Skip to main content
NCBI home page
Heliyon logoLink to Heliyon
. 2016 Jun 28;2(6):e00124. doi: 10.1016/j.heliyon.2016.e00124

Assessment of the labelling accuracy of spanish semipreserved anchovies products by FINS (forensically informative nucleotide sequencing)

Amaya Velasco a,⁎, Anxela Aldrey b, Ricardo I Pérez-Martín a, Carmen G Sotelo a
PMCID: PMC4946307  PMID: 27441295

Abstract

Anchovies have been traditionally captured and processed for human consumption for millennia. In the case of Spain, ripened and salted anchovies are a delicacy, which, in some cases, can reach high commercial values. Although there have been a number of studies presenting DNA methodologies for the identification of anchovies, this is one of the first studies investigating the level of mislabelling in this kind of products in Europe. Sixty-three commercial semipreserved anchovy products were collected in different types of food markets in four Spanish cities to check labelling accuracy. Species determination in these commercial products was performed by sequencing two different cyt-b mitochondrial DNA fragments. Results revealed mislabelling levels higher than 15%, what authors consider relatively high considering the importance of the product. The most frequent substitute species was the Argentine anchovy, Engraulis anchoita, which can be interpreted as an economic fraud.

Keywords: Food Science

1. Introduction

Anchovies are small pelagic fish belonging to the Engraulidae family, which play key roles in continental shelf food webs across the globe (FAO, 1988). As a result of their abundance, anchovies have been captured and consumed by humans for millennia, and of the 17 existing genera, Engraulis, Anchoa, and Stolephorus, are those with higher commercial relevance. In fact Engraulis ringens is one of the most exploited fish species in the world (FAO, 2014). The European anchovy (Engraulis encrasicolus) was the third species of the family in terms of catches in 2010 (529,615 t). Engraulis encrasicolus is a highly appreciated species in Europe, and particularly those caught along the northern Spanish coast, which are traded as “Anchoa del Cantabrico”, a denomination regularly employed in canned (“semipreserved”) products.

European legislation about labelling (EU 1169, 2011) lay down the rules about the information that would be provided to final consumers. In addition, the EU 1379/2013 establishes the information that must be reported in case of fishery and aquaculture products. In particular, commercial and scientific names of fish species should be exhibited in seafood products (live, fresh, chilled, frozen, dried, salted or in brine and smoked) at point of sale. This is an important tool helping consumers to identify the nature of the product they are about to buy. Starting from 2002 each European member state has published a list of approved commercial names that must be used for fishery products commercialized in its own territory. The commercial names “Anchoa” and “Anchoas” refer to a type of seafood product where the main ingredient is fish of the family Engraulidae (genus Engraulis) according to the Spanish approved list of commercial names for seafood products (BOE, 2015), which has been salted and matured for a certain period of time. Nevertheless, taking into account the specific Spanish legislation for semipreserved seafood (RD 1521, 1984),only products with E. encrasicolus should be labeled as “anchoa” (without “s”). This kind of product is a delicacy, which can reach commercial values in the Spanish markets from 90 up to 300 €/Kg, depending on the process employed (industrial versus artisanal), the species (Engraulis encrasicolus being the most prized of the genus) and the ingredients (type of oil used).

Fish Species identification relies in most cases on external morphological characters, however these are no longer recognizable in processed seafood, therefore several DNA based techniques have been developed to authenticate fish species in seafood products (Rasmussen Hellberg and Morrissey, 2011, Quinteiro et al., 1998; Hold et al., 2001; Griffiths et al., 2014); these have been also proven to be useful in the case of anchovy products (Bréchon et al., 2013; Jérôme et al., 2008; Santaclara et al., 2006; Sebastio et al., 2001).

Seafood mislabelling is a concern from different points of view, such as economic deception and loss of consumer confidence in the fishing industry; the use of cheaper fish species in products sold with the names of higher-value species remains the most common type of seafood mislabelling (Jacquet and Pauly, 2008) and this appears to be greater in processed products (Pardo et al., 2016; Everstine et al., 2013). Mislabelling can also hide illegal fishing practices which affect negatively the sustainability of a resource and damages the long term survival of an ancient human activity (Jacquet and Pauly, 2008). There might be also health implications since some substitute species might be toxic (Armani et al., 2015a; Cohen et al., 2009).

This study aims to evaluate the level of accuracy of the information provided to consumers in the case of processed anchovies in Spain: an important seafood product in the European market. We examine the information provided on the labels of this type of products in relation to its quality (species declared) and quantity (presence/absence of pieces of mandatory and voluntary information).

2. Material and methods

2.1. Samples

56 samples of authentic Engraulidae and Cupleidae species were obtained fresh, from local fish markets, and frozen from collaborating fish canneries (Table 1).

Table 1.

Sequences of authentic species used as reference in the present study. “Specimens” column indicates each of the individuals used for performing the analysis. In the case of sequences obtained from a public database GenBank is indicated.

