###<0.0005.

(E–F) Lamina propria (LP) and epithelial cells (EC) in the colon were separated and analyzed for IL-25 protein from untreated, antibiotic only, and day 3 post C. difficile infected mice. (E) Data represents IL-25 protein from combined time points (F) Data represents IL-25 protein in the epithelium alone on each time point. n=4–10 per group; mean +/− SEM; *p value < 0.05.

We wished to understand if the reduction in IL-25 expression during human CDI was due to antibiotic treatments that CDI patients were likely receiving, or as a result of the infection itself. IL-25 protein was measured in the cecum of C57BL/6J mice that were untreated, only given only antibiotics, or on day 1, 2, and 3 post-C. difficile infection. Our infection model consists of antibiotic treatment in order to render mice susceptible to infection, followed by gavage with approximately 10^4–10^5 CFU of vegetative C. difficile (strain VPI10643) (Chen et al., 2008).

IL-25 expression was evaluated by both immunohistochemical staining of the cecum and total protein in cecal lysates. IL-25 expression by both analyses was suppressed by antibiotics, but further diminished on day 3 of CDI (Figure 1C, 1D). This data suggests that the environment created by CDI not only sustains, but also further decreases IL-25 protein levels compared to antibiotic treatment alone. Separation of the colonic epithelial from the lamina propria indicated that IL-25 protein was primarily found in epithelial cells (Figure 1E). Additionally, epithelial cell-specific IL-25 was similarly reduced from antibiotic treated levels on day 3 of CDI (Figure 1F). In contrast, IL-25 protein was observed in both epithelial cell and cells infiltrating the lamina propria in human biopsies, suggesting IL-25 expression might differ between humans and mice. This observation requires further investigation, but regardless of human and mouse cell differences in IL-25 expression, IL-25 protein expression was decreased during CDI in both human and mice. Overall, these data indicate that epithelial cells in mice are the primary source of IL-25 protein, and that CDI significantly decreases IL-25 levels from antibiotic treatment alone.

Restoration of IL-25 provided protection to mice against CDI-associated mortality and morbidity

The microbiota can prevent susceptibility to CDI by outcompeting the pathogen and inducing host factors, yet potentially beneficial influences of the microbiota to modulate the immune response and regulate CDI severity remain unknown (Britton and Young, 2014). Our observation of decreased IL-25 protein during CDI suggested that IL-25 regulation of type 2 immunity could be a downstream mechanism of microbiota-mediated protection. To address this question, we tested if repletion of IL-25 could reduce disease severity in the setting of antibiotics and active CDI. Mice were treated with a daily dose of 0.5 μg of recombinant IL-25 or PBS daily for five days prior to infection (Figure S1). Protection was assessed by mortality and a clinical scoring system of morbidity (Warren et al., 2012).

Restoration of IL-25 led to significant decreases in mortality (Figure 2A) and morbidity (Figure 2B) indicating that IL-25 repletion leads to host protection. IL-25 pretreatment was also capable of reducing CDI-associated morbidity in two additional models of CDI including a spore challenge (strain VPI10643) (Figure S2A and S2B) and challenge with a second toxin A and B producing C. difficile strain (strain 630) (Figure S2C and S2D). IL-25 and PBS treated mice surprisingly had similar levels of C. difficile colony forming units (CFU) (Figure 2F) and virulence factors, toxins A and B, (Figure 2E) in the cecal contents, indicating that IL-25 does not protect by influencing the ability of the pathogen to expand or produce toxins in the gut. Immunohistological evaluation of the cecum at day 3 post infection showed that IL-25 significantly decreased CDI-associated tissue pathology (Figure 2C and 2D). IL-25 treatment decreased cellular exudate and inflammatory cell numbers in the lamina propria, but the most profound impact was the prevention of epithelial cell disruption at the intestinal barrier. We concluded that IL-25 reduced disease severity by protecting host tissue and maintaining the integrity of the epithelium, rather than by dampening C. difficile growth or toxin production.

Figure 2. Recombinant IL-25 pretreatment protected against CDI-associated mortality and morbidity without changing C. difficile CFU or toxin. Related to Figure S1 and S2.

Figure 2

C57BL/6J mice were treated with a daily dose of either 0.5 μg of recombinant IL-25 protein or PBS daily for five days prior to infection with C. difficile.

(A) Survival and (B) clinical scores over the initial 6 days of infection. Data represents four combined experiments; n=6–10 mice per group per experiment; mean +/− SEM; * <0.05, ***<0.0005.

(C) Representative H&E stained cecal sections of mice on day 3 after infection with C. difficile (Scale = 100 μM) and (D) pathology scores. (E) Toxin A/B levels and (F) C. difficile bacterial burden in cecal contents on day 3 post C. difficile. Data represents two combined experiments; n= 4–7 mice per group per experiment; mean +/− SEM; *<0.05, **<0.005.

IL-25 resulted in increased IL-4 and mucin production during CDI

The crosstalk between immune responses and the intestinal epithelial is critical to maintain homeostasis in the gut (Peterson and Artis, 2014). Therefore, we hypothesized that IL-25-mediated epithelial tissue protection during CDI occurred through influences on the immune response. To understand how IL-25 shaped immunity during infection, we evaluated protein levels of inflammatory cytokines in cecal tissue on day 3 of infection (Figure 3A). IL-23 is known to have a deleterious role during CDI and has also been indicated to signal inversely of IL-25, thus we examined whether IL-25 dampened IL-23 levels in the gut (Buonomo et al., 2013; Kleinschek et al., 2007; Zaph et al., 2008). IL-25 treatment reduced IL-23 protein production in cecal lysates, but had no effect on downstream Th17-like cytokines IL-17 or IL-22 (Figure 3A). Therefore, we concluded that the reduction in IL-23 may partly contribute to IL-25-mediated protection, but there are likely additional immune mediators playing a role. Next, we evaluated how IL-25 treatment manipulated two canonical type 2 cytokines, IL-4 and IL-13. IL-25 has historically enhanced both cytokines, yet we only observed increased production of IL-4 during CDI (Figure 3A). Conversely, we detected decreased IL-13 protein levels in the cecal tissue on day 3. To test if induction of IL-13 by IL-25 occurs earlier than day 3, cecal protein levels were also measured on days 0 and 2 without evidence of increased IL-13 protein with IL-25 treatment (Figure S3). Our studies were done in antibiotic treated and infected mice, which may explain the lack of IL-25 induction of IL-13 protein. Further investigation into the role of IL-13 and its protein levels in cecal contents and systemically during CDI is needed to establish the relevance of this observation.

