Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2016 Jul 15.
Published in final edited form as: Dev Dyn. 2012 Jan 25;241(3):553–562. doi: 10.1002/dvdy.23738

Drosophila lilliputian is required for proneural gene expression in retinal development

Ginnene M DiStefano 1, Andrew J Gangemi 1, Preeti J Khandelwal 1, Aleister J Saunders 1,2,3, Daniel R Marenda 1,3,*
PMCID: PMC4946344  NIHMSID: NIHMS348220  PMID: 22275119

Abstract

Background

Proper neurogenesis in the developing Drosophila retina requires the regulated expression of the basic helix-loop-helix (bHLH) proneural transcription factors Atonal (Ato) and Daughterless (Da). Factors that control the timing and spatial expression of these bHLH proneural genes in the retina are required for the proper formation and function of the adult eye and nervous system.

Results

Here, we report that lilliputian (lilli), the Drosophila homolog of the FMR2/AF4 family of proteins regulates the transcription of ato and da in the developing fly retina. We find that lilli controls ato expression at multiple enhancer elements. We also find that lilli contributes to ato auto-regulation in the morphogenetic furrow by first regulating the expression of da prior to ato. We show that FMR2 regulates the ato and da homologs MATH5 and TCF12 in human cells, suggesting a conservation of this regulation from flies to humans.

Conclusions

We conclude that lilliputian is part of the genetic program that regulates the expression of proneural genes in the developing retina.

Keywords: Drosophila, Lilliputian, lilli, FMR2, FRAXE, Fragile X, MATH5, TCF12, atonal, daughterless

Introduction

Proper retinal development requires the formation of multiple distinct neuronal cell types in the developing retina. These cells develop from a population of undifferentiated precursor cells through inductive signaling events that are spatially and temporally regulated. Undifferentiated cells must first undergo neurogenesis, in which a cell switches from an undifferentiated cycling neural progenitor to a committed neural precursor cell with a limited replicative potential (Powell and Jarman, 2008). In all animals, basic helix-loop-helix (bHLH) proneural transcription factors are critical for this step, and their functions are highly conserved across phyla (Powell and Jarman, 2008). The proneural gene atonal (ato) is one of the most highly conserved bHLH proneural transcription factors in animal eye development, and is required for the proper development of the first retinal neural cell type in flies, the R8 photoreceptor cells (Jarman et al., 1993; Jarman et al., 1994; Jarman et al., 1995). In vertebrates, ato orthologs (MATH5/Ath5/Atoh7) are required for the proper development of the first retinal neural cells types as well, the retinal ganglion cells (Brown et al., 1998; Brown et al., 2001; Wang et al., 2001; Hsiung and Moses, 2002). Thus, a better understanding of which factors regulate the timing and spatial expression of ato during development can lead to a better understanding of the development of the retina in multiple species.

We recently described the discovery of novel regulators of ato in the developing fly retina (Melicharek et al., 2008). In this screen, we identified two novel mutant alleles in the transcription factor lilliputian (lilli) as enhancers of a loss of function ato eye phenotype (Melicharek et al., 2008). The Lilli protein is the only member of the FMR2/AF4 protein family found in flies, and shares a high degree of identity and homology with human FMR2, including homology within the putative transactivation region (Tang et al., 2001; Wittwer et al., 2001; Gu and Nelson, 2003). Mutation in FMR2/AF4 gene family members are involved in both acute lymphoblastic leukemia and FRAXE non-syndromic X-linked mental retardation syndrome (Gu et al., 1996; Gu and Nelson, 2003).

Mutations in lilli affect a variety of cellular processes, including the establishment of a functional cytoskeleton during embryonic cellularization, embryonic pair-rule gene expression, and cell growth (Tang et al., 2001; Wittwer et al., 2001; Vanderzwan-Butler et al., 2007). Expression of the early zygotic genes serendipity α, fushi tarazu, and huckebein are all reduced in mutant lilli embryos (Tang et al., 2001), with Lilli regulating fushi tarazu in a Runt-dependant manner (Vanderzwan-Butler et al., 2007). In the developing Drosophila eye and wing, loss-of-function mutations in lilli decrease the size of photoreceptor cells and wing bristles without significantly affecting their morphology (Tang et al., 2001; Wittwer et al., 2001). In addition, mutations in lilli have been isolated in a number of genetic screens that have implicated lilli function in the transforming growth factor-β and Ras/Raf/MAPK signal transduction pathways (Dickson et al., 1996; Su et al., 2001). Loss-of-function lilli mutants genetically enhance embryonic loss-of-function phenotypes of both decapentaplegic and screw alleles (Su et al., 2001). In the developing eye, lilli loss-of-function mutants were identified as genetic enhancers of the rough eye phenotype associated with FGF overexpression (Zhu et al., 2005), Delta expression (Shalaby et al., 2009), and as an enhancer of aggregate formation in eyes expression mutant Huntington protein (Zhang et al., 2010). lilli mutants have also been recovered as suppressors of the rough eye phenotype associated with Raf overexpression (Dickson et al., 1996; Wittwer et al., 2001), Phyllopod overexpression (Tang et al., 2001), and Senseless overexpression (Pepple et al., 2007). Taken together, these data suggest a broad requirement for lilli gene function in a variety of tissues.

Here, we report that lilli is a positive regulator of proneural gene transcription in the developing fly retina. We show that lilli regulates both ato and daughterless (da) expression in the developing fly retina, and that it does so through different mechanisms at the 5′ and 3′ ato enhancer elements. Our analysis suggests that lilli may regulate the 3′ ato enhancer at multiple locations, and that this regulation is independent of Da expression. Alternately, at the 5′ enhancer, lilli function is first required for Da protein expression upstream of Ato, and may be required for ato auto-regulation at this enhancer. Further, we show that FMR2 (one of the human homologs of lilli) regulates ato and da homologs MATH5 and TCF12 in human cells, suggesting a conservation of this regulation outside of the fly retina.

Results

Lilliputian is required for atonal transcriptional regulation at multiple enhancers

We had previously identified lilli in a genetic screen meant to isolate novel regulators of ato function in the developing fly retina (Melicharek et al., 2008). We had isolated two loss-of-function mutations in lilli (lilliGD17 and lilliAG5) both of which dominantly enhance a loss-of-function ato mutant eye phenotype (compare Figure 1B to 1C). To rule out any effects of genetic background, we also analyzed whether lilli mutants can rescue a second ato loss-of-function genetic background (atots/ato1, Supplemental Figure 1A). We found that both lilliGD17 and lilliAG5 significantly enhance this ato loss-of-function genetic background as well (Supplemental Figure 1B).

Figure 1. Lilli regulates Ato expression in the developing retina.