Keys Common Name (Spanish) Common name Scientific name Specimens Origin Provided by Accession number
EENC Anchoa European anchovy Engraulis encrasicolus EENC1 Spain Alfageme KX062193
EENC4 Spain Alfageme KX062194
EENC6 Spain Alfageme KX062195
EENC5 Spain Alfageme KX062196
EENC3 Spain Alfageme KX062197
EJAP Anchoa japonesa Japanese anchovy Engraulis japonicus EJAP2 Japan A. Takasuka KX062166
EJAP4 Japan A. Takasuka KX062167
EJAP1 Japan A. Takasuka KX062168
EJAP3 Japan A. Takasuka KX062169
EJAP5 Japan A. Takasuka KX062170
EANC Anchoita Argentine anchovy Engraulis anchoita EANCH1 Argentina Conxemar KX062155
EANCH10 Argentina Conxemar KX062156
EANCH6 Argentina Conxemar KX062157
EANCH8 Argentina Conxemar KX062158
EANCH2 Argentina Conxemar KX062159
EANCH3 Argentina Conxemar KX062160
EANCH7 Argentina Conxemar KX062161
EANCH4 Argentina Conxemar KX062162
EANCH9 Argentina Conxemar KX062163
EANCH5 Argentina Conxemar KX062164
EANCHOITA1 Argentina Conxemar KX062165
ERIN Anchoveta Peruvian anchovy Engraulis ringens ERIN2 Peru Conxemar KX062198
ERIN4 Peru Conxemar KX062199
ERIN3 Peru Conxemar KX062200
ERIN1 Peru Conxemar KX062201
ERIN5 Peru Conxemar KX062174
ANAS Anchovetas indias, anchoveta blanca Longnose anchovy Anchoa nasus ANAS1 Mexico IIM KX062149
ANAS4 Mexico IIM KX062150
ANAS6 Mexico IIM KX062151
ANAS3 Mexico IIM KX062152
ANAS5 Mexico IIM KX062153
ANAS2 Mexico IIM KX062154
EMOR Anchoa de California Californian anchovy Engraulis mordax EMOR14GB GenBank JQ012350
EMOR15GB GenBank FJ264393
EMOR16GB GenBank FJ264392
EMOR17GB GenBank AY923783
EMOR18GB GenBank AY923782
SPIL Sardina European pilchard Sardina pilchardus SPIL10 Spain IIM KX062184
SPIL13 Spain IIM KX062185
SPIL12 Spain IIM KX062186
SPIL14 Spain IIM KX062187
SPIL11 Spain IIM KX062188
SAUR Sardinelas Round sardinella Sardinella aurita SAUR1 Senegal IIM KX062175
SAUR2 Senegal IIM KX062176
SAUR3 Spain IIM KX062177
SAUR4 Spain IIM KX062178
SAUR5 Spain IIM KX062179
SSAG Sardinopas Southamerican pilchard Sardinops sagax SSAG1 Peru/Chile IIM KX062189
SSAG4 Peru/Chile IIM KX062190
SSAG3 Peru/Chile IIM KX062191
SSAG2 Peru/Chile IIM KX062192
EMAC Machete Pacific Menhaden Ethmidium maculatum EMAC3 Peru/Chile BIP Vigo KX062171
EMAC2 Peru/Chile BIP Vigo KX062172
EMAC1 Peru/Chile BIP Vigo KX062173
SMAD Sardinelas Madeiran sardinella Sardinella maderiensis SMAD1 Senegal IIM KX062180
SMAD2 Senegal IIM KX062181
SMAD3 Senegal IIM KX062182
SMAD4 Senegal IIM KX062183
CHAR Arenque Atlantic herring Clupea harengus CLUPEAHARENGUSGB GenBank EU492008
Open in a new tab

For all authors’ knowledge in Spain there are about 130 brands for semipreserved anchovies, most of them are only available in particular cities or retailers, since anchovies market in Spain present a certain level of localism. The main commercial brands are covered in the sampling: the 11 most relevant Spanish commercial brands, present in all retailers sampled, and some of the city-specific and retail-specific brands. We analyzed 63 commercial samples, from a range of 42 brands, of commercial products of semipreserved anchovies, purchased in markets of four different Spanish cities, across three different geographical Spanish regions: Vigo, Santiago de Compostela (North West), Bilbao (North) and Madrid (Centre).

In all cities different locations of the city area were sampled, collecting products both in traditional markets, supermarkets and specialized stores. Samples were obtained in their original packaging and were immediately transported to the laboratory, where they were stored at −20 °C the same day of the purchase. Before opening the package, all products were photographed (Fig. 1) and label information was recorded (Table 2).

Fig. 1.

Fig. 1

Open in a new tab

Information collected for each commercial sample. Mandatory Information in anchovy labels (red marks) and not mandatory (yellow marks).

Table 2.

Labelling information collected in anchovy products showing percentages of appearance.

INFORMATION Mandatory number of samples %
Commercial denomination Yes 63 100
Declared “anchoa” Yes 28 44.44
Declared “anchoas” Yes 35 55.56
Ingredients list Yes 63 100
with olive oil (or Extra virgin olive oil) Yes 39 61.9
with vegetable oil Yes 15 23.81
with sunflower oil Yes 8 12.7
with mixed oil Yes 1 1.59
with % of ingredients Yes 13 20.63
Net and drained weight Yes 63 100
Conservation instructions Yes 63 100
Best before date Yes 63 100
Company name or code Yes 63 100
Batch number Yes 63 100
Country of origin (only mandatory for imported products) Yes 3 100
Nutritional information No 63 100
Reference to Cantabria* No 16 25.4
Scientific name No 23 36.51
Declared E.encrasicolus No 11 17.46
Declared not E.encrasicolus No 12 19.05
Artisanal elaboration No 2 3.17
Elaborated from fresh fish No 1 1.59
Product from Spain No 2 3.17
Captured from April to June No 3 4.76
No lactose No 1 1.59
No gluten No 3 4.76
Omega 3 source No 3 4.76
Natural ingredients No 1 1.59
Low salted No 1 1.59
Consumer information telephone No 5 7.94
Open in a new tab

*Processed in Cantabria, Processed in Santoña, From the Cantabrian Sea.

2.2. DNA extraction

Before DNA extraction, all commercial samples were desalted by soaking them in sterilized water for 3 to 4 hours at room temperature and rinsed afterwards with sterile water. DNA extraction from reference and commercial samples was carried out as previously described (Chapela et al., 2007) using Proteinase K (Thermo Fisher Scientific) digestion with Wizard DNA Clean-up System kit (Promega) for DNA isolation. DNA quality and concentration were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific). The resulting concentrations of DNA were in the range of 50–500 ng/μl. DNA extracts were kept at −20 °C until analysis.

2.3. DNA amplification

A 464 bp fragment of cytb gene was amplified by using the primers described by Burgener (1997) (H15149ad: GCICCTCARAATGAYATTTGTCCTCA and L14735: AAAAACCACCGTTGTTATTCAACTA). The thermal cycling protocol used was: 94 °C for 5 min, followed by 35 cycles of amplification (94 °C for 40 s, 55 °C for 80 s and 72 °C for 80 s) and a final extension step of 72 °C for 7 min. These PCR reactions were carried out in a GeneAmp PCR system 9700 Thermo cycler (Applied Biosystems), with a total reaction volume of 25 μL with 100 ng of DNA template, using PCR Ready-to-Go beads (GE Healthcare) with final concentrations of 1.5 mM of MgCl2, 0.8 μM of each primer, 0.2 mM of dNTPs and 0.1 units of Taq polymerase.

A shorter cytochrome b fragment (100 bp) was also amplified with the same PCR mix using C-CB primers (Jérôme et al., 2003): C-CB284dF-AYGCNCACATTGGNCGRGG and C-CB425dR-CCTCAGAADGACATTTGBCCTC when the 464 bp fragment amplification failed. In this case, the following thermal protocol was employed: 94 °C for 3 min, followed by 35 cycles of amplification (94 °C for 40 s, 55 °C for 40 s and 72 °C for 40 s) and a final extension step of 72 °C for 7 min.