Figure 3. IL-25 pretreatment increased IL-4 and mucin expression during CDI. Related to Figure S3 and S4.

Figure 3

(A) ELISA analysis of protein expression of type 17 and type 2 cytokines cecal tissue of C57BL/6J mice on day 3 of C. difficile infection. Data represents two combined experiments; n=6–8 mice per group per experiment; mean +/− SEM; *<0.05, **<0.005.

(B) Periodic acid-Schiff (PAS) staining of mucins in control and IL-25 treated cecal sections (Scale= 50 μM) and (C) scoring on day 3 of C. difficile infection. Data represents two combined experiments; n=4–6 mice per group per experiment; mean +/− SEM; **p<0.005.

(D) Fold change of muc2 RNA in cecal tissue by qPCR relative to gapdh and actin. Data represents three combined experiments; n=4–6 mice per group per experiment; mean +/− SEM; *<0.05.

In order to evaluate the cellular source of IL-4, we utilized flow cytometry to intracellularly stain and measure IL-4 producing cell populations in the colonic lamina propria on day 3 of infection (Figure S4). In agreement with protein levels, the absolute number of IL-4 producing cells was increased with IL-25 treatment (Figure S4A). The majority of IL-4 producing cells were CD11b+ (Figure S4B). Further examination revealed that IL-4+ cells were mainly CD11b+ SiglecF+, identifying eosinophils as the primary source of this cytokine during CDI (Figure S4C).

IL-25 has also been demonstrated to enhance mucus production (von Moltke et al., 2016). Periodic acid-Schiff (PAS) staining (Figure 3B) and scoring (Figure 3C) of the cecal tissue on day 3 revealed that IL-25 induced mucus production. RNA analysis of cecal tissue by qPCR confirmed increased transcripts for muc2, a gene that encodes a major component of mucin, in IL-25 treated mice (Figure 3D). These data prompted the hypothesis that IL-25 may protect the host by bolstering the physical mucus barrier lining the epithelial tissue or by inducing IL-4. From this data, we concluded that IL-25 decreased the deleterious cytokine IL-23, and increased IL-4 and mucin production during CDI.

IL-25 resulted in the accumulation of eosinophils but not neutrophils in the lamina propria of the colon during CDI

Neutrophils are considered the hallmark innate effector cell of human C. difficile infection, but IL-25 signaling is primarily associated with eosinophilia (Cowardin and Petri Jr., 2014; Fort et al., 2001). Therefore, we sought to identify the ability of IL-25 to modulate neutrophils, eosinophils, and monocytes in lamina propria of the colon on day 3 of CDI. Infection increased the levels of both eosinophils (Figure 4A) and neutrophils (Figure 4B) compared to antibiotic treatment alone, indicating that both granulocyte subsets were recruited to the lamina propria during infection. IL-25 selectively increased absolute cell numbers and percentages of eosinophils during CDI (Figure 4A). In contrast, IL-25 treatment did not influence numbers of neutrophils (Figure 4B) or Ly6chi and Ly6clo monocytes (Figure S3) during CDI. Increased eosinophilia by both measurements correlated with decreased clinical scores (Figures 4C, 4D), implying that eosinophilia may play a role in dampening CDI severity. These data demonstrated that IL-25 pretreatment selectively enhanced eosinophil, but not neutrophil, accumulation during CDI and prompted the hypothesis that eosinophils may play a role IL-25 mediated protection.

Figure 4. IL-25 increased lamina propria eosinophils during CDI. Related to Figure S3.

Figure 4

(A) CD45+ CD11b+ CD11cmid SiglecF+ Ly6g− eosinophils and (B) CD45+ CD11b+ Ly6g+ Ly6c+ neutrophils were isolated from the colonic lamina propria and quantified by flow cytometry for absolute numbers and percentage of live cells on day 3 of CDI. Representative flow plot shows neutrophils and eosinophils as a percentage of live cells gated from CD11b+ cells. Data represents three combined experiments; n= 4–6 mice per group per experiment; mean +/− SEM; Students two tailed t-test **<0.005. #<0.05 from uninfected PBS treated group.

(C) Absolute number and (D) percentage of live eosinophils in the lamina propria of PBS and IL-25 treated mice plotted against clinical scores on day 3 of CDI. Data is representative of three experiments; n= 4–6 mice per group per experiment.

Eosinophils are essential for IL-25 mediated protection against CDI severity

IL-25 pretreatment decreased mortality and induced robust eosinophilia during CDI. Furthermore, increased eosinophils in the colon correlated with less severe clinical scores. This led us to hypothesize that eosinophils may be downstream of IL-25 mediated protection. Two distinct models where mice lacked eosinophils were utilized to test the hypothesis. First, PBS and IL-25 treated mice were treated with either anti-SiglecF, an eosinophil depleting monoclonal antibody, or an IgG isotype antibody. Anti-SiglecF treatment selectively depleted eosinophils, as demonstrated by a significant decrease in eosinophils (Figure S5A), but not neutrophils (Figure S5B), in the lamina propria of the colon (Chu et al., 2014; Griseri et al., 2015). Similarly, total IL-4 (Figure S5C) and CD11b+ IL-4+ (Figure S5D) expressing cells were significantly reduced with anti-SiglecF treatment. This was expected since eosinophils are the primary producers of IL-4 during CDI.

IL-25 treated mice lacking eosinophils due to anti-SiglecF depletion experienced increased mortality (Figure 5A) and morbidity (Figure 5B) demonstrating that eosinophils were an essential downstream effector cell in IL-25 mediated protection. Interestingly, depletion of eosinophils in control mice did not influence mortality, suggesting that a more significant enhancement of eosinophilia to levels seen in IL-25 treated mice may be required for survival benefits. Secondly, we utilized PHIL mice, transgenic mice that genetically lack eosinophils, to assess the ability of IL-25 to protect in the absence of eosinophils (Jacobsen et al., 2008). PHIL mice and wild type littermate controls were treated with PBS or IL-25 and assessed for survival rates (Figure 5C) and clinical scores (Figure 5D) during infection. In agreement with antibody-mediated depletion of eosinophils, PHIL mice could not be rescued from severe disease with IL-25 pretreatment supporting the necessity of these cells in IL-25 mediated protection. In PHIL experiments, mice were treated with a sub-lethal dose of 10^3 CFU of C. difficile in order to delineate differences between genotypes. The decreased dose of C. difficile used to challenge mice in PHIL mice experiments likely explains the reduced mortality of PBS wild type treated mice when compared to wild type mice used in other experiments. Interestingly, enhanced disease severity was observed in PHIL mice regardless of IL-25 treatment when compared to wild type controls, consistent with the importance of eosinophils in CDI. We concluded that eosinophils were the cellular mechanism by which IL-25 protects against CDI mortality and morbidity.