Figure 1

Open in a new tab

(A-C) Stereomicroscope pictures of adult compound eyes, anterior right, dorsal up, same magnification. Genotypes are listed in lower right of each panel. (A) Wild type Drosophila eye. (B) Adult eye from trans-heterozygous ato loss-of-function genotype atots/Df(3R)p13 (a deficiency which completely removes the ato gene). This fly was raised at 25°C. (C) Heterozygous lilliGD17 / +; atots/ Df(3R)p13 shows a dominant enhancement of the ato small eye phenotype. (D-F) Third instar larval retinas, anterior right. (D) Wild type Ato protein expression. Arrow indicates beginning of Ato expression at the morphogenetic furrow. Asterisk denotes intermediate groups. Arrowhead denotes single R8 photoreceptor nucleus. (E-F) show lilliGD17 homozygous mutant clones marked by the absence of GFP (green). lilli mutant tissue is marked by white boundaries in each panel. (E) Ato protein expression is shown in red. Note decreased Ato expression within lilliGD17 mutant tissue. (F) Ato protein expression (white) from panel (E). (G) Average pixel density of Ato protein. Ato protein is significantly reduced within homogyzous lilliGD17 clones (grey column) compared to internal control cells (black column). *P<0.0001 Student’s t-test.

Both alleles of lilli obtained from our screen are homozygous lethal. In order to rule out effects of secondary mutations on our observed phenotypes, we utilized a UAS:lilli transgene that has been previously shown to express wild type Lilli protein, and to rescue the lethality associated with other homozygous loss-of-function lilli mutants (Tang et al., 2001). Though this transgene is under the inducible expression of the Gal4/UAS system, we found that the presence of the UAS:lilli transgene alone was sufficient to rescue the lethality associated with both homozygous lilliGD17 and lilliAG5 flies. We were also able to rescue the lethality associated with lilliGD17 and other loss-of-function alleles, including lilliGD17/ lilliAG5, lilliGD17/ lilliXS575, and lilliGD17/ lilliXS407. These data demonstrate that the lilliGD17 mutation is the only lethal mutation within this homozygous background. Further, because lethality from the trans-heterozygous lethal lilli mutant combinations are also rescued, this suggests that the rescue is happening at the lilli locus. We conclude that genetic rescue of lethal lilli mutants is due to leaky (uninduced) expression of wild type Lilli protein from the UAS:lilli locus. We then determined if this transgene could rescue the enhancement we observe from lilli mutants in the ato loss-of-function phenotype. We observed that one copy of the UAS:lilli transgene significantly rescued the enhancement normally observed in this genetic background (Supplemental Figure 1C). Taken together, these data suggest that it is lilli function specifically that enhances the ato loss-of-function phenotype, as opposed to secondary effects of genetic background.

By using a β-Galactosidase reporter for lilli expression (lilli00632), we determined that lilli is ubiquitously expressed in the third instar larval retina (Supplemental Figure 1D). Based on this expression, we derived loss-of-function homozygous somatic mutant clones in this tissue using the FLP/FRT technique (Xu and Rubin, 1993) in order to further understand the role of the lilli gene in the regulation of ato expression in this tissue. Ato protein is normally expressed in a broad stripe anterior to the morphogenetic furrow in the developing fly retina (arrow in Figure 1D). This expression is then refined to small clusters of roughly 20 cells, the ‘intermediate groups’ (asterisk in Figure 1D)(Jarman et al., 1995). Finally, Ato expression is refined to single cells, the future R8 photoreceptor cells (arrowhead in Figure 1D)(Jarman et al., 1995; Baker et al., 1996). In clones of cells deficient for lilli function (Figures 1, E-F), we find that Ato protein expression is dramatically reduced. Interestingly, within these clones, Ato expression is most significantly reduced in both the broad expression pattern anterior to the furrow (arrow in Figure 1E), and within the ‘intermediate groups’ within the furrow. Ato expression in single R8 nuclei is only modestly reduced (arrowhead in Figure 1E). Overall, we observed a 50.27% (±5.92) reduction in total Ato protein expression within lilli mutant clones compared to internal controls (Figure 1G). Ato protein expression was also similarly reduced in clones of cells mutant for other lilli alleles including lilliXS407, lilliXS575, lilliS35 and lilliAG5 (Supplemental Figure 2). These data suggest that lilli gene function is required for normal Ato protein expression in the developing fly retina.

Mammalian FMR2 has been shown to possess transcriptional activation potential (Hillman M., 2001), and Drosophila Lilli has been shown to regulate the transcription of the pair rule gene fushi tarazu (Vanderzwan-Butler et al., 2007). Based on these data, we examined the requirement for lilli gene function in the regulation of ato transcription. We utilized two well established atonal-lacZ (ato-lacZ) reporters: 3′F:5.8 and 5′F:9.3(Sun et al., 1998). 5′F:9.3 (5′ ato-lacZ) contains a 9.3 kb fragment upstream of the ato open reading frame fused to the lacZ reporter, and directs β-Galactosidase expression in the pattern corresponding to the intermediate groups and single R8 cells (Sun et al., 1998). 3′F:5.8 (3′ ato-lacZ) contains a 5.8 kb fragment downstream of the ato open reading frame fused to the lacZ reporter, and directs β-Galactosidase expression in the initial Ato expression pattern corresponding to the broad stripe of expression anterior to the furrow (Sun et al., 1998). Within lilli mutant clones, we find that ato transcription, as reported by these reagents, is significantly reduced (Figure 2). ato transcription is most severely affected in the broad stripe correlating to the 3′ ato regulatory region (Figures 2C-D), which is reduced to 21.72% (±2.92) of internal control expression (Figure 2G). This is consistent with what we observed for Ato protein expression within these clones as well (Figure 1). ato transcription from the 5′ enhancer is also significantly reduced (Figures 2E-F), but only to 59.95% (±5.88) of internal control expression (Figure 2G). Taken together, these data suggest that lilli function is required at both the 3′ and 5′ ato regulatory elements, although to different extents.

Figure 2. Lilli regulates ato transcription in the developing retina.

Figure 2

Open in a new tab

(A-F) Third instar larval retinas, anterior right. Loss of GFP indicates homozygous somatic lilliGD17mutant tissue in C and E. (A-B) Wild type β-galactosidase protein expression directed by the 5′ enhancer element of ato (A) and the 3′ enhancer element of ato (B). (C-D) β-galactosidase protein expression directed by the 3′ enhancer element of ato in lilli mutant clones. Note significant reduction of β-galactosidase protein (red in C) compared to internal controls. (D) β-galactosidase expression (white) from panel (C). (E-F) β-galactosidase protein expression directed by the 5′ enhancer element of ato. Note significant reduction of β-galactosidase protein (red in E) compared to internal controls. (F) β-galactosidase expression (white) from panel (E) (G) Average pixel intensity of β-galactosidase protein. Significant reduction of β-galactosidase within lilliGD17 clones at the 3′ and 5′ elements compared to internal control cells. *P<0.005 Student’s t-test.

A core 348 bp sequence within the 3′ enhancer element is necessary and sufficient to promote ato expression within the developing eye disc (Zhang et al., 2006). We therefore tested the requirement for lilli function to regulate ato expression from this minimal fragment. Within lilli mutant clones, we find that ato transcription driven by the 348 bp fragment is also significantly reduced (Figure 3), to 55.27% (±6.60) of internal control expression (Figure 3E). When we normalize the expression of β-Galactosidase at both the 3′ and 348 bp enhancer elements, we find that the level of lilli-mediated ato regulation at the 348 bp fragment is different from the requirement for lilli-mediated ato regulation at the larger 3′ enhancer element (Figure 3E), suggesting that lilli may be regulating ato expression at multiple sites along the length of the 3′ enhancer element in addition to the 348 bp sequence. However, different cis-regulatory elements surrounding the 348 bp and larger 3′ enhancer elements may also have an effect on the differential regulation we observe at each of these elements.