PCR products were examined and recorded on a 2% agarose gel (Conda) using UV light with GelDOc XR (Biorad). In the case of PCR failure, DNA was run in agarose gels to check the DNA fragmentation status.

2.4. DNA Sequencing and data analysis

Enzymatic purification was applied to PCR products, by adding 3 μl of illustra™ ExoStar™ 1-Step (GE Healthcare) and incubating at 37 °C for 15 min and 80 °C for 15 min. Two sequencing reactions were performed per PCR product, one with each primer of the set. Sequencing reactions were carried out with BigDye Terminator 1.1 (Applied Biosystems), following the manufacturer’s instructions. After cleaning and drying, 15 μl of Hi-Di Formamide (Thermo Fisher Scientific) were added to the sample tube, and Sanger sequencing carried out in an ABI PRISM 310 genetic analyzer (Applied Biosystems).

After automatic sequencing, forward and reverse sequences were edited with Chromas LITE (Technelysium) and aligned with Bioedit (Hall, 1999) to obtain the complete fragment. NCBI nucleotide database only allows to upload sequences longer than 200 bp, therefore sequences obtained with C-CB priners (100 bp) could not be submitted, and only the sequences obtained with the Burgener fragment have been assigned an accession number. (Table 3: KJ563141 to KJ563182, KJ623921, KJ645861 and KJ645862).

Table 3.

Commercial anchovy samples used for the study showing the results of the analyses. Mislabelled samples appear in red.