Figure 5. IL-25 protected from CDI through an eosinophil-dependent mechanism. Related to Figure S5.

Figure 5

(A–B) C57BL/6J mice +/− IL-25 treatment were given with 20 μg of anti-SiglecF or isotype control one day prior and one day after infection with C. difficile and assessed for (A) survival and (B) clinical scores during infection. Data is representative of two experiments; n=10 mice per group per experiment; mean +/− SEM; *<0.05.

(C–D) C57BL/6J or PHIL mice +/− IL-25 treatment and infected with a sub-lethal dose of 10^3 CFU of C. difficile were assessed for (C) survival and (D) clinical scores. Data represents two combined experiments; n=5–10 mice per group; mean +/− SEM; p value *< 0.05, **<0.005, ***<0.0005 compared to IL-25+anti-SiglecF infected mice.

Eosinophils did not protect by inducing IL-4 or mucin production

IL-25 treatment led to enhanced IL-4 production. Since eosinophils were the primary source of IL-4 during CDI and were necessary for IL-25 mediated reduction in mortality, we speculated that IL-4 production may be the mechanism by which eosinophils reduce disease severity. To test this, we compared survival (Figure S6A) and morbidity (Figure S6B) in PBS control, IL-25 treated, and IL-25+anti-IL4 monoclonal antibody treated mice. Neutralization of IL-4 did not influence mortality but did slow disease resolution, suggesting that IL-4 does not play a role in IL-25 mediated enhanced survival during initial disease, but may be important during disease resolution.

Increased mucin was also observed with IL-25 treatment during CDI. In order to test whether IL-25 protects via mucus induction, we compared muc2 gene expression (Figure S6C) and mucin by PAS histological analysis (Figure S6D) in the cecum of IL-25 treated mice with or without eosinophils on day 3 of infection. We did not observe differences in mucin production in the absence of eosinophils. Thus, we concluded that mucin is not likely to contribute to the protective capabilities of eosinophils.

Lastly, due to mounting evidence supporting a role for eosinophils in promoting IgA responses, we tested whether eosinophils may be protective by increasing antibody levels in the gut (Chu et al., 2014). We measured on day 3 post infection total IgA (Figure S6E) and IgG (Figure S6F) levels in the cecal contents of IL-25 treated mice with or without eosinophil depletion. IgG and IgA production were comparable despite the presence or absence of eosinophils, indicating eosinophils do not protect by increasing total IgA or IgG levels during the initial 3 days of CDI infection. Together these data signify that IL-4, mucin, IgA, and IgG responses were likely not responsible for the ability of eosinophils to reduce mortality and morbidity during CDI.

Eosinophils protected the intestinal epithelial barrier during CDI

In order to understand how eosinophils may be protecting against CDI-associated mortality, we investigated the impact of eosinophil depletion on the colonic intestinal epithelial barrier. Immunohistochemical staining (Figure 6A) and scoring (Figure 6B) of cecal tissue pathology was analyzed in IL-25 treated +/− eosinophil depleted mice on day 3 post infection. IL-25 mice lacking eosinophils had increased epithelial destruction and cellular exudate comparable to levels seen in wild type mice. Additionally, mice lacking eosinophils were the only group to have significantly elevated luminal albumin compared to protected IL-25 treated mice, demonstrating that these mice had the most severe barrier disruption during infection (Figure 6C). In line with these findings, IL-25 treated mice lacking eosinophils and PBS control mice had significantly shorter colon length, a measure of more severe colitis, when compared to IL-25 treated mice (Figure 6D). These data suggest that the loss of eosinophils permitted the most drastic intestinal tissue damage, despite the presence of IL-25. In order to rule out the possibility that eosinophils protected mice from mortality by a direct bactericidal function against C. difficile, we quantified C. difficile toxins A and B (Figure 6E) and bacterial burden (Figure 6F) in the cecal contents on day 3 of infection. We found comparable levels in all groups of mice, indicating that eosinophils do not alter the ability of C. difficile to colonize and produce toxins in the colon. Together, these data signify that eosinophils contribute to IL-25 mediated protection during CDI by protecting host tissue, rather than reducing the capabilities of the pathogen.

Figure 6. Eosinophils were necessary for IL-25-mediated maintenance of the intestinal epithelial barrier during CDI. Related to Figure S6.

Figure 6

(A) H&E staining and (B) tissue pathology scores of cecal tissue from C57BL/6J mice treated with PBS, rIL-25, or rIL-25+anti-Siglecf on day 3 of CDI (Scale = 20μm). Data represents two combined experiments; n=4–7 mice per group per experiment; mean +/− SEM; *<0.05, **<0.005.

(C) Albumin concentration in the cecal contents on day 3 of CDI. Data is from three combined experiments; n=2–5 mice per infected groups per experiment; mean +/− SEM; *<0.05, **<0.005.

(D) Colon length and (E) toxin A/B level and (F) C. difficile bacterial burden in cecal contents on day 3 of CDI. Data is from two combined experiments; n=4–7 mice per group per experiment; mean +/− SEM; *<0.05, **<0.005.

Discussion

This work demonstrates that repletion of IL-25 protected from CDI-associated mortality and morbidity through the action of gut eosinophils. We discovered that IL-25, a cytokine regulated by the microbiota, was repressed in the colon of humans and mice with CDI. Restoration of IL-25 reduced disease severity, despite the presence of equivalent levels of C. difficile and toxins in the gut lumen. IL-25 treatment reduced mortality and morbidity and enhanced integrity of gut epithelial barrier through an eosinophil-dependent manner. Therefore, this work demonstrates a mechanism by which a microbiota-regulated cytokine can induce an innate eosinophilic response that protects the host epithelium and reduces mortality during CDI.