Figure 3. Lilli regulates ato transcription from a minimal 348 bp enhancer in the developing retina.

Figure 3

Open in a new tab

(A-D) Third instar larval retinas, anterior right. Loss of GFP indicates homozygous somatic lilliGD17mutant tissue. Clone boundaries are outlined in white. (A) β-galactosidase protein expression directed by a minimal 348 bp 3′ enhancer element in wild type retina. (B) β-Galactosidase expression directed by a minimal 348 bp 3′ enhancer region in lilliGD17 homozygous somatic mutant clones. Note significant reduction of β-galactosidase protein (red in B) compared to internal controls. (C) GFP expression (white) from panel (B). (D) β-Galactosidase expression (white) from panel (B). (E) Average pixel intensity of β-galactosidase protein (left). Note significant reduction of β-Galactosidase at the 348bp 3′ enhancer in lilliGD17 mutant clones compared to internal control cells. Normalized pixel intensity (right) shows a greater reduction of β-Galactosidase protein expression at the larger 3′ enhancer element than compared to the 348bp 3′ enhancer element. *P<0.0001 Student’s t-test.

Lilliputian is required for daughterless and atonal auto-regulation

The Ato protein binds to Daughterless, the sole type I bHLH transcription factor in flies, to form functional heterodimers to regulate target gene expression (Kophengnavong et al., 2000; Massari and Murre, 2000; Smith and Cronmiller, 2001). In the developing retina, Da protein is ubiquitously expressed (Figure 4A), is upregulated within the morphogenetic furrow, and is required for proper R8 photoreceptor differentiation (Brown et al., 1996). ato auto-regulates its expression through the 5′ 9.3 kb enhancer region, thus sustaining its expression in the intermediate groups and single R8s (Sun et al., 1998). We we have shown that da function is required at this enhancer for ato expression (Melicharek et al., 2008). Because both Ato protein expression and transcription from the 5′ ato regulatory element are decreased, but not absent within lilli mutant clones, we hypothesized that Lilli may regulate ato expression indirectly, perhaps by affecting ato auto-regulation at this transcriptional regulatory site. As Da is required for Ato function, and the ability of Ato to auto-regulate at this enhancer region, we analyzed the expression of Da in lilli mutant clones in the developing retina. Within lilli mutant clones, Da protein expression was significantly reduced (Figures 4B-C), to 51.48% (±4.14) of internal control expression (Figure 4G), suggesting that lilli function is required to regulate da expression as well as ato in this tissue.

Figure 4. Lilli regulates Da transcription in the developing retina.

Figure 4

Open in a new tab

(A-F) Third instar larval retinas, anterior right. Loss of GFP indicates homozygous somatic lilliGD17mutant tissue. (A) Wild type Da protein expression in the developing retina. (B-C) Da protein expression in lilliGD17mutant tissue. Arrow indicates reduced Da expression in lilliGD17 mutant tissue. Clone boundaries are outlined in white. (C) Da protein expression (white) from panel (B). (D) Normal β-Galactosidase protein (representing da gene transcription) from the G32 enhancer region in wild type retinas. (E-F) β-Galactosidase expression in lilliGD17 mutant tissue. Arrow indicates reduced β-Galactosidase expression in lilliGD17 mutant tissue. (F) β-Galactosidase expression (white) from panel (E). (G) Average pixel intensity of Da protein (left) and β-galactosidase protein (right). Note significant reduction of both Da protein and β-Galactosidase protein in lilliGD17 mutant clones compared to internal control cells. *P<0.0001 Student’s t-test.

We then analyzed da transcription from the da G32 enhancer (Smith and Cronmiller, 2001). Analysis of β-Galactosidase expression as driven by G32 shows that da transcription is also ubiquitous in the developing retina as well (Figure 4D). Within lilli mutant clones, we found that da transcription from the G32 enhancer is also strongly reduced (arrows in Figures 4E-F), to 41.00% (±2.74) of internal control expression (Figure 4G). We found a domain specific difference in the G32-driven da expression in lilli clones posterior to the furrow as compared to lilli mutant clones within the furrow. For clones near the posterior of the eye disc, we found that G32-driven da expression was reduced to 27.99% (±6.16) of internal controls, while G32-driven da expression was reduced to 44.93% (±2.50) of internal controls within the furrow itself. Taken together, these data suggest that lilli gene function is required for da transcription in the developing retina in a domain specific fashion.

To test whether the decreased Da expression within lilli mutant clones affected the ability of Ato to auto-regulate at the 5′ enhancer region, we used the MARCM technique (Lee and Luo, 1999) to create lilli mutant clones that replaced the lost Da expression within these clones. We generated clones of lilli GD17 mutant tissues, that also contained UAS:Da (to replace Da expression normally lost in these clones) and either the 3′ ato-lacZ or the 5′ ato-lacZ reporters in the genetic background. We found no significant difference between the amount of Da protein within lilli mutant clones compared to Da protein outside of lilli clones (Figures 5B, 5F, 5I, p=0.272; Supplemental Figure 3E, p=0.761), suggesting that we are replacing Da protein expression to endogenous levels within these clones. We then analyzed the expression of the 3′ ato-lacZ within these clones. We found a significant reduction in the expression of 3′ ato-lacZ within these lilli mutant clones to 57.53 % (±6.0) of the normal 3′ ato-lacZ expression in internal controls outside of lilli mutant clones (Figures 5D, 5J). However, we observed no significant difference in the expression of the 5′ ato-lacZ enhancer within these clones (Figures 5H, 5J; p=0.446), compared to the expression of the 5′ ato-lacZ enhancer in internal control tissue outside of lilli mutant clones. Further, analysis of Ato protein expression within these clones shows that Ato expression is still significantly reduced in the 3′ region of the morphogenetic furrow (Supplemental Figures 3D, 5E). However, Ato protein expression is rescued to endogenous levels in the 5′ region (Figures 3D, 3E). Taken together, we suggest that these data demonstrate the following: 1) replacement of Da protein expression normally lost in lilli mutant tissue is sufficient to rescue 5′ ato-lacZ expression in lilli mutants, but is insufficient to rescue 3′ ato-lacZ expression in lilli mutants; 2) Da-mediated rescue of 5′ ato-lacZ in lilli mutants is due to auto-regulation of Ato expression at the 5′ enhancer element. The auto-regulation of ato expression at the 5′ enhancer element requires Lilli-mediated expression of da.

Figure 5. Replacement of Da protein in lilli clones rescues ato expression from the 5′ but not the 3′ ato enhancer element.