Saple code Label information Date of sampling City Species declared Fragment amplified FINS result BLAST result % of match GenBank ID Correct/mislabelled
AV1 Anchovies fillets in olive oil (37%) 02/05/2013 Vigo Anchoas 464 bp Engraulis anchoita Engraulis anchoita 100% KJ563154 correct
AV2 Anchovies fillets in olive oil. Anchoas 02/05/2013 Vigo Anchoas 464 bp Engraulis anchoita Engraulis anchoita 100% KJ563155 correct
AV3 Anchovies in olive oil 02/05/2013 Vigo Anchoas 100 bp Engraulis encrasicolus Engraulis encrasicolus 100% correct
AV4 Anchovies fillets in olive oil. Cantabrian Sea 02/05/2013 Vigo Anchoas 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563156 correct
AV5 Anchovy fillets from the Cantabrian Sea in olive oil (30%) FAO 27. VIII. Engraulis encrasicholus 02/05/2013 Vigo Anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563141 correct
AV6 Anchovy fillets in vegetable oil 02/05/2013 Vigo Anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563157 correct
AV7 Anchovies fillets in sunflower oil, Engraulis anchoita 02/05/2013 Vigo Engraulis anchoita 100 bp Engraulis anchoita Engraulis anchoita 100% correct
AV8 Anchovy fillets in olive oil (40%) 02/05/2013 Vigo Anchoa 100 bp Engraulis anchoita Engraulis anchoita 99% mislabelled
AV9 Anchovies in vegetable oil, Engraulis ringens, FAO-087, P019-PAR-PRIS-PERÚ 02/05/2013 Vigo Engraulis ringens 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563142 mislabelled
AV10 Anchovies fillets in vegetable oil, Engraulis ringens 02/05/2013 Vigo Engraulis ringens 100 bp Engraulis ringens Engraulis ringens 95% correct
AV11 Anchovies fillets in vegetable oil, Engraulis ringens 02/06/2013 Vigo Engraulis ringens 100 bp Engraulis ringens Engraulis ringens 100% correct
AV12 Anchovy fillets in olive oil 02/06/2013 Vigo Anchoa 100 bp Engraulis anchoita Engraulis anchoita 100% mislabelled
AV13 Anchovy fillets in olive oil. Engraulis encrasicholus 02/06/2013 Vigo Engraulis encrasicolus 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563158 correct
AV14 Anchovy fillets in olive oil. Engraulis encrasicholus 02/06/2013 Vigo Engraulis encrasicolus 100 bp Engraulis encrasicolus Engraulis encrasicolus 100% correct
AV15 Anchovy fillets in sunflower oil 02/06/2013 Vigo Anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 100% KJ563159 correct
AV16 Anchovies from Santoña in olive oil. Anchovies from the Cantabrian Sea 02/08/2013 Vigo Anchoas 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563160 correct
AV17 Anchovies in extra virgin olive oil. Cantabrian Sea 02/08/2013 Vigo Anchoas 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563161 correct
AV18 Anchovies in extra virgin olive oil 02/08/2013 Vigo Anchoas 100 bp Engraulis encrasicolus Engraulis encrasicolus 100% correct
AV19 Anchovy fillets in olive oil 02/08/2013 Vigo Anchoa 100 bp Engraulis anchoita Engraulis anchoita 98% mislabelled
AV20 Anchovy fillets in oilve oil. Engraulis encrasicholus, Mediterranean Sea (Morocco) 02/08/2013 Vigo Engraulis encrasicolus 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563143 correct
AS1 Anchovies in olive oil (40%) 06/12/2013 Santiago de Compostela Anchoas 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563162 correct
AS2 Anchovies fillets in vegetable oil, Engraulis ringens 06/12/2013 Santiago de Compostela Engraulis ringens 464 bp Engraulis encrasicolus Engraulis encrasicolus 98% KJ563163 mislabelled
AS3 Anchovies fillets in vegetable oil, Engraulis ringens 06/12/2013 Santiago de Compostela Engraulis ringens 100 bp Engraulis ringens Engraulis ringens 100% correct
AS4 Anchovies fillets in sunflower oil 06/12/2013 Santiago de Compostela Anchoas 100 bp Engraulis ringens Engraulis ringens 100% correct
AS5 Anchovies fillets in vegetable oil, Engraulis ringens 06/12/2013 Santiago de Compostela Engraulis ringens 100 bp Engraulis ringens Engraulis ringens 100% correct
AS6 Anchovy fillets in virgin olive oil 06/12/2013 Santiago de Compostela Anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563164 correct
AS7 Anchovies fillets in olive oil, from the Cantabrian Sea 06/12/2013 Santiago de Compostela Anchoas 464 bp Engraulis anchoita Engraulis anchoita 99% KJ563165 correct
AS8 Anchovies fillets in sunflower oil, Engraulis ringens 06/12/2013 Santiago de Compostela Engraulis ringens 100 bp Engraulis ringens Engraulis ringens 100% correct
AS9 Anchovies fillets in vegetable oil 06/12/2013 Santiago de Compostela Anchoas 464 bp Engraulis anchoita Engraulis anchoita 100% KJ563166 correct
AS10 Anchovies fillets in vegetable oil 06/12/2013 Santiago de Compostela Anchoas Not amplified
AS11 Anchovies fillets in olive oil 06/12/2013 Santiago de Compostela Anchoas Not amplified
AS12 Anchovy fillets in olive oil, Engraulis encrasicolus 06/12/2013 Santiago de Compostela Engraulis encrasicolus 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563167 correct
AS13 Anchovy fillets in olive oil 06/12/2013 Santiago de Compostela Anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ623921 correct
AS14 Anchovy fillets in olive oil, Cantabrian Sea, Engraulis encrasicolus 06/12/2013 Santiago de Compostela Engraulis encrasicolus 464 bp Engraulis encrasicolus Engraulis encrasicolus 100% KJ563168 correct
AS15 Anchovies from the Cantabrian Sea in olive oil 06/12/2013 Santiago de Compostela Anchoas 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563169 correct
AS16 Anchovy fillets in olive oil, Engraulis encrasicolus 06/12/2013 Santiago de Compostela Engraulis encrasicolus 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563170 correct
AS17 Anchovy fillets in olive oil, made in Santoña 06/12/2013 Santiago de Compostela Anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563171 correct
AM1 Anchovies fillets in oilve oil 26/06/2013 Madrid anchoas 464 bp Engraulis anchoita Engraulis anchoita 100% KJ563144 correct
AM2 Anchovy fillets in vegetable oil, made in Cantabria 26/06/2013 Madrid anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563145 correct
AM3 Anchovy fillets from the Cantabrian in olive oil, Engraulis encrasicolus 26/06/2013 Madrid Engraulis encrasicolus 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563146 correct
AM4 Anchovies in vegetable oil, Engraulis spp, product from Peru 26/06/2013 Madrid Engraulis spp Not amplified
AM5 Anchovies fillets in sunflower oil, Engraulis anchoita 26/06/2013 Madrid Engraulis anchoita 464 bp Engraulis anchoita Engraulis anchoita 99% KJ563147 correct
AM6 Anchovy fillets in vegetable oil, Engraulis encrasicolus 26/06/2013 Madrid Engraulis encrasicolus 464 bp Engraulis encrasicollus Engraulis encrasicollus 100% KJ563148 correct
AM8 Anchovies in olive oil, low salt 26/06/2013 Madrid anchoas 464 bp Engraulis anchoita Engraulis anchoita 99% KJ563149 correct
AM9 Anchovy fillets in olive oil, from Santoña 26/06/2013 Madrid anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563150 correct
AM10 Anchovies fillets in olive oil, from Santoña 26/06/2013 Madrid anchoas 464 bp Engraulis anchoita Engraulis anchoita 100% KJ563151 correct
AM11 Anchovy fillets in olive oil. Anchoa (Engraulis spp) 26/06/2013 Madrid anchoa (Engraulis spp) 464 bp Engraulis anchoita Engraulis anchoita 100% KJ563152 mislabelled
AM12 Anchovies fillets in vegetable oil 26/06/2013 Madrid anchoas 464 bp Engraulis ringens Engraulis ringens 98% KJ645862 correct
AM13 Anchovies fillets in olive oil 26/06/2013 Madrid anchoas 464 bp Engraulis japonicus Engraulis japonicus 99% KJ563153 correct
AB1 Anchovy fillets in sunflower oil 04/07/2013 Bilbao anchoa 464 bp Engraulis anchoita Engraulis anchoita 98% KJ563173 mislabelled
AB2 Anchovy fillets in olive oil 04/07/2013 Bilbao anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 98% KJ563174 correct
AB3 Filetes de anchoa del Cantábrico 04/07/2013 Bilbao anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 100% KJ563175 correct
AB4 Anchovy fillets in olive oil 04/07/2013 Bilbao anchoa 464 bp Engraulis anchoita Engraulis anchoita 99% KJ563176 mislabelled
AB5 Anchovy fillets from the Cantabrian Sea, Engraulis encrasicolus 04/07/2013 Bilbao Engraulis encrasicolus 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563177 correct
AB6 Anchovies 04/07/2013 Bilbao Engraulis anchoita 464 bp Engraulis anchoita Engraulis anchoita 99% KJ563178 correct
AB7 Anchovies fillets in olive oil 04/07/2013 Bilbao anchoas 100 bp Engraulis ringens Engraulis ringens 98% correct
AB8 Anchovy fillets in olive oil 04/07/2013 Bilbao anchoa 464 bp Engraulis anchoita Engraulis anchoita 99% KJ563179 mislabelled
AB9 Anchovy fillets in olive oil 04/07/2013 Bilbao anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563180 correct
AB10 Anchovy fillets in olive oil 04/07/2013 Bilbao anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ563181 correct
AB11 Anchovy fillets in olive oil 04/07/2013 Bilbao anchoa 464 bp Engraulis encrasicolus Engraulis encrasicolus 95% KJ563182 correct
AB12 Anchovies fillets in olive oil, Engraulis encrasicolus 04/07/2013 Bilbao anchoas Not amplified
AB13 Anchovies fillets in olive oil 04/07/2013 Bilbao anchoas 464 bp Engraulis encrasicolus Engraulis encrasicolus 99% KJ645861 correct
AB14 Anchovies fillets in vegetable oil 04/07/2013 Bilbao anchoas Not amplified
Open in a new tab

MEGA (Kumar et al., 2008) was used for a phylogenetic analysis. Genetic distance analysis was used to infer species from DNA sequences obtained from commercial samples using reference sequences obtained from Engraulidae and Cupleidae families (Table 1). The method Neighbor-Joining with Tamura-Nei model was used for the phylogeny reconstruction (Fig. 2). Each sequence was also matched in the Nucleotide BLAST (Basic Local Alignment Search Tool) of the NCBI (National Center of Biotechnology Information), by using the program Megablast with the default algorithm parameters.

Fig. 2.

Fig. 2

Open in a new tab

Tamura-Nei trees with the 465 bp fragment (103 sequences) and 100 bp fragment (76 sequences) of cyt b. Commercial samples of this study are marked with ♦.