Our results suggest a role for the microbiota in CDI, one that occurs after C. difficile colonization and that does not act by decreasing the burden of C. difficile infection or intoxication. Antibiotic treatment reduces microbial diversity and leads to host susceptibility to CDI (Antonopoulos et al., 2009; Buffie et al., 2012; Ferreyra et al., 2014). The mechanism by which gut commensal bacteria protect has historically been linked to the ability of a healthy microbiota to outcompete C. difficile for space and nutrients (Britton and Young, 2014; Ng et al., 2013; Wilson and Perini, 1988). Disruption of the microbiota has also been shown to alter primary and secondary bile acids, resulting in enhanced germination of spores and subsequent outgrowth of C. difficile (Britton and Young, 2012; Buffie et al., 2015). Therefore, prior studies support the paradigm that the microbiota provides resistance to CDI by acting to block host susceptibility to C. difficile. In contrast, our study demonstrates that restoration of IL-25, a cytokine regulated by the microbiota and reduced during CDI, prevented death and disease from CDI without influencing C. difficile bacterial burden or toxin production. Thus IL-25 functions to reduce mortality in the face of C. difficile toxin production, and does so despite active C. difficile colonization. These findings indicate that there are several mechanisms by which the microbiota protects, and understanding the importance of microbiota regulation of innate immune responses may provide insight to the development of microbial-based therapies used for transplant and probiotic treatments.

It is unclear how IL-25 is regulated during homeostasis, antibiotic treatment, and active CDI. However, it is possible that the immune response to CDI may directly contribute to reducing IL-25 levels. CDI has been associated with the induction of the proinflammatory cytokines IL-23 and IL-1β (Cowardin et al., 2015). Both cytokines correlate with lower IL-25 levels and their increased production during CDI may explain the significant drop in IL-25 during infection (Zaiss et al., 2013; Zaph et al., 2008). Alternatively, epithelial destruction, the cell source of IL-25 in mice, may explain decreases observed in IL-25 expression during CDI. Lastly, CDI has been shown to sustain microbial dysbiosis in the intestine conferred by initial antibiotic treatment (Antharam et al., 2013; Chang et al., 2008; Engevik et al., 2015). Thus, persistent decreases in microbial diversity combined with the outgrowth of C. difficile during active infection may abolish beneficial signals from commensal organisms that induce IL-25 expression. Investigation into the bacterial components of the microbiota that regulate IL-25 expression is required to better understand these relationships.

Eosinophils were identified as the effector cell by which IL-25 signaling protected against CDI-associated mortality. While previously shown to be protective against gut helminth infection, the role of eosinophils in CDI was unanticipated. In human CDI, peripheral eosinophils have been associated with protection from persistent diarrhea and death, which supports our finding in mice of their protective role (Crook et al., 2012). Currently, eosinophils remain heavily examined in the context of allergy, asthma, and parasitic infection while our understanding of their role in the broader context of bacterial infections remains incomplete. While there has been evidence of eosinophils having antibacterial capabilities in vitro, in vivo correlatives of their role in bacterial infections are limited (Hogan et al., 2013; Linch et al., 2012). Since eosinophils did not reduce the burden of the pathogen, it is likely that their action occurred downstream and involved maintaining the intestinal barrier.

Eosinophils have several effector functions that may be beneficial to protecting host tissue during CDI. First, eosinophils may protect the host by regulating immune responses to promote a balanced inflammatory environment that effectively combats the pathogen but prevents off-target host tissue destruction. This is plausible, as the immune response has a multifaceted role during disease and different immune mediators play a protective or pathogenic roles during CDI (Cowardin and Petri Jr., 2014). Eosinophils have previously been demonstrated to promote a beneficial immune response in the colon. For instance, in a model of DSS-induced colitis, eosinophils reduced intestinal pathology by dampening inflammatory mediators in the colon via the lipid mediator protectin D1 (Masterson et al., 2014). Likewise, recent reports indicate that eosinophils specific to the lamina propria are capable of inducing the development of regulatory T cells (Treg) and play an important role in maintaining gut homeostasis by promoting IgA responses (Chen et al., 2015; Chu et al., 2014).

In our model, it is possible that the environment in the colon created by enhanced eosinophils may functionally influence other immune mediators to result in a balanced immune response that is beneficial to host outcome. This hypothesis is supported by our results that IL-25 can selectively reduce deleterious IL-23 but does not influence downstream cytokine IL-22, which has been demonstrated to have a protective role during CDI (Buonomo et al., 2013; Hasegawa et al., 2014). Eosinophils may also protect host tissues through their well-documented ability to remodel and repair host tissue, limiting pathogen or commensal entry into the lamina propria. Likewise, eosinophils may protect the host by facilitating rapid wound healing responses after disruption by the pathogen (Travers and Rothenberg, 2015). Thus, IL-25 mediated eosinophilia may protect against CDI-associated mortality by creating a balance between proinflammatory and tolerogenic immune responses and/or by inducing tissue remodeling and repair pathways to strengthen the epithelial barrier.

While our study indicates that eosinophils are necessary for IL-25 mediated protection, it is unknown whether IL-25 signals directly or indirectly to facilitate the accumulation of eosinophils in the lamina propria. IL-25 receptor (IL-25RB) is expressed on human eosinophils, yet it is more commonly found on type 2 innate lymphoid cells (ILC2) in mice (Cheung et al., 2006; Saenz et al., 2008; Tang et al., 2014; von Moltke et al., 2016). This prompts the question of the involvement of ILC2s in IL-25-eosinophilia mediated protection from CDI severity. Additionally, IL-25 shares the IL-17RB/IL-17RA complex with IL-17B, therefore it is possible that IL-25 activates this receptor complex to influence the expression of IL-17B, which may factor into the accumulation of eosinophils in the intestine (Reynolds et al., 2015).

Finally, it remains unclear whether the ability of eosinophils to reduce mortality is specific to the IL-25 signal, or if other cytokines and chemokines that promote eosinophilia are also capable of protecting the host. Our data demonstrates that in wild type infection where IL-25 signal is diminished, depletion of eosinophils does not influence host mortality, suggesting that the eosinophils recruited during CDI in the absence of IL-25 treatment are not sufficient to reduce the severity of disease. It is possible that robust eosinophilia to levels higher than those seen in wild type infection is necessary to reduce mortality and that any eosinophilia-promoting cytokine is capable of protecting the host. Alternatively, it is conceivable that IL-25 functions not only to support eosinophilia in the gut, but directly or indirectly primes eosinophils to function in a manner that is protective towards host tissue. Further examination is required to understand how IL-25 influences eosinophils to mediate protection during CDI.