Figure 5

Open in a new tab

(A-H) Third instar larval retinas, anterior right. Presence of GFP indicates homozygous somatic lilliGD17mutant tissue that also expresses Da protein within the clone. Clone boundaries are outlined in white. (A) β-Galactosidase protein expression directed from the 3′ ato enhancer (blue) is significantly decreased within lilliGD17 mutant tissue marked by GFP (green), with replaced Da expression (red) in each clone. (B) Da expression (white) from panel (A). (C) GFP expression (white) from panel (A). (D) β-Galactosidase protein expression (white) from panel (A). (E-H) β-Galactosidase protein expression directed from the 5′ ato enhancer (blue) is not significantly decreased within lilliGD17 mutant tissue marked by GFP (green), with replaced Da expression (red) in each clone. (F) Da expression (white) from panel (A). (G) GFP expression (white) from panel (A). (H) β-Galactosidase protein expression (white) from panel (A). (I) Average pixel intensity of Da protein in clones expressing β-galactosidase protein under the 3′ ato enhancer (left), and the 5′ ato enhancer (right). No significant difference was observed in these clones. (J) Average pixel intensity of β-galactosidase protein under the 3′ ato enhancer (left), and the 5′ ato enhancer (right) in lilli mutant clones expressing Da protein. Note significant reduction of β-galactosidase protein expression in lilli mutant clones with 3′ ato enhancer expression (left, p=0.001). Not no significant reduction in β-galactosidase protein expression in lilli mutant clones with 5′ ato enhancer expression (right, p=0.109). Student’s t-test.

Regulation of both atonal and daughterless expression by lilliputian is conserved in fly antennae and human cells

lilli has been identified in multiple genetic screens in a broad number of different tissues. Further, the proneural genes ato and da are also expressed in multiple sensory tissues outside the fly retina. This led us to hypothesize that Lilli may regulate the expression of other genes in different areas of the developing retina, and may regulate the expression and function of proneural proteins in other tissues. To begin to examine this possibility, we analyzed the expression of both ELAV (an RNA binding protein expressed in post-mitotic photoreceptors posterior to the furrow), and Hairy (an inhibitory bHLH protein expressed ahead of the furrow). We found no significant difference in ELAV expression, or in the morphology and development of photoreceptors posterior to the furrow (Supplemental Figures 4A-B). However, we did observe decreased Hairy expression anterior to the furrow (Supplemental Figures 4C-D), suggesting that lilli also functions in proneural gene regulation outside of the morphogenetic furrow.

We created mutant lilli clones in the developing antenna, a sensory organ where both Ato and Da proteins are expressed and required for proper antennal function (Gupta and Rodrigues, 1997; Jhaveri et al., 2000). Within antennal clones, the expression of both Da and Ato protein is also reduced, though not absent (Supplemental Figures 5A-C). Ato expression is reduced to 38.25% (±8.8) of internal control expression, and Da expression is reduced to 38.02% (±5.9) of internal control expression (Supplemental Figure 5G).

To determine if our observations made in Drosophila were conserved in human cells, we utilized human HEK293 cells, as these cells are amenable to gene knockdown by RNAi, and also express a number of genes normally found in developing neuronal cell lineages (Shaw et al., 2002). We initially assayed these cells for mRNA expression of the human homologues of ato (MATH5/ATOH7), da (TCF12/HEB/HTF4/HsT17266), and lilliputian (FMR2/AFF2/FRAXE/MRX2/OX19) through reverse transcription PCR (RT-PCR). We found that human HEK293 cells express all of these genes (data not shown). We then performed gene knockdown by RNA interference (RNAi), again performed RT-PCR from these cells. We assayed the level of MATH5, TCF12, and FMR2 in these cells after FMR2 gene knockdown (Figure 6A). As a control for knockdown, we used a non-coding RNA (NC). As a control for cDNA loading and amplification we used Glyceraldehyde 3-phosphate dehydrogenase (GAPDH, a housekeeping gene unaffected by our RNAi treatment) and normalized all our expression data to this control.

Figure 6. Lilliputian homologue FMR2 regulates MATH5 and TCF12 in HEK 293 cells.

Figure 6

Open in a new tab

(A) RT-PCR analysis of human ato (MATH5), human da (TCF12), and human lilli (FMR2) after RNAi knockdown of FMR2 in HEK293 cells. NC is a non-coding RNA used for control, and represents endogenous levels of each gene transcript in these cells. GAPDH is a housekeeping gene whose expression is unaffected by our RNAi analysis, and is used as a loading control. (B) Average expression (densitometry) of three independent tests normalized to GAPDH. Note significant reduction in MATH5 and TCF12 expression after FMR2 RNAi. Error bars represent standard error. *P<0.05 Student’s t-test.

We observed a strong reduction in FMR2 levels after RNAi knockdown (Figure 6A). We also observed a significant decrease in both MATH5 and TCF12 mRNA levels as compared to mRNA levels in our NC control RNAi treatment (Figures 6A-B). Importantly, both MATH5 and TCF12 mRNA levels were decreased, but not completely absent upon FMR2 gene knockdown, consistent with what we have observed in lilli mutant clones in both the Drosophila retina and antenna. Taken together, our data suggests that Lilli-mediated transcriptional regulation of the proneural genes ato and da occurs within multiple Drosophila tissues, and is also conserved within human embryonic kidney cells.

Discussion

lilliputian and the regulation of proneural gene expression in the developing retina

We have shown here that lilliputian, the Drosophila homolog of the FMR2/AF4 family of proteins, regulates the transcription of the bHLH proneural genes atonal and daughterless in the developing retina and antenna of flies. We have further shown that this transcriptional regulation is conserved from flies to human cells.

Our data suggests that lilli regulates ato differentially at the 5′ and 3′ enhancer elements. The 3′ cis-regulatory element is a 1.2 kb region of DNA located approximately 3.1 kb downstream of the ato transcription unit, and controls the early phase of ato expression in the developing retina (Zhang et al., 2006). At this element, lilli appears to regulate transcription of ato at multiple sites. While analysis of transcription driven by the 5.8 kb element described in Sun et al. (Sun et al., 1998) is significantly reduced to less than 25% of controls, transcription driven by a minimal 348 bp enhancer element described in Zhang et al. (Zhang et al., 2006) and found within the larger 5.8 kb 3′ enhancer is only reduced to 55% of controls. An important question remains for lilli-mediated ato transcription: is lilli function required to directly induce ato expression, or rather to maintain expression once previously induced? Given its function as a transcriptional activator, lilli function may be directly required to turn on ato expression at the 348 bp enhancer element in the developing retina. However, lilli may also be required to maintain ato expression once activated by other factors (such as Sine oculis or Eyeless/Pax6) at this enhancer element (Zhang et al., 2006). Alternately, other cis-regulatory elements along the 5.8 kb enhancer region may require lilli function to modulate ato expression after activation. Further experimentation will be required to answer these questions.

Our data also shows that lilli-mediated regulation of ato expression at the 5′ enhancer region requires the expression of the Da protein. The Ato protein auto-regulates its expression at the 5′ enhancer region to sustain ato gene expression in the intermediate groups and single R8 photoreceptors (Sun et al., 1998). We hypothesize that the Lilli protein regulates ato expression indirectly, by affecting ato auto-regulation at the 5′ enhancer element. We base this hypothesis on multiple observations. 1) Ato protein expression and ato transcription from the 5′ enhancer element is decreased, but not absent within lilli mutant clones, consistent with an indirect effect on ato transcription. 2) Da protein expression and da transcription is also decreased, but not absent within lilli mutant clones in the region corresponding to the 5′ enhancer expression. 3) By replacing Da expression within lilli mutant clones, we can fully rescue ato transcription directed by the 5′ enhancer element, but not ato transcription directed by the 3′ enhancer element. This is also true for Ato protein expression in these clones. Thus, the Lilli protein must first induce da transcription in cells in the intermediate groups and R8s prior to ato expression within these cells. Then, Ato-Da heterodimers can form, and maintain the activation of ato expression within the intermediate groups and R8 cells. If lilli function is compromised, da expression decreases, as does ato’s ability to auto-regulate.