103 sequences were used to build a Neighbor-Joining tree with Tamura Nei distances with the 465 bp fragment (44 from commercial samples, 53 from reference samples and 6 downloaded from GenBank) and for the 100 bp fragment Tree 76 sequences were used (14 from commercial samples, 56 from reference samples and 6 downloaded from GenBank).

3. Results and discussion

3.1. Species information in preserved anchovies

Commercial anchovy samples were analyzed using FINS (Forensically Informative Nucleotide Sequencing) (Bartlett and Davidson, 1992). This methodology is based on the analysis of DNA sequences, in this case a cytochrome b fragment of 464 bp (Burgener fragment) and of 100 bp (C-CB fragment). These DNA markers were chosen because of their capability for differentiating among all anchovy species and, other possible substitute species, such as Sardina pilchardus, Sardinops sagax, Sardinella aurita or Ethmidium maculatum (Jérôme et al., 2003, Jérôme et al., 2008).

DNA quality was tested with NanoDrop, all DNA samples showed 269/280 ratios of 1.7 to 1.9. Although these ratios seemed acceptable for PCR, DNA fragmentation hindered the amplification of the 464 bp fragment in 19 cases, in which DNA quality had to be rechecked in agarose gels. In 14 of those cases it was necessary to use the shorter DNA fragment amplification target (C-CB, 100 bp), since DNA degradation did not allow the amplification of the 464 bp amplification, and in the other 5 samples DNA fragments sizes were below 100 bp hindering any DNA amplification. The total number of valid DNA sequences obtained was 58 out of 63 samples collected. Once DNA sequences were obtained, species were identified after determining their genetic distance with a set of reference sequences (Tamura Nei model, with 1000 replicates in the bootstrap test) and phylogenetic reconstruction using a Neighbor-Joining tree. Fig. 2 shows the obtained trees for the Burgener fragment (464 bp) and C-CB fragment (100 bp) with all 58 commercial samples together with reference samples listed in Table 1. The trees show the bootstrap support of each branch for the clades obtained. Table 4 shows the global result of the FINS analysis. Additionally, to support these results a homology search using BLASTn with Megablast algorithm and default parameters was carried out with the DNA sequences obtained from market samples. The results of both analyses are listed in Table 3 and it can be observed that coherent results between the two approaches were found in all cases.

Table 4.

Commercial samples used in this study and FINS results.

Number of samples %
Total samples collected 63
Successfully identified samples 58 92.06
Identified as Engraulis encrasicolus 32 50.79
Identified as other than Engraulis encrasicolus 26 41.27
Identified as Engraulis anchoita 17 26.98
Identified as Engraulis ringens 8 12.70
Identified as Engraulis japonicus 1 1.58
Correctly labelled 49 84.48
Mislabelled 9 15.52
Open in a new tab

3.2. Labelling analysis and species substitution

58 commercial samples were successfully identified. Approximately half of them were identified as Engraulis encrasicolus, and the other species found were Engraulis anchoita, Engraulis ringens and Engraulis japonicus. Following the mentioned Spanish legislation (BOE, 2015; RD 1521, 1984), products with E. ringens, E. anchoita, E. japonicus and E. encrasicolus under the commercial name “Anchoas” were considered correctly labeled, but products under the commercial name “Anchoa” containing other than E. encrasicolus were considered mislabelled. In the cases where the scientific name was present, we considered mislabeled samples with a wrong scientific name, even when the commercial name declared was the generic “anchoas”. A total of 9 samples were mislabeled regarding species, making a 15.52% of the total samples analyzed (Table 4). Regarding the commercial brands, 8 of them had mislabeled samples, resulting a 19.05% of the total brands (Table 5). The most frequent substitution found was Engraulis anchoita, labelled as Engraulis encrasicolus or anchoa. This substitution was found in 7 cases. Engraulis anchoita, is imported frozen from Peru and Argentina (MAGRAMA, 2013), most probably at a lower price. Therefore, this is an example of economic fraud. In 2 out of these 7 cases, the label showed a mention to Cantabrian region.

Table 5.

Commercial brands tested in this study and FINS results.

Brand code sample code declared FINS result
1 AV1 Anchoas Engraulis anchoita
AV5 Engraulis encrasicolus Engraulis encrasicolus
2 AV2 Anchoas Engraulis anchoita
3 AV3 Anchoas Engraulis encrasicolus
4 AV4 Anchoas Engraulis encrasicolus
5 AV6 Anchoa Engraulis encrasicolus
AS6 Anchoa Engraulis encrasicolus
6 AV7 Engraulis anchoita Engraulis anchoita
AS8 Engraulis ringens Engraulis ringens
AM5 Engraulis anchoita Engraulis anchoita
7 AV8 Anchoa Engraulis anchoita
8 AV9 Engraulis ringens Engraulis encrasicolus
AM4 Engraulis spp failed
9 AV10 Engraulis ringens Engraulis ringens
AS2 Engraulis ringens Engraulis encrasicolus
AS5 Engraulis ringens Engraulis ringens
10 AV11 Engraulis ringens Engraulis ringens
AS3 Engraulis ringens Engraulis ringens
11 AV12 Anchoa Engraulis anchoita
AM8 Anchoas Engraulis anchoita
AB8 Anchoa Engraulis anchoita
12 AV13 Engraulis encrasicolus Engraulis encrasicolus
13 AV14 Engraulis encrasicolus Engraulis encrasicolus
14 AV15 Anchoa Engraulis encrasicolus
AS1 Anchoas Engraulis encrasicolus
AS4 Anchoas Engraulis ringens
15 AV16 Anchoas Engraulis encrasicolus
16 AV17 Anchoas Engraulis encrasicolus
17 AV18 Anchoas Engraulis encrasicolus
18 AV19 Anchoa Engraulis anchoita
AS13 Anchoa Engraulis encrasicolus
19 AV20 Engraulis encrasicolus Engraulis encrasicolus
20 AS16 Engraulis encrasicolus Engraulis encrasicolus
21 AS7 Anchoas Engraulis anchoita
AS9 Anchoas Engraulis anchoita
AM1 Anchoas Engraulis anchoita
22 AS10 Anchoas failed
AB7 Anchoas Engraulis ringens
23 AS11 Anchoas failed
AM13 Anchoas Engraulis japonicus
AB1 Anchoa Engraulis anchoita
24 AS12 Engraulis encrasicolus Engraulis encrasicolus
25 AS14 Engraulis encrasicolus Engraulis encrasicolus
26 AS15 Anchoas Engraulis encrasicolus
27 AS17 Anchoa Engraulis encrasicolus
AM9 Anchoa Engraulis encrasicolus
28 AM2 Anchoa Engraulis encrasicolus
29 AM3 Engraulis encrasicolus Engraulis encrasicolus
30 AM6 Engraulis encrasicolus Engraulis encrasicolus
31 AM10 Anchoas Engraulis anchoita
32 AM11 Anchoa Engraulis anchoita
33 AM12 Anchoas Engraulis ringens
34 AB2 Anchoa Engraulis encrasicolus
35 AB3 Anchoa Engraulis encrasicolus
AB9 Anchoa Engraulis encrasicolus
36 AB4 Anchoa Engraulis anchoita
37 AB5 Engraulis encrasicolus Engraulis encrasicolus
38 AB6 Anchoas Engraulis anchoita
39 AB10 Anchoa Engraulis encrasicolus
AB11 Anchoa Engraulis encrasicolus
40 AB12 Anchoas failed
41 AB13 Anchoas Engraulis encrasicolus
42 AB14 Anchoas failed
Open in a new tab