Overall, our study identifies IL-25 as a component of the immune response that is regulated by a healthy microbiota and reduces pathology associated with CDI. We identified an essential role for eosinophils in this process. Enhanced mortality, relapse rates, and increased prevalence of CDI in the United States stress the need for better therapies and management strategies. Modulating the innate immune response to reduce CDI-associated pathology may offer advantages to currently inadequate antibiotic therapies, and by acting downstream of the microbiota may complement microbial-based therapeutic development.

Experimental Procedures

Mice

Male C57BL/6J mice were purchased from Jackson Laboratory and PHIL mice were a provided by J. Lee (Mayo Clinic, Scottsdale, AZ) and bred in the UVA vivarium. Mice were between 8–10 weeks of age and given access to autoclaved food and water at the animal facility at the University of Virginia. All C57BL/6J mice ordered from Jackson were age-matched males, but both male and female mice were age-matched and evenly distributed with in experimental groups used in PHIL experiments. Sex and aged-matched controls were used in all experiments. All procedures were approved by the IACUC at the University of Virginia.

Clostridium difficile infection

Mice were received from Jackson Laboratories and started immediately on antibiotic treatment. PHIL mice were littermates and bred at the UVA vivarium. Antibiotics consisted of gentamicin (Sigma) (50 mg/ml), metronidazole (Hopsra)(5 mg/ml), colistin (Sigma) (25 mg/ml), and vancomycin (Hopsra)(50 mg/ml) in the drinking water for three days followed by two days of fresh water and a subsequent single intraperitoneal injection of clindamycin (Hopsra)((10 mg/kg) one day prior to infection with 10^3–10^5 CFU of vegetative C. difficile (strain VPI10643 ATCC #43255 and stain 630 ATCC #BAA-1382) or 10^5 C. difficile spores (strain VPI10643) via oral gavage. Vegetative C.difficile was obtained by overnight culture of a plated single colony of C. difficile in anaerobic Chopped Meat broth (Anaerobic Systems) followed by a subculture of 100 μl in the same media for 5 hours. 1mL of C. difficile in broth was pelleted, washed, quantified by spectrophotometer, and resuspended to desired concentration in sterile PBS and given orally by gavage. Quantification of C. difficile inoculum was verified by counting CFUs on anaerobic BHI agar plates (BD) supplemented with taurocholate (Sigma) (BHI-T). For spores, Mice were treated with a daily dose of 0.5 μg of recombinant IL-25 protein (Biolegend or R&D systems) daily for five days prior to infection.(Zaph et al., 2008) In eosinophil depleting experiments, mice received 20 μg of monoclonal anti-SiglecF (clone 238047, R&D Systems) or IgG isotype (clone 54447, R&D systems) on day −1 and day 1 of infection. For IL-4 neutralization experiments, mice received 1mg of anti-IL4 (Clone 11B11, University of Virginia, Lymphocyte Culture Center) monoclonal antibody or isotype control on day −1 and day 1 of infection. Post-infected mice were assessed for mortality rates and morbidity based clinical scores (weight loss, hair ruffling, ocular discharge, activity, posture, and diarrhea severity) determined by scorer blinded to experimental conditions.(Warren et al., 2012)

Clostridium difficile quantification

Cecal contents were suspended in sterile, anaerobic PBS and serially diluted. Bacterial burden was determined by quantification of colony forming units (CFU) grown anaerobically on BHI-T and 2x C. difficile supplement (Sigma) (BHIS-T) agar plates. Toxins A/B were quantified using the ELISA C. difficile TOX A/B II kit (Techlab, Blacksburg, VA). Both CFU and toxin levels were normalized to stool weight.

Isolation of Lamina propria and flow cytometry

Lamina propria and epithelial cells in the colon were separated as previously described (Madan et al., 2014). Briefly, the colon was removed, cut longitudinally, and rinsed in a Hank’s Balanced Salt Solution (HBSS), 5% Fetal Calf Serum (FCS), 215 25mM HEPES Buffer. The tissue was incubated in pre-warmed buffer consisting of HBSS, 15mM HEPES, 5mM EDTA, 10% FCS 217 and 1mM DTT at 37°C on a shaking incubator for two 20 minute cycles in fresh media to remove the epithelial layer. The tissue was minced and incubated in prewarmed RPMI containing 0.17mg/ml liberase TL (Roche) and 30 μg /ml DNase (Roche) for 40 minutes. After digestion, tissue was passed through 40μm and 100μm nylon strainers, resuspended in FACS buffer, and quantified for total cell numbers and cell viability using trypan blue cell counting. Single cell colonic lamina propria cells were plated at 10^6 live cells per sample and stained. After Fc blockade (anti-mouse CD16/32 TruStain, Biolegend), cells were stained using monoclonal antibodies to markers: Live/dead (Fixable Viability Dye eFluor 506), CD11b-APC(M1/70), CD45-APC-Cy7(30-F11), CD11c-BV421 (N418), Siglecf-PE(E50–2440), Ly6g-PeCy7(1A8), Ly6c-Fitc (HK1.4) (Biolegend, BD, eBiosciences). For ex vivo intracellular analysis cells were incubated without stimulation for 3 hours with Golgiplug (eBioscience) in IMDM + 5% FBS at 37°C. Following incubation, cells were stained with the clones above and IL-4 (11B11, BD Biosciences) using the Fixation/Permeabilization Solution Kit (BD Biosciences). Data was acquired on a Becton Dickinson LSRFortessa flow cytometry BD FACSDiva version 6. software (BD Biosciences). 5x10^5–10^6 events were collected and data was analyzed using FlowJo version 9.2 software (Treestar 233 Inc., Ashland, OR). Cell populations were calculated from total cells per colon and as a percentage of live cells.