We have shown that lilli is required for the proper expression of hairy, another bHLH factor that is expressed anterior to the furrow. Hairy is an inhibitory factor to furrow progression. Interestingly, ato and da expression does not expand anteriorly in lilli clones, suggesting that loss of hairy anterior to the furrow is not sufficient to remove all of hairy function in these clones. Still, it is interesting that our analysis has identified a third bHLH factor regulated by lilli, and may suggest that Lilli protein functions broadly to regulate the expression of multiple bHLH factors in different tissues.

lilliputian and regulation of proneural gene expression in human disease

lilli is homologous to the AF4/FMR2 family of nuclear proteins in humans. This family includes FMR2, LAF4, AF4 and AF5Q31 (Gecz et al., 1996; Gu et al., 2002). Members of this family are implicated in acute lymphoblastic leukemia and FRAXE non-syndromic Fragile X mental retardation. We have shown that FMR2 also regulates the expression of the proneural genes MATH5 and TCF12 in HEK293 cells, showing that the observations we have made in the fly retina are conserved in human cells.

Patients with FRAXE exhibit various developmental and morphological problems, including mental retardation, delays in speech development, attention deficit disorder, hyperactivity, and impaired motor coordination (Murray et al., 1999; Gu and Nelson, 2003). While the etiology of these symptoms remains unknown, defects in neurogenesis, and/or the regulation of critical transcription factors such as the human homologues of Ato and Da may be related to these symptoms. Further, recent evidence has shown that Ato also functions as a tumor suppressor gene (Bossuyt et al., 2009a; Bossuyt et al., 2009b). This may provide an additional link between the misregulation of bHLH protein in lilli mutants and the leukemia observed in AF4 mutants. Further research is required to determine the significance of this connection.

Experimental Procedures

Drosophila stocks

Unless otherwise noted, all crosses were carried out at 25° on standard cornmeal–molasses–agar medium. BL number refers to Bloomington Stock Center stock number. Stocks used: lilliGD17 and lilliAG5 (Melicharek et al., 2008), lilliXS575 and lilliXS407 (Tang et al., 2001), lilliS35 (Neufeld et al., 1998), Df(3R)p13 (BL# 25779), ato1 (Jarman et al., 1994; Jarman et al., 1995), atonal-lacZ enhancer trap lines, both 5′ F:9.3 and 3′ F:5.8 are described in (Sun et al., 1998), 3′ato348-lacZ (Zhang et al., 2006), daUX , P{neo FRT} 40A (synonym da10, gift from C. Cronmiller, described in (Brown et al., 1996)), w; adv/cyo; UAS:lilliw+, a gift from Amy Tang, described in (Tang et al., 2001)), Da-Gal4.G32, gift from C. Cronmiller), lilli2L-193-35 (gift from Peter Gergen described in (VanderZwan-Butler et al., 2006), and lilli00632 (BL# 10944).

Mosaic clones

Mosaic clones were generated using ey:FLP (Berger et al., 2008), as described (Xu and Rubin, 1993). Flip stocks y−, w−, ey:FLP; Ubi-GFP, P{neoFRT}40A were crossed to the following stocks as appropriate to generate mutant clones:

  1. w ; lilliGD17 P{neo FRT} 40A

  2. w; lilliAG5 P{neo FRT} 40A

  3. w ; lilliXS575 P{neo FRT} 40A

  4. w ; lilliXS407 P{neo FRT} 40A

  5. w; lilliS35 P{neo FRT} 40A

  6. Atonal-lacZ (15 3′ F:5.8), lilliGD17 P{neo FRT} 40A

  7. Atonal-lacZ (13 5′ F: 9.3), lilliGD17 P{neo FRT} 40A

  8. Atonal-lacZ (15 3′ F:5.8), lilliAG5 P{neo FRT} 40A

  9. Atonal-lacZ (15 3′ F:5.8), lilliAG5 P{neo FRT} 40A

MARCM clones were generated as described (Lee and Luo, 1999; Wu and Luo, 2006). Flip stock y−, w−, hs:FLP, UAS:CD8-GFP; Tub-Gal80, P{neoFRT}40A; Tub-Gal4 / TM6B were crossed to(1) w−; lilliGD17 P{neoFRT}40A/TSTL; UAS:Da / TSTL and (2) Atonal-lacZ (13 5′ F: 9.3), lilliGD17 P{neo FRT} 40A/TSTL; UAS:Da / TSTL and (3) Atonal-lacZ (15 3′ F:5.8), lilliAG5 P{neo FRT} 40A/TSTL; UAS:Da / TSTL to generate MARCM retinas.

Immunohistochemistry and microscopy

Eye disc preparations were as described (Tio et al., 1994), mounted in Vectashield (Vector Laboratories, H-1000), and imaged by confocal microscopy using both a Nikon Eclipse TE2000-U and Olympus FluoView FV1000 laser- scanning confocal microscopes. Primary antibodies: guinea pig anti-Atonal (1:1000, described in (Melicharek et al., 2008)), mouse anti-Daughterless (1:40, gift of C. Cronmiller; described in(Brown et al., 1996)), and rabbit anti-β-galactosidase (1:1000, Cortex Biochem CA2190). Secondary antibodies were from Jackson ImmunoResearch: goat anti-mouse TRITC (1:150, 115-175-003), goat anti-guinea pig Cy5 (1:200), and goat anti-rabbit TRITC (1:250, 111-025-003).