Another substitution found twice was Engraulis encrasicolus labelled as Engraulis ringens. This was quite unexpected, since the species Engraulis encrasicolus, the local species, is traditionally more appreciated by consumers and can also reach a higher price. One possible explanation is the low levels of biomass of the species Engraulis encrasicolus, which led the Authorities to close some fisheries on several years (ICES, 2010). This could represent an attempt to introduce over-quota catches by trading them as Engraulis ringens, whose distribution comprises the Eastern South Pacific, in the coasts of Peru and Chile (FAO, 2012). An accidental, genuine mistake is, of course, another probable reason.

The system adopted by Spanish legislation (BOE, 2015; RD 1521, 1984), that only allows to label as “Anchoa” products made of E. encrasicolus and “Anchoas” the other Engraulis species is very confusing and most consumers are not prepared for paying attention at that slight difference. The commercial name for preserved anchovies does not permit consumers to have an exact idea about the product they are buying. The European Commission recognizes also the commercial designation “anchoa” for Engraulis encrasicolus (http://mare.istc.cnr.it/site/engraulis_encrasicolus_cd.htm), but there is not such information for other Engraulis species. We therefore deem that legislation should be reviewed and adapted to the current situation of the processing industry (i.e. insufficient amounts of E. encrasicolus to meet the whole range of demand of anchovy products). It should be also adapted to the current needs of the market, as the number of anchovy species captured and traded has increased unceasingly since the last national specific legislation was issued (RD 1521, 1984).

Other works regarding seafood mislabelling have been reported all over the world focused in different species: rockfish (Logan et al., 2008), tuna from sushi in restaurants (Lowenstein et al., 2009) and red snapper (Marko et al., 2004) in the USA; cod (Miller and Mariani, 2010), hake (Machado-Schiaffino et al., 2008) and fish in pet food (Armani et al., 2015b) in Europe. All had rates of mislabelling higher than 20%. Despite our results reveal a lower level of mislabelling than the aforementioned, it could still be considered relatively high compared with other seafood products, such as gadoids (5,66%) in UK retailers (Helyar et al., 2014).

In this context, the relatively recent emergence on the market of the product named “Anchodina” (trademark registered by the company INKIELE S.L.), made with sardine (Sardina pilchardus) as raw material, should be mentioned. This product has an analogous elaboration process than semipreserved Anchovies, and it has also a very similar appearance, but uses a much cheaper raw material as fresh anchovy is 50% more expensive than fresh sardine (OPA-MAGRAMA, 2013). This eventually may lead to economic frauds if commercial names are not adequately used and regulated and consumers are consequently misled.

3.3. Labelling information in preserved anchovies

Typical labelling of this type of products is shown in Fig. 1. Most of the label is filled with mandatory information: commercial name, list of ingredients, company code, net and drained weights, conservation instructions and Best before Date, company name or code and batch number (not shown in Fig. 1). In imported products, the label should also reflect the country of origin (RD 1521, 1984; EU 1169, 2011). In this context, 3 samples were imported and showed the country of origin correctly in their labels: 2 from Peru and 1 from Morocco. All anchovy samples exhibited the complete mandatory information in their labels according to EU 1169, 2011 (Table 2).

Besides, labels sometimes include some non-mandatory additional information such as Nutritional Information (RD 930, 1992), or the absence of allergens, as it can also be seen in Table 2, the number of samples that present these pieces of non-mandatory information is variable: 100% of the samples gave nutritional information (which will be mandatory from December 2016) and 36.5% showed scientific names in the labels. Surprisingly, 25% of the samples indicate some link to a geographical location of the production (in this case Cantabria) but only 3% declared that the product was from Spain. Geographical location, such as “Cantabria”, is perceived by consumers as linked to high quality product for two reasons: species and process. Traditionally, the species Engraulis encrasicolus was seasonally captured by the artisanal fleet in the Cantabrian Sea, also the traditional preservation process was employed by the local industry, which led to great quality (MAGRAMA, 2013). Therefore, companies take profit of this cultural perception and rather indicate Cantabria than Spain in their labels.

However, the linkage to a geographical location or a particular type of process should be regulated and controlled, as in the case of quality labels for Protected Geographical Indication (PGI): in the case of Anchovies, such labelling authorization has not yet been approved, which forced the Spanish region of Cantabria to issue a regional normative to establish a quality label of Controlled Quality (CC) only for those manufactured in Cantabria with Engraulis encrasicolus (GAN 18, 2014).

In recent years, the decrease in the population of the Cantabrian Engraulis encrasicolus forced the limitation of captures (STECF, 2005) and even in some years the preventive closure of the fishery (EC 1116, 2006). The consequences of this limitation in raw material has resulted in the industry seeking other sources of anchovy, either from other close regions (Mediterranean) or even distant geographical locations (e.g. Asia, South America). Even provided that the product maintains its quality, consumers should still be informed on the species used, especially in the case of highly priced products. After this lockdown, anchovy stocks in the Gulf of Biscay have recovered, which led the authorities to allow a TAC (Total Allowable Catches) of 17,100 tons for Europe in 2013, 15,390 of which have been granted to Spain (EU 713, 2013).

In relation with the denomination of the product, in semipreserved anchovies, only the commercial names of the ingredients are mandatory (RD 1521, 1984). From that point of view, it was observed that all products exhibited the commercial name, and even a significant amount of the samples, 36.51%, provided extra-information by adding scientific names on their labels.