Cytokine, IgA and IgG, and muc2 analysis

Cecal tissue was flushed with sterile PBS and homogenized by bead beating for 1 minute in a buffer consisting of 1M HEPES and HALT protease inhibitor cocktail (Thermo-Fisher Scientific Inc., Rockford, IL) followed by a 30 minute incubation on ice and with an Triton X 100, HEPES and HALT protease inhibitor cocktail containing buffer. Cytokines levels were evaluated by ELISA (IL-23, IL-25, IL-22, IL-17A, IL-4, IL-13 Duo-Set, R&D systems). Cytokine protein expression was normalized to total protein concentration generated from the Pierce BCA Protein Assay (ThermoFisher). For epithelial cell and lamina propria extraction, the above protocol was used. For IgA and IgG analysis, cecal contents were diluted and analyzed by ELISA (Ready-SET-go, eBiosciences).For muc2 analysis, cecal tissue was flushed with sterile PBS and processed using the RNeasy mini kit (Qiagen) and Turbo DNA-free kit (Ambion). RNA was reverse transcribed with Tetro cDNA synthesis kit (Bioline). Amplification of muc2 was done using the Sensifast SYBR and fluorescein mix (Bioline), and Forward (TGCCCAGAGAGTTTGGAGAG) and Reverse (CCTCACATGTGGTCTGGTTG) primers. Gene expression was normalized to β-actin and GAPDH.

Human and mice histology

Human biopsies were obtained from the University of Virginia Biorepository and Tissue Research Facility. Tissues samples were provided from remnant surgeries and researchers we blinded to patient identity. Patients with the closest age match were chosen and a full description is provided in Table S1. Positivity of CDI was based on the presence of C. difficile toxins in stool samples of patients. CDI negative tissues were derived from patients suspected of various other intestinal diseases, but confirmed negative for tissue pathology upon biopsy analysis. Immunochemistry staining was performed using the DAKO Autostainer Universal System (Dako, Denmark) with a primary antibody directed against IL-25 (R&D Systems). Scoring was done by four independent blinded scorers and was based on intensity and abundance of IL-25 staining in lamina propria cell infiltrates. The staining scale was between 0–3. Mouse cecal tissue was extracted and fixed for 24 hours in Bouin’s solution (or Corony’s fixative for PAS stain), washed, and stored in 70% ethanol. Tissue was processed and hematoxylin and eosin (H&E) and Periodic acid–Schiff (PAS) stained by the University of Virginia Research Histology core. Mouse IL-25 (US biological life sciences) staining was performed by the University of Virginia Biorepository and Tissue Research Facility. Two independent blinded scorers graded tissues based on 5 parameters (immune infiltrates, cellular exudate, mucosal thickening, epithelial disruption, edema) with individual scales of 0–3 per parameter.

Statistical analysis

Survival rates between groups were assessed using Log-rank (Mantel-Cox) and Gehan-Breslow-Wilcoxon tests. An analysis of variance (ANOVA) was used for differences among multiple groups. Student’s T test (2-tailed) or Mann-Whitney test was used to compare two groups. A p-value below 0.05 was considered significant. All statistical tests were done using GraphPad Prism software (GraphPad Software INc., La Jolla, CA).

Supplementary Material

1
2

Highlights.

  • IL-25 is suppressed during human and murine Clostridium difficile infection (CDI)

  • Restoration of IL-25 reduces mortality and morbidity during CDI

  • Depletion or genetic deletion of eosinophils negate IL-25-mediated protection

  • IL-25-induced eosinophilia maintains integrity of the intestinal barrier during CDI

Acknowledgments

We would like to thank the Petri, Mann, and Ramakrishnan laboratories for helpful discussions, the flow cytometry and histology cores at the University of Virginia for their expertise, and Dr. James Lee for his kind gift of PHIL mice. This work was supported by the US National Institutes of Health (R01AI026649-25, 1R01 AI124214, and R21AI114734 to W.A.P, T32AI07496 and F31AI114203 to E.L.B, and T32AI07046-38 to C.A.C).