Gene Knockdown and RT-PCR

Gene specific knockdown was carried out using the methods described by Zhang et al. (Zhang et al., 2007). Briefly, plasmid-based shRNA constructs were purchased from Open Biosystems (Birmingham, AL). The shRNA plasmids targeting FMR2 (RHS1764-9501785) or a negative control non-coding (NC) shRNA (RHS 1707) were transfected into naïve human embryonic kidney (HEK)-293 cells (ATCC). Prior to transfection, cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin. 50,000 naïve HEK293 cells were plated in each well of a six-well plate and 24 hours later, cells were individually transfected with shRNAs using Arrest-In transfection reagent (Open Biosystems, Inc.) following the manufacturers recommendations. Stably expressing shRNA clones were generated by selecting for cells able to grow in the presence of 2 μg/ml puromycin. Media was changed every one to two days until cell death was no longer detected. Three independent populations of puromycin resistant clones were detected five to seven days post-transfection. Total RNA was isolated from sub-confluent monolayers by washing cells with cold PBS and then utilizing RNeasy Mini Kit (Qiagen Inc.) to purify total RNA. cDNA was synthesized from this total RNA using N6 random primers and SuperScript II Reverse Transcriptase (Invitrogen). cDNA from FMR2 and control knockdown cells (n=3) was diluted 1:10 using RNase free water and PCRs were performed using MATH5, TCF12, FMR2, or GAPDH specific primers (MATH5 F: 5′-ggcccaggattctaaggatgcaat-3′,R: 5′-tcacccgaacagaaactcaca-3′; TCF12: F: 5′-acccatcctgggcttactgaaact-3′, R: 5′-tgctggcatcagctgagtgtagat-3′; FMR2 F: 5′-aactttgcaagtcccttggcttcg-3′, R: tgtcggccatatcccagtgttcat-3′; GAPDH F: atcatcagcaatgcctcct, R: gcagggatgatgttctggag). GAPDH was used as an internal control. PCR cycling conditions were an initial denaturation of 95C for 5 minutes, followed by 29 cycles of 95C for 30 seconds, 55C for 30 seconds, and 72C for 1 minute. Finally a 72C incubation for 10 minutes. The PCR products, 6 in total (3 for control knockdown and 3 for FMR2 knockdown) were separated by agarose gel electrophoresis in the presence of ethidium bromide. Correct amplification was confirmed by migration relative to a molecular weight standard. PCR products levels were visualized and quantified using a Fluorochem 8900 (Alpha Innotech). PCR product intensities were normalized to GAPDH levels. Errors bars represent normalized intensity standard error of the triplicate samples.

Supplementary Material

Supp Figure S1

Supplemental Figure 1. lilliputian mutants enhance atonal loss-of-function eye phenotype. (A-C) Stereomicroscope pictures of adult compound eyes, anterior right, dorsal up, same magnification. Genotypes are listed in lower right of each panel. All flies raised at 25°C. (A) Adult eye from trans-heterozygous ato loss-of-function genotype atots/ ato1. (B) lilliGD17 lilli mutants dominantly enhance this ato loss-of-function eye phenotype (lilliGD17/+; atots/ ato1). (C) Rescue of lilli enhancement of ato loss-of-function eye phenotype with gain-of-function UAS:lilli transgene (lilliGD17/+; UAS:lilli, ato1/atots). (D) Wild type lilli expression, as assayed by β-Galactosidase protein driven under endogenous lilli cis regulatory region (lilli00632).

Supp Figure S2

Supplemental Figure 2. Reduced Atonal expression in lilli mutant clones. (A-D) Third instar larval retinas, anterior right. Loss of GFP indicates homozygous somatic lilli mutant tissue. Clone boundaries are marked by white lines. (A) lillixs407 clones in the developing eye show reduced Ato expression (red). (B) Ato expression (white) from panel (A). (C) lilliS35 clones in the developing eye show reduced Ato expression (red). (D) Ato expression (white) from panel (C).

Supp Figure S3

Supplemental Figure 3. Reduced Ato protein expression in the leading edge of the morphogenetic furrow. (A-D) Third instar larval retinas, anterior right. Presence of GFP indicates homozygous somatic lilliGD17mutant tissue that also expresses Da protein within the clone. (A) Ato (blue), Da (red), and GFP (green) protein expression with replaced Da protein in lilliGD17mutant clones. Arrow indicates region controlled by the 3′ enhancer element. Arrowhead indicates region controlled by the 5′ enhancer element. (B) Da protein expression (white) from panel (A). Arrow denotes region controlled by the 5′ enhancer element from panel (A). (C) GFP expression (white) from panel (A). (D) Ato protein expression (white) from panel (A). Arrow indicates region controlled by the 3′ enhancer element. (E) Average pixel intensity of Da protein (left) and Ato protein expression (right). *P<0.05 Student’s t-test.

Supp Figure S4

Supplemental Figure 4. Lilliputian-mediated regulation of gene expression within the retina. (A-D) All eyes anterior right, late third larval instar. Loss of GFP indicates homozygous somatic lilli mutant tissue. (A) lilliGD17 clones in the developing eye show no reduction in Elav expression (red), and show no disrupted morphology of photoreceptor cells posterior to the furrow. (B) Elav expression (white) from panel (A). (C) lilliGD17 clones in the developing eye show reduced Hairy expression (red). (D) Hairy expression (white) from panel (C).

Supp Figure S5

Supplemental Figure 5. Lilli regulates Da and Ato expression in the developing Drosophila antenna . (A-C) Third instar larval antennal imaginal discs with lilliGD17 mutant clones. Loss of GFP (green) indicates homozygous mutant tissue. (A) Ato expression (blue), Da expression (red) and GFP expression (green) in mutant clones. Arrow denotes decreased Ato and Da expression. Arrowhead denotes normal expression levels in internal control cells. (B) Da expression (white) from panel (A). (C) Ato expression (white) from panel (A). (D) Average pixel intensity of Da (left) and Ato protein (right) shows significant reduction within lilliGD17 clones. *P<0.05 Student’s t-test.

Bullet Points/Key phrases.

  • Lilliputian regulates ato expression

  • Lilliputian regulates da expression

Acknowledgements

We would like to thank Claire Cronmiller for Daughterless antibodies and mutant stocks, Amy Tang and Ernst Hafen for lilliputian stocks, Hugo Bellen for MARCM stocks, The Iowa Hybridoma bank for antibodies, and the Bloomington Drosophila Stock Center for stocks. We would also like to thank the Marenda laboratory members for helpful comments on the manuscript. This work was supported by NIH grants R15EY018431 and R21RR026074 (to DRM).

Grant Information: NIH grants R15EY018431 and R21RR026074 (to DRM).