Labelling of Anchovies resulted ambiguous: up to three types of names were found in the market: “anchoas” (anchovies) (15.85% of the samples), “filetes de anchoa” (anchovy fillets) (44.4%) and “filetes de anchoas” (anchovies fillets) (39.7%); in addition, some brands added “of Cantabria”(23.8%). It is difficult for consumers to understand of the subtle differences among these commercial names. Besides, in some samples it was also possible to observe one name (“anchoa”) and the other (“anchoas”) in a different side of the package (23.8% of the samples).

4. Conclusions

In this work we have performed the first study to address the level of mislabelling of semipreserved anchovies in Spain, a European country: 15.52% of the analyzed samples were mislabelled, with the most frequent substitution being Engraulis anchoita sold as E. encrasicolus.

In light of our results, authors have also realized that there is some non-mandatory information presented in labels. Some of this extra information can be confusing since it does not follow clear rules, such a reference to a geographical location or the inclusion of scientific names. More specific regulation would be essential to harmonize when and how this information should be present in the labels.

Even more, authors consider that there is a need for more specific and updated pieces of legislation in Europe and particularly in Spain regarding the allowed commercial names for species in this type of products, in order to protect both consumers and fisheries.

Declarations

Author contribution statement

Amaya Velasco: Performed the experiments; Analyzed and interpreted the data; Wrote the paper.

Anxela Aldrey: Performed the experiments.

Ricardo I. Pérez-Martín: Contributed reagents, materials, analysis tools or data.

Carmen G. Sotelo: Conceived and designed the experiments; Analyzed and interpreted the data; Wrote the paper.

Competing interest statement

The authors declare no conflict of interest.

Funding statement

This work was supported by the European Union INTERREG Atlantic Area Program (‘LabelFish’, project 2011-1/163).

Additional information

No additional information is available for this paper.

Acknowledgments

Authors thank Stefano Mariani from University of Salford and Veronique Verrez from IFREMER for their useful and constructive comments.