Abbreviations

IL-25

Interleukin-25

CDI

Clostridium difficile infection

LP

lamina propria

PHIL mice

transgenic mice lacking eosinophils

Footnotes

Authors Contributions

E.L.B and W.A.P designed experiments and wrote the manuscript. E.L.B performed all experiments and analyzed and interpreted data. C.A.C helped with manuscript review, tissue extraction and processing, and bacterial quantification. M.G.W aided in IL-25 protein detection and tissue processing. M.M.S aided in tissue processing. P.P conducted IL-25 histological staining on human and mouse tissues.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Abt MC, Lewis BB, Caballero S, Xiong H, Carter RA, Sušac B, Ling L, Leiner I, Pamer EG. Innate Immune Defenses Mediated by Two ILC Subsets Are Critical for Protection against Acute Clostridium difficile Infection. Cell Host Microbe. 2015;18:27–37. doi: 10.1016/j.chom.2015.06.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Antharam VC, Li EC, Ishmael A, Sharma A, Mai V, Rand KH, Wang GP. Intestinal Dysbiosis and Depletion of Butyrogenic Bacteria in Clostridium difficile Infection and Nosocomial Diarrhea. J Clin Microbiol. 2013;51:2884–2892. doi: 10.1128/JCM.00845-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Antonopoulos DA, Huse SM, Morrison HG, Schmidt TM, Sogin ML, Young VB. Reproducible Community Dynamics of the Gastrointestinal Microbiota following Antibiotic Perturbation. Infect Immun. 2009;77:2367–2375. doi: 10.1128/IAI.01520-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Britton RA, Young VB. Interaction between the intestinal microbiota and host in Clostridium difficile colonization resistance. Trends Microbiol. 2012;20:313–319. doi: 10.1016/j.tim.2012.04.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Britton RA, Young VB. Role of the Intestinal Microbiota in Resistance to Colonization by Clostridium difficile. Gastroenterology. 2014;146:1547–1553. doi: 10.1053/j.gastro.2014.01.059. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Buffie CG, Jarchum I, Equinda M, Lipuma L, Gobourne A, Viale A, Ubeda C, Xavier J, Pamer EG. Profound Alterations of Intestinal Microbiota following a Single Dose of Clindamycin Results in Sustained Susceptibility to Clostridium difficile-Induced Colitis. Infect Immun. 2012;80:62–73. doi: 10.1128/IAI.05496-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Buffie CG, Bucci V, Stein RR, McKenney PT, Ling L, Gobourne A, No D, Liu H, Kinnebrew M, Viale A, et al. Precision microbiome restoration of bile acid-mediated resistance to Clostridium difficile. Nature. 2015;517:205–208. doi: 10.1038/nature13828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Buonomo EL, Madan R, Pramoonjago P, Li L, Okusa MD, Petri WA. Role of IL-23 signaling in Clostridium difficile Colitis. J Infect Dis. 2013:jit277. doi: 10.1093/infdis/jit277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Chang JY, Antonopoulos DA, Kalra A, Tonelli A, Khalife WT, Schmidt TM, Young VB. Decreased diversity of the fecal Microbiome in recurrent Clostridium difficile-associated diarrhea. J Infect Dis. 2008;197:435–438. doi: 10.1086/525047. [DOI] [PubMed] [Google Scholar]
  10. Chen H-H, Sun A-H, Ojcius DM, Hu W-L, Ge Y-M, Lin X, Li L-J, Pan J-P, Yan J. Eosinophils from Murine Lamina Propria Induce Differentiation of Naïve T Cells into Regulatory T Cells via TGF-β1 and Retinoic Acid. PLoS ONE. 2015;10 doi: 10.1371/journal.pone.0142881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chen X, Katchar K, Goldsmith JD, Nanthakumar N, Cheknis A, Gerding DN, Kelly CP. A Mouse Model of Clostridium difficile–Associated Disease. Gastroenterology. 2008;135:1984–1992. doi: 10.1053/j.gastro.2008.09.002. [DOI] [PubMed] [Google Scholar]
  12. Cheung PFY, Wong CK, Ip WK, Lam CWK. IL-25 regulates the expression of adhesion molecules on eosinophils: mechanism of eosinophilia in allergic inflammation. Allergy. 2006;61:878–885. doi: 10.1111/j.1398-9995.2006.01102.x. [DOI] [PubMed] [Google Scholar]
  13. Chu VT, Beller A, Rausch S, Strandmark J, Zänker M, Arbach O, Kruglov A, Berek C. Eosinophils Promote Generation and Maintenance of Immunoglobulin-A-Expressing Plasma Cells and Contribute to Gut Immune Homeostasis. Immunity. 2014;40:582–593. doi: 10.1016/j.immuni.2014.02.014. [DOI] [PubMed] [Google Scholar]
  14. Cowardin CA, Petri WA., Jr Host recognition of Clostridium difficile and the innate immune response. Anaerobe. 2014;30:205–209. doi: 10.1016/j.anaerobe.2014.08.014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Cowardin CA, Kuehne SA, Buonomo EL, Marie CS, Minton NP, Petri WA. Inflammasome activation contributes to interleukin-23 production in response to Clostridium difficile. mBio. 2015;6 doi: 10.1128/mBio.02386-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Crook DW, Walker AS, Kean Y, Weiss K, Cornely OA, Miller MA, Esposito R, Louie TJ, Stoesser NE, Young BC, et al. Fidaxomicin versus vancomycin for Clostridium difficile infection: meta-analysis of pivotal randomized controlled trials. Clin Infect Dis Off Publ Infect Dis Soc Am. 2012;55(Suppl 2):S93–S103. doi: 10.1093/cid/cis499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. El Feghaly RE, Stauber JL, Deych E, Gonzalez C, Tarr PI, Haslam DB. Markers of intestinal inflammation, not bacterial burden, correlate with clinical outcomes in Clostridium difficile infection. Clin Infect Dis Off Publ Infect Dis Soc Am. 2013a;56:1713–1721. doi: 10.1093/cid/cit147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. El Feghaly RE, Stauber JL, Tarr PI, Haslam DB. Intestinal Inflammatory Biomarkers and Outcome in Pediatric Clostridium difficile Infections. J Pediatr. 2013b;163:1697–1704. e2. doi: 10.1016/j.jpeds.2013.07.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Engevik MA, Engevik KA, Yacyshyn MB, Wang J, Hassett DJ, Darien B, Yacyshyn BR, Worrell RT. Human Clostridium difficile infection: inhibition of NHE3 and microbiota profile. Am J Physiol Gastrointest Liver Physiol. 2015;308:G497–G509. doi: 10.1152/ajpgi.00090.2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Fallon PG, Ballantyne SJ, Mangan NE, Barlow JL, Dasvarma A, Hewett DR, McIlgorm A, Jolin HE, McKenzie ANJ. Identification of an interleukin (IL)-25–dependent cell population that provides IL-4, IL-5, and IL-13 at the onset of helminth expulsion. J Exp Med. 2006;203:1105–1116. doi: 10.1084/jem.20051615. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Ferreyra JA, Wu KJ, Hryckowian AJ, Bouley DM, Weimer BC, Sonnenburg JL. Gut Microbiota-Produced Succinate Promotes C. difficile Infection after Antibiotic Treatment or Motility Disturbance. Cell Host Microbe. 2014;16:770–777. doi: 10.1016/j.chom.2014.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Fort MM, Cheung J, Yen D, Li J, Zurawski SM, Lo S, Menon S, Clifford T, Hunte B, Lesley R, et al. IL-25 Induces IL-4, IL-5, and IL-13 and Th2-Associated Pathologies In Vivo. Immunity. 2001;15:985–995. doi: 10.1016/s1074-7613(01)00243-6. [DOI] [PubMed] [Google Scholar]