References

  1. Baker NE, Yu S, Han D. Evolution of proneural atonal expression during distinct regulatory phases in the developing Drosophila eye. Curr. Biol. 1996;6:1290–1301. doi: 10.1016/s0960-9822(02)70715-x. [DOI] [PubMed] [Google Scholar]
  2. Berger J, Senti KA, Senti G, Newsome TP, Asling B, Dickson BJ, Suzuki T. Systematic identification of genes that regulate neuronal wiring in the Drosophila visual system. PLoS Genet. 2008;4:e1000085. doi: 10.1371/journal.pgen.1000085. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bossuyt W, De Geest N, Aerts S, Leenaerts I, Marynen P, Hassan BA. The atonal proneural transcription factor links differentiation and tumor formation in Drosophila. PLoS Biol. 2009a;7:e40. doi: 10.1371/journal.pbio.1000040. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bossuyt W, Kazanjian A, De Geest N, Van Kelst S, De Hertogh G, Geboes K, Boivin GP, Luciani J, Fuks F, Chuah M, VandenDriessche T, Marynen P, Cools J, Shroyer NF, Hassan BA. Atonal homolog 1 is a tumor suppressor gene. PLoS Biol. 2009b;7:e39. doi: 10.1371/journal.pbio.1000039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brown NL, Kanekar S, Vetter ML, Tucker PK, Gemza DL, Glaser T. Math5 encodes a murine basic helix-loop-helix transcription factor expressed during early stages of retinal neurogenesis. Development. 1998;125:4821–4833. doi: 10.1242/dev.125.23.4821. [DOI] [PubMed] [Google Scholar]
  6. Brown NL, Paddock SW, Sattler CA, Cronmiller C, Thomas BJ, Carroll SB. daughterless is required for Drosophila photoreceptor cell determination, eye morphogenesis, and cell cycle progression. Dev Biol. 1996;179:65–78. doi: 10.1006/dbio.1996.0241. [DOI] [PubMed] [Google Scholar]
  7. Brown NL, Patel S, Brzezinski J, Glaser T. Math5 is required for retinal ganglion cell and optic nerve formation. Development. 2001;128:2497–2508. doi: 10.1242/dev.128.13.2497. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Dickson BJ, ven der Straten A, Domínguez M, Hafen E. Mutations modulating Raf signaling in Drosophila eye development. Genetics. 1996;142:163–171. doi: 10.1093/genetics/142.1.163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Gecz J, Gedeon AK, Sutherland GR, Mulley JC. Identification of the gene FMR2, associated with FRAXE mental retardation. Nat Genet. 1996;13:105–108. doi: 10.1038/ng0596-105. [DOI] [PubMed] [Google Scholar]
  10. Gu Y, McIlwain KL, Weeber EJ, Yamagata T, Xu B, Antalffy BA, Reyes C, Yuva-Paylor L, Armstrong D, Zoghbi H, Sweatt JD, Paylor R, Nelson DL. Impaired conditioned fear and enhanced long-term potentiation in Fmr2 knock-out mice. J Neurosci. 2002;22:2753–2763. doi: 10.1523/JNEUROSCI.22-07-02753.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Gu Y, Nelson DL. FMR2 function: insight from a mouse knockout model. Cytogenet Genome Res. 2003;100:129–139. doi: 10.1159/000072847. [DOI] [PubMed] [Google Scholar]
  12. Gu Y, Shen Y, Gibbs RA, Nelson DL. Identification of FMR2, a novel gene associated with the FRAXE CCG repeat and CpG island. Nat Genet. 1996;13:109–113. doi: 10.1038/ng0596-109. [DOI] [PubMed] [Google Scholar]
  13. Gupta BP, Rodrigues V. Atonal is a proneural gene for a subset of olfactory sense organs in Drosophila. Genes Cells. 1997;2:225–233. doi: 10.1046/j.1365-2443.1997.d01-312.x. [DOI] [PubMed] [Google Scholar]
  14. Hillman MGJ. Fragile XE-associated familial mental retardation protein 2 (FMR2) acts as a potent transcription activator. J Hum Genet. 2001;46:251–259. doi: 10.1007/s100380170074. [DOI] [PubMed] [Google Scholar]
  15. Hsiung F, Moses K. Retinal development in Drosophila: specifying the first neuron. Hum Mol Genet. 2002;11:1207–1214. doi: 10.1093/hmg/11.10.1207. [DOI] [PubMed] [Google Scholar]
  16. Jarman AP, Grau Y, Jan LY, Jan YN. atonal is a proneural gene that directs chordotonal organ formation in the Drosophila peripheral nervous system. Cell. 1993;73:1307–1321. doi: 10.1016/0092-8674(93)90358-w. [DOI] [PubMed] [Google Scholar]
  17. Jarman AP, Grell EH, Ackerman L, Jan LY, Jan YN. atonal is the proneural gene for Drosophila photoreceptors. Nature. 1994;369:398–400. doi: 10.1038/369398a0. [DOI] [PubMed] [Google Scholar]
  18. Jarman AP, Sun Y, Jan LY, Jan YN. Role of the proneural gene, atonal, in formation of the Drosophila chordotonal organs and photoreceptors. Development. 1995;121:2019–2030. doi: 10.1242/dev.121.7.2019. [DOI] [PubMed] [Google Scholar]
  19. Jhaveri D, Sen A, Reddy GV, Rodrigues V. Sense organ identity in the Drosophila antenna is specified by the expression of the proneural gene atonal. Mech Dev. 2000;99:101–111. doi: 10.1016/s0925-4773(00)00487-1. [DOI] [PubMed] [Google Scholar]
  20. Kophengnavong T, Michnowicz JE, Blackwell TK. Establishment of distinct MyoD, E2A, and twist DNA binding specificities by different basic region-DNA conformations. Mol Cell Biol. 2000;20:261–272. doi: 10.1128/mcb.20.1.261-272.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Lee T, Luo L. Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron. 1999;22:451–461. doi: 10.1016/s0896-6273(00)80701-1. [DOI] [PubMed] [Google Scholar]
  22. Massari ME, Murre C. Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Mol Cell Biol. 2000;20:429–440. doi: 10.1128/mcb.20.2.429-440.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Melicharek D, Shah A, DiStefano G, Gangemi AJ, Orapallo A, Vrailas-Mortimer AD, Marenda DR. Identification of Novel Regulators of Atonal Expression in the Developing Drosophila Retina. Genetics. 2008;180:2095–2110. doi: 10.1534/genetics.108.093302. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Murray A, Webb J, Dennis N, Conway G, Morton N. Microdeletions in FMR2 may be a significant cause of premature ovarian failure. J Med Genet. 1999;36:767–770. doi: 10.1136/jmg.36.10.767. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Neufeld TP, Tang AH, Rubin GM. A genetic screen to identify components of the sina signaling pathway in Drosophila eye development. Genetics. 1998;148:277–286. doi: 10.1093/genetics/148.1.277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Pepple KL, Anderson AE, Frankfort BJ, Mardon G. A Genetic Screen in Drosophila for Genes Interacting With senseless During Neuronal Development Identifies the Importin moleskin. Genetics. 2007;175:125–141. doi: 10.1534/genetics.106.065680. Epub 2006 Nov 2016. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Powell LM, Jarman AP. Context dependence of proneural bHLH proteins. Curr Opin Genet Dev. 2008;18:411–417. doi: 10.1016/j.gde.2008.07.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Shalaby NA, Parks AL, Morreale EJ, Osswalt MC, Pfau KM, Pierce EL, Muskavitch MA. A screen for modifiers of notch signaling uncovers Amun, a protein with a critical role in sensory organ development. Genetics. 2009;182:1061–1076. doi: 10.1534/genetics.108.099986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Shaw G, Morse S, Ararat M, Graham FL. Preferential transformation of human neuronal cells by human adenoviruses and the origin of HEK 293 cells. FASEB J. 2002:869–871. doi: 10.1096/fj.01-0995fje. [DOI] [PubMed] [Google Scholar]
  30. Smith JEr, Cronmiller C. The Drosophila daughterless gene autoregulates and is controlled by both positive and negative cis regulation. Development. 2001;128:4705–4714. doi: 10.1242/dev.128.23.4705. [DOI] [PubMed] [Google Scholar]
  31. Su M, Wisotzkey R, Newfeld S. A Screen for Modifiers of decapentaplegic Mutant Phenotypes Identifies lilliputian, the Only Member of the Fragile-X/Burkitt’s Lymphoma Family of Transcription Factors in Drosophila melanogaster. Genetics. 2001;157:717–725. doi: 10.1093/genetics/157.2.717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Sun Y, Jan LY, Jan YN. Transcriptional regulation of atonal during development of the Drosophila peripheral nervous system. Development. 1998;125:3731–3740. doi: 10.1242/dev.125.18.3731. [DOI] [PubMed] [Google Scholar]
  33. Tang AH, Neufeld TP, Rubin GM, Muller HA. Transcriptional regulation of cytoskeletal functions and segmentation by a novel maternal pair-rule gene, lilliputian. Development. 2001;128:801–813. doi: 10.1242/dev.128.5.801. [DOI] [PubMed] [Google Scholar]
  34. Tio M, Ma C, Moses K. spitz, a Drosophila homolog of transforming growth factor-α, is required in the founding photoreceptor cells of the compound eye facets. Mech. Dev. 1994;48:13–23. doi: 10.1016/0925-4773(94)90002-7. [DOI] [PubMed] [Google Scholar]
  35. Vanderzwan-Butler CJ, Prazak LM, Gergen JP. The HMG-box protein Lilliputian is required for Runt-dependent activation of the pair-rule gene fushi-tarazu. Dev Biol. 2007;301:350–360. doi: 10.1016/j.ydbio.2006.10.027. Epub 2006 Oct 2025. [DOI] [PubMed] [Google Scholar]
  36. Wang SW, Kim BS, Ding K, Wang H, Sun D, Johnson RL, Klein WH, Gan L. Requirement for math5 in the development of retinal ganglion cells. Genes Dev. 2001;15:24–29. doi: 10.1101/gad.855301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Wittwer F, van der Straten A, Keleman K, Dickson BJ, Hafen E. Lilliputian: an AF4/FMR2-related protein that controls cell identity and cell growth. Development. 2001;128:791–800. doi: 10.1242/dev.128.5.791. [DOI] [PubMed] [Google Scholar]
  38. Wu JS, Luo L. A protocol for mosaic analysis with a repressible cell marker (MARCM) in Drosophila. Nat Protoc. 2006;1:2583–2589. doi: 10.1038/nprot.2006.320. [DOI] [PubMed] [Google Scholar]
  39. Xu T, Rubin GM. Analysis of genetic mosaics in developing and adult Drosophila tissues. Development. 1993;117:1223–1237. doi: 10.1242/dev.117.4.1223. [DOI] [PubMed] [Google Scholar]
  40. Zhang C, Khandelwal PJ, Chakraborty R, Cuellar TL, Sarangi S, Patel SA, Cosentino CP, O’Connor M, Lee JC, Tanzi RE, Saunders AJ. An AICD-based functional screen to identify APP metabolism regulators. Mol Neurodegener. 2007;2:15. doi: 10.1186/1750-1326-2-15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Zhang S, Binari R, Zhou R, Perrimon N. A genomewide RNA interference screen for modifiers of aggregates formation by mutant Huntingtin in Drosophila. Genetics. 2010;184:1165–1179. doi: 10.1534/genetics.109.112516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Zhang T, Ranade S, Cai CQ, Clouser C, Pignoni F. Direct control of neurogenesis by selector factors in the fly eye: regulation of atonal by Ey and So. Development. 2006;133:4881–4889. doi: 10.1242/dev.02669. Epub 2006 Nov 4815. [DOI] [PubMed] [Google Scholar]
  43. Zhu MY, Wilson R, Leptin M. A screen for genes that influence fibroblast growth factor signal transduction in Drosophila. Genetics. 2005;170:767–777. doi: 10.1534/genetics.104.039750. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supp Figure S1