References

  1. Armani A., Guardone L., La Castellana R., Gianfaldoni D., Guidi A., Castigliego L. DNA barcoding reveals commercial and health issues in ethnic seafood sold on the Italian market. Food Control. 2015;55:206–214. [Google Scholar]
  2. Armani A., Tinacci L., Xiong X., Castigliego L., Gianfaldoni D., Guidi A. Fish species identification in canned pet food by BLAST and Forensically Informative Nucleotide Sequencing (FINS) analysis of short fragments of the mitochondrial 16s ribosomal RNA gene (16S rRNA) Food Control. 2015;50:821–830. [Google Scholar]
  3. Bartlett S.E., Davidson W.S. FINS (forensically informative nucleotide sequencing): a procedure for identifying the animal origin of biological specimens. Biotechniques. 1992;12(3):408–411. [PubMed] [Google Scholar]
  4. BOE Resolución de 26 de febrero de 2015, de la Secretaría General de Pesca por la que se publica el listado de denominaciones comerciales de especies pesqueras y de acuicultura admitidas en España. Ministry of Agriculture, Food and Environment. Boletín Oficial del Estado. 2015;61:23220–23260. [Google Scholar]
  5. Bréchon A.L., Coombs S.H., Sims D.W., Griffiths A.M. Development of a rapid genetic technique for the identification of clupeid larvae in the Western English Channel and investigation of mislabelling in processed fish products. ICES Journal of Marine Science. 2013;2:399–407. [Google Scholar]
  6. Burgener M. University of Bern; Switzerland: 1997. Molecular species differentiation of fish and mammals. Ph. D. Thesis. [Google Scholar]
  7. Chapela M.J., Sotelo C.G., Pérez-Martín R.I., Pardo M.A., Gilardi P., Riese J. Comparison of DNA extraction methods from muscle of canned tuna for species identification. Food Control. 2007;18:1211–1215. [Google Scholar]
  8. Cohen N.J., Deeds J.R., Wong E.S., Hanner R.H., Yancy H.F., White K.D., Thompson T.M., Wahl M., Pham T.D., Guichard F.M., Huh I., Austin C., Dizikes G., Gerber S.I. Public health response to puffer fish (Tetrodotoxin) poisoning from mislabeled product. J. Food Protect. 2009;72(4):810–817. doi: 10.4315/0362-028x-72.4.810. [DOI] [PubMed] [Google Scholar]
  9. EC 1116 . 2006. Commission Regulation (EC) No 1116/2006 of 20 July 2006 prohibiting fishing for anchovy in ICES Sub-area VIII. [Google Scholar]
  10. EU 713 . 2013. Council Regulation (EU) No 713/2013 of 23 July 2013 establishing the fishing opportunities for anchovy in the Bay of Biscay for the 2013/14 fishing season. [Google Scholar]
  11. Everstine K., Spink J., Kennedy S. Economically Motivated Adulteration (EMA) of Food: Common Characteristics of EMA incidents. J. Food Protect. 2013;76:723–735. doi: 10.4315/0362-028X.JFP-12-399. [DOI] [PubMed] [Google Scholar]
  12. FAO . Cupleid Fishes of the world; 1988. FAO Fisheries Synopsis No. 125, Volume 7, Part 2. [Google Scholar]
  13. FAO . FAO Fisheries and Aquaculture Department; 2012. The State of World Fisheries and Aquaculture. [Google Scholar]
  14. FAO . FAO Fisheries and Aquaculture Department; 2014. The State of World Fisheries and Aquaculture. [Google Scholar]
  15. Griffiths A.M., Sotelo C.G., Mendes R., Pérez-Martín R.I., Schröder U., Shorten M. Current methods for seafood authenticity testing in Europe: Is there a need for harmonisation? Food Control. 2014;45(C):1–6. [Google Scholar]
  16. Hall T.A. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999;41:95–98. [Google Scholar]
  17. Helyar S.J., Lloyd H.A.D., de Bruyn M., Leake J., Bennett N., Carvalho G.R. Fish Product Mislabelling: Failings of Traceability in the Production Chain and Implications for Illegal, Unreported and Unregulated (IUU) Fishing. PLoS ONE. 2014;9(6) doi: 10.1371/journal.pone.0098691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hold G.L., Russell V.J., Pryde S.E., Rehbein H., Quinteiro J., Vidal R., Rey-Mendez M., Sotelo C.G., Pérez-Martín R.I., Santos A.T., Rosa C. Development of a DNA-based method aimed at identifying the fish species present in food Products. J. Agr. Food Chem. 2001;49:1175–1179. doi: 10.1021/jf001149x. [DOI] [PubMed] [Google Scholar]
  19. ICES . ICES CM 2010/ACOM:16.; Vigo, Spain: June 2010. Report of the Working Group on Anchovy and Sardine (WGANSA), 24-28 June 2010; p. 290. [Google Scholar]
  20. Jacquet J.L., Pauly D. Trade secrets: Renaming and mislabeling of seafood. Marine Policy. 2008;32:309–318. [Google Scholar]
  21. Jérôme M., Lemaire C., Verrez-Bagnis V., Etienne M. Direct sequencing method for species identification of canned sardine and sardine-type products. J. Agr. Food Chem. 2003;51(25):7326–7332. doi: 10.1021/jf034652t. [DOI] [PubMed] [Google Scholar]
  22. Jérôme M., Martinsohn J.T., Ortega D., Carreau P., Verrez-Bagnis V., Mouchel O. Towards fish and seafood traceability: anchovy species determination in fish products by molecular markers and support through a public domain database. J. Agr. Food Chem. 2008;56:3460–3469. doi: 10.1021/jf703704m. [DOI] [PubMed] [Google Scholar]
  23. Kumar S., Dudley J., Nei M., Tamura K. MEGA: A biologist-centric software for evolutionary analysis of DNA and protein sequences. Brief. Bioinform. 2008;9:299–306. doi: 10.1093/bib/bbn017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Logan C.A., Alter S.E., Haupt A.J., Tomalty K., Palumbi S.R. An impediment to consumer choice: Overfished species are sold as Pacific red snapper. Biol. Conserv. 2008;141:1591–1599. [Google Scholar]
  25. Lowenstein J.H., Amato G., Kolokotronis S.-O. The Real maccoyii: Identifying Tuna Sushi with DNA Barcodes - Contrasting Characteristic Attributes and Genetic Distances. PLoS ONE. 2009;4(11):e7866. doi: 10.1371/journal.pone.0007866. 10.1371/journal.pone.0007866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Machado-Schiaffino G., Martínez J.L., García-Vázquez E. Detection of mislabeling in hake seafood employing mtSNPs-based methodology with identification of eleven hake species of the genus Merluccius. J. Agr. Food Chem. 2008;56:5091–5095. doi: 10.1021/jf800207t. [DOI] [PubMed] [Google Scholar]
  27. Marko P.B., Lee S.C., Rice A.M., Gramling J.M., Fitzhenry T.M., McAlister J.S., Harper G.R., Moran A.L. Fisheries: mislabelling of a depleted reef fish. Nature. 2004;15(430 (6997)):309–310. doi: 10.1038/430309b. [DOI] [PubMed] [Google Scholar]
  28. Miller D.D., Mariani S. Smoke, mirrors: and mislabeled cod: poor transparency in the European seafood industry. Frontiers in Ecology and the Environment. 2010;8:517–521. [Google Scholar]
  29. MAGRAMA . Secretaría General de Pesca, Government of Spain; 2013. Ministerio de Agricultura, Alimentación y Medio Ambiente (MAGRAMA) 2013 El mercado de la anchoa. [Google Scholar]
  30. OPA-MAGRAMA . Ministerio de Agricultura, Alimentación y Medio Ambiente; 2013. Memoria anual de actividades del Observatorio de Precios de los Alimentos; p. 22. [Google Scholar]
  31. GAN 18 . 2014. Order GAN/18/2014 of April 7th, which approves the technical rules for the use of the quality label CC Calidad Controlada for semipreserved anchovy fillets in oil. [Google Scholar]
  32. Quinteiro J., Sotelo C.G., Rehbein H., Pryde S.E., Medina I., Pérez-Martín R.I., Rey-Méndez M., Mackie I.M. Use of mtDNA Direct Polymerase Chain Reaction (PCR) Sequencing and PCR-Restriction Fragment Length Polymorphism Methodologies in Species Identification of Canned Tuna. J. Agr. Food Chem. 1998;46:1662–1669. [Google Scholar]
  33. Rasmussen Hellberg R.S., Morrissey M.T. Advances in DNA-based techniques for the detection of seafood species substitution on the commercial market. J. Lab. Autom. 2011;16:308–321. doi: 10.1016/j.jala.2010.07.004. [DOI] [PubMed] [Google Scholar]
  34. EU 1169 . 2011. Regulation (EU) No 1169/2011 of the European Parliament and of the Council of 25 October 2011 on the provision of food information to consumers, amending Regulations (EC) No 1924/2006 and (EC) No 1925/2006 of the European Parliament and of the Council, and repealing Commission Directive 87/250/EEC, Council Directive 90/496/EEC, Commission Directive 1999/10/EC, Directive /13/EC of the European Parliament and of the Council, Commission Directives 2002/67/EC and 2008/5/EC and Commission Regulation (EC) No 608/2004 Regulation (EU) No. 1379/2013 of the European Parliament and of the Council of 11 December 2013 on the common organisation of the markets in fishery and aquaculture products, amending Council Regulations (EC) No 1184/2006 and (EC) No 1224/2009 and repealing Council Regulation (EC) No 104/2000. [Google Scholar]
  35. RD 1521 . 1984. Royal Decree of August 28th on the technical-health regulations of establishments and fishery and aquaculture products for human consumption. [Google Scholar]
  36. RD 930 . 1992. Royal Decree of July 17th which approves the rule on labelling of nutritional properties of food products. [Google Scholar]
  37. Santaclara F.J., Cabado A.G., Vieites J.M. Development of a method for genetic identification of four species of anchovies: E. encrasicolus, E., anchoita, E. ringens and E. japonicus. Eur. Food Res. Technol. 2006;223:609–614. [Google Scholar]
  38. Sebastio P., Zanelli P., Neri T.M. Identification of anchovy (Engraulis encrasicholus L.) and gilt sardine (Sardinella aurita) by Polymerase Chain Reaction, sequence of their mitochondrial Cytochrome b gene, and restriction analysis of Polymerase Chain Reaction products in semipreserves. J. Agr. Food Chem. 2001;49(3):1194–1199. doi: 10.1021/jf000875x. [DOI] [PubMed] [Google Scholar]
  39. STECF . SEC 266; Brussels: 2005. STECF Commission of the European Communities, Report of the scientific, technical and economic committee for fisheries, Review of scientific advice for 2005. [Google Scholar]

Articles from Heliyon are provided here courtesy of Elsevier

RESOURCES