  23. Franzè E, Rizzo A, Caruso R, Pallone F, Monteleone G. Interleukin-25 negatively controls pathogenic responses in the gut. Inflamm Allergy Drug Targets. 2011;10:187–191. doi: 10.2174/187152811795564028. [DOI] [PubMed] [Google Scholar]
  24. Geiger TL, Abt MC, Gasteiger G, Firth MA, O’Connor MH, Geary CD, O’Sullivan TE, van den Brink MR, Pamer EG, Hanash AM, et al. Nfil3 is crucial for development of innate lymphoid cells and host protection against intestinal pathogens. J Exp Med. 2014;211:1723–1731. doi: 10.1084/jem.20140212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Griseri T, Arnold IC, Pearson C, Krausgruber T, Schiering C, Franchini F, Schulthess J, McKenzie BS, Crocker PR, Powrie F. Granulocyte Macrophage Colony-Stimulating Factor-Activated Eosinophils Promote Interleukin-23 Driven Chronic Colitis. Immunity. 2015;43:187–199. doi: 10.1016/j.immuni.2015.07.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Hasegawa M, Yada S, Liu MZ, Kamada N, Muñoz-Planillo R, Do N, Núñez G, Inohara N. Interleukin-22 regulates the complement system to promote resistance against pathobionts after pathogen-induced intestinal damage. Immunity. 2014;41:620–632. doi: 10.1016/j.immuni.2014.09.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Hogan SP, Waddell A, Fulkerson PC. Eosinophils in Infection and Intestinal Immunity. Curr Opin Gastroenterol. 2013;29:7–14. doi: 10.1097/MOG.0b013e32835ab29a. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Jacobsen EA, Ochkur SI, Pero RS, Taranova AG, Protheroe CA, Colbert DC, Lee NA, Lee JJ. Allergic pulmonary inflammation in mice is dependent on eosinophil-induced recruitment of effector T cells. J Exp Med. 2008;205:699–710. doi: 10.1084/jem.20071840. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Jarchum I, Liu M, Shi C, Equinda M, Pamer EG. Critical role for MyD88-mediated neutrophil recruitment during Clostridium difficile colitis. Infect Immun. 2012;80:2989–2996. doi: 10.1128/IAI.00448-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Kleinschek MA, Owyang AM, Joyce-Shaikh B, Langrish CL, Chen Y, Gorman DM, Blumenschein WM, McClanahan T, Brombacher F, Hurst SD, et al. IL-25 regulates Th17 function in autoimmune inflammation. J Exp Med. 2007;204:161–170. doi: 10.1084/jem.20061738. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Lessa FC, Mu Y, Bamberg WM, Beldavs ZG, Dumyati GK, Dunn JR, Farley MM, Holzbauer SM, Meek JI, Phipps EC, et al. Burden of Clostridium difficile Infection in the United States. N Engl J Med. 2015;372:825–834. doi: 10.1056/NEJMoa1408913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Linch SN, Danielson ET, Kelly AM, Tamakawa RA, Lee JJ, Gold JA. Interleukin 5 Is Protective during Sepsis in an Eosinophil-Independent Manner. Am J Respir Crit Care Med. 2012;186:246–254. doi: 10.1164/rccm.201201-0134OC. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Madan R, Guo X, Naylor C, Buonomo EL, Mackay D, Noor Z, Concannon P, Scully KW, Pramoonjago P, Kolling GL, et al. Role of leptin-mediated colonic inflammation in defense against Clostridium difficile colitis. Infect Immun. 2014;82:341–349. doi: 10.1128/IAI.00972-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Masterson JC, McNamee EN, Fillon SA, Hosford L, Harris R, Fernando SD, Jedlicka P, Iwamoto R, Jacobsen E, Protheroe C, et al. Eosinophil-mediated signalling attenuates inflammatory responses in experimental colitis. Gut gutjnl – 2014–306998. 2014 doi: 10.1136/gutjnl-2014-306998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. von Moltke J, Ji M, Liang HE, Locksley RM. Tuft-cell-derived IL-25 regulates an intestinal ILC2-epithelial response circuit. Nature. 2016;529:221–225. doi: 10.1038/nature16161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Ng KM, Ferreyra JA, Higginbottom SK, Lynch JB, Kashyap PC, Gopinath S, Naidu N, Choudhury B, Weimer BC, Monack DM, et al. Microbiota-liberated host sugars facilitate post-antibiotic expansion of enteric pathogens. Nature. 2013;502 doi: 10.1038/nature12503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Peterson LW, Artis D. Intestinal epithelial cells: regulators of barrier function and immune homeostasis. Nat Rev Immunol. 2014;14:141–153. doi: 10.1038/nri3608. [DOI] [PubMed] [Google Scholar]
  38. Reynolds JM, Lee YH, Shi Y, Wang X, Angkasekwinai P, Nallaparaju KC, Flaherty S, Chang SH, Watarai H, Dong C. Interleukin-17B Antagonizes Interleukin-25-Mediated Mucosal Inflammation. Immunity. 2015;42:692–703. doi: 10.1016/j.immuni.2015.03.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Ryan A, Lynch M, Smith SM, Amu S, Nel HJ, McCoy CE, Dowling JK, Draper E, O’Reilly V, McCarthy C, et al. A Role for TLR4 in Clostridium difficile Infection and the Recognition of Surface Layer Proteins. PLoS Pathog. 2011;7:e1002076. doi: 10.1371/journal.ppat.1002076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Saenz SA, Taylor BC, Artis D. Welcome to the neighborhood: epithelial cell-derived cytokines license innate and adaptive immune responses at mucosal sites. Immunol Rev. 2008;226:172–190. doi: 10.1111/j.1600-065X.2008.00713.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tang W, Smith SG, Beaudin S, Dua B, Howie K, Gauvreau G, O’Byrne PM. IL-25 and IL-25 receptor expression on eosinophils from subjects with allergic asthma. Int Arch Allergy Immunol. 2014;163:5–10. doi: 10.1159/000355331. [DOI] [PubMed] [Google Scholar]
  42. Travers J, Rothenberg ME. Eosinophils in mucosal immune responses. Mucosal Immunol. 2015;8:464–475. doi: 10.1038/mi.2015.2. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Warren CA, van Opstal E, Ballard TE, Kennedy A, Wang X, Riggins M, Olekhnovich I, Warthan M, Kolling GL, Guerrant RL, et al. Amixicile, a Novel Inhibitor of Pyruvate:Ferredoxin Oxidoreductase, Shows Efficacy against Clostridium difficile in a Mouse Infection Model. Antimicrob Agents Chemother. 2012;56:4103–4111. doi: 10.1128/AAC.00360-12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wilson KH, Perini F. Role of competition for nutrients in suppression of Clostridium difficile by the colonic microflora. Infect Immun. 1988;56:2610–2614. doi: 10.1128/iai.56.10.2610-2614.1988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Zaiss MM, Maslowski KM, Mosconi I, Guenat N, Marsland BJ, Harris NL. IL-1β Suppresses Innate IL-25 and IL-33 Production and Maintains Helminth Chronicity. PLoS Pathog. 2013;9 doi: 10.1371/journal.ppat.1003531. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Zaph C, Du Y, Saenz SA, Nair MG, Perrigoue JG, Taylor BC, Troy AE, Kobuley DE, Kastelein RA, Cua DJ, et al. Commensal-dependent expression of IL-25 regulates the IL-23-IL-17 axis in the intestine. J Exp Med. 2008;205:2191–2198. doi: 10.1084/jem.20080720. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
2

RESOURCES