Supplemental Figure 1. lilliputian mutants enhance atonal loss-of-function eye phenotype. (A-C) Stereomicroscope pictures of adult compound eyes, anterior right, dorsal up, same magnification. Genotypes are listed in lower right of each panel. All flies raised at 25°C. (A) Adult eye from trans-heterozygous ato loss-of-function genotype atots/ ato1. (B) lilliGD17 lilli mutants dominantly enhance this ato loss-of-function eye phenotype (lilliGD17/+; atots/ ato1). (C) Rescue of lilli enhancement of ato loss-of-function eye phenotype with gain-of-function UAS:lilli transgene (lilliGD17/+; UAS:lilli, ato1/atots). (D) Wild type lilli expression, as assayed by β-Galactosidase protein driven under endogenous lilli cis regulatory region (lilli00632).

NIHMS348220-supplement-Supp_Figure_S1.tif (12MB, tif)
Supp Figure S2

Supplemental Figure 2. Reduced Atonal expression in lilli mutant clones. (A-D) Third instar larval retinas, anterior right. Loss of GFP indicates homozygous somatic lilli mutant tissue. Clone boundaries are marked by white lines. (A) lillixs407 clones in the developing eye show reduced Ato expression (red). (B) Ato expression (white) from panel (A). (C) lilliS35 clones in the developing eye show reduced Ato expression (red). (D) Ato expression (white) from panel (C).

NIHMS348220-supplement-Supp_Figure_S2.tif (2.9MB, tif)
Supp Figure S3

Supplemental Figure 3. Reduced Ato protein expression in the leading edge of the morphogenetic furrow. (A-D) Third instar larval retinas, anterior right. Presence of GFP indicates homozygous somatic lilliGD17mutant tissue that also expresses Da protein within the clone. (A) Ato (blue), Da (red), and GFP (green) protein expression with replaced Da protein in lilliGD17mutant clones. Arrow indicates region controlled by the 3′ enhancer element. Arrowhead indicates region controlled by the 5′ enhancer element. (B) Da protein expression (white) from panel (A). Arrow denotes region controlled by the 5′ enhancer element from panel (A). (C) GFP expression (white) from panel (A). (D) Ato protein expression (white) from panel (A). Arrow indicates region controlled by the 3′ enhancer element. (E) Average pixel intensity of Da protein (left) and Ato protein expression (right). *P<0.05 Student’s t-test.

NIHMS348220-supplement-Supp_Figure_S3.tif (3.5MB, tif)
Supp Figure S4

Supplemental Figure 4. Lilliputian-mediated regulation of gene expression within the retina. (A-D) All eyes anterior right, late third larval instar. Loss of GFP indicates homozygous somatic lilli mutant tissue. (A) lilliGD17 clones in the developing eye show no reduction in Elav expression (red), and show no disrupted morphology of photoreceptor cells posterior to the furrow. (B) Elav expression (white) from panel (A). (C) lilliGD17 clones in the developing eye show reduced Hairy expression (red). (D) Hairy expression (white) from panel (C).

NIHMS348220-supplement-Supp_Figure_S4.tif (22.2MB, tif)
Supp Figure S5

Supplemental Figure 5. Lilli regulates Da and Ato expression in the developing Drosophila antenna . (A-C) Third instar larval antennal imaginal discs with lilliGD17 mutant clones. Loss of GFP (green) indicates homozygous mutant tissue. (A) Ato expression (blue), Da expression (red) and GFP expression (green) in mutant clones. Arrow denotes decreased Ato and Da expression. Arrowhead denotes normal expression levels in internal control cells. (B) Da expression (white) from panel (A). (C) Ato expression (white) from panel (A). (D) Average pixel intensity of Da (left) and Ato protein (right) shows significant reduction within lilliGD17 clones. *P<0.05 Student’s t-test.

NIHMS348220-supplement-Supp_Figure_S5.tif (3.4MB, tif)

RESOURCES