Abstract
Disintegrins are small peptides produced in viper venom that act as integrin antagonists. When bound to integrins, disintegrins induce altered cellular behaviors, such as apoptotic induction. Disintegrins with RGDDL or RGDDM motifs induce apoptosis of normal and cancer cells. We hypothesized that a second aspartate (D) carboxyl to the RGD is sufficient to induce apoptosis. Five recombinant mojastin D mutants were produced by site-directed mutagenesis (r-Moj-DA, r-Moj-DG, r-Moj-DL, r-Moj-DN, and r-Moj-DV). Stable αv integrin knockdown and shRNA scrambled control SK-Mel-28 cell lines were produced to test a second hypothesis: r-Moj-D_ peptides bind to αv integrin. Only r-Moj-DL, r-Moj-DM, and r-Moj-DN induced apoptosis of SK-Mel-28 cells (at 29.4%, 25.6%, and 36.2%, respectively). Apoptotic induction was significantly reduced in SK-Mel-28 cells with a stable αv integrin knockdown (to 2%, 17%, and 2%, respectively), but not in SK-Mel-28 cells with a stable scrambled shRNA. All six r-Moj-D_ peptides inhibited cell proliferation; ranging from 49.56% (r-Moj-DN) to 75.6% (r-Moj-DA). Cell proliferation inhibition by r-Moj-D_ peptides was significantly reduced in SK-Mel-28 cells with a stable αv integrin knockdown. All six r-Moj-D_ peptides inhibited SK-Mel-28 cell migration at high levels (69% to 100%). As a consequence, rac-1 mRNA expression levels were significantly reduced as early as 1 h after treatment, suggesting that rac-1 is involved in the cell migration activity of SK-Mel-28.
Keywords: melanoma cell line, recombinant RGD disintegrin, αvβ3 integrin, αv knockdown, cell migration, cell proliferation, apoptosis induction, rac-1 expression
1. Introduction
Integrins are heterodimeric transmembrane proteins, consisting of one alpha and one beta subunit. Integrins can activate signal transduction pathways that can result in altered cell behaviors such as cell migration, proliferation, and apoptosis (Desgrosellier and Cheresh 2010; Mousa 2008; Ridley et al. 2003). Integrin function is often the result of specific subunit expression. Antagonists, such as disintegrins, are being studied as these molecules can bind and alter integrin signaling and as such hold promise as potential therapeutic agents for the treatment of cancer (Selistre-de-Araujo et al. 2010; McLane et al. 2008).
Disintegrins are non-enzymatic peptides found in viper venom that were initially characterized as being platelet aggregation inhibitors (McLane et al. 2004). Many of the known disintegrins contain an RGD motif, a usual structural characteristic of integrin antagonists (Rouslahti 1996). Seven naturally occurring or recombinant disintegrins with a second aspartate amino acid immediately carboxyl of the RGD induce apoptosis. Apoptotic-inducing disintegrins with a second aspartate are in two categories: one with an RGDDL and the second with an RGDDM motif. RGDDL disintegrins with reported apoptotic activity include: vicrostatin (Minea et al. 2010), salmosin (Hong et al. 2003), contortrostatin (Zhou et al. 1999), and accutin (Yeh et al. 1998). RGDDM disintegrins with reported apoptotic activity include: DisBa-01 (Ribeiro et al 2014), r-Moj-DM (Seoane et al. 2010), and echistatin (Alimenti et al. 2004; Brassard et al. 1999). Published reports demonstrate that most of these disintegrins antagonize the αvβ3 integrin (Minea et al. 2010; Ramos et al. 2008; Kang et al. 1999; Kumar et al. 1997). This integrin has been studied as a target for therapy development (Mitjans et al. 2000), since it is overexpressed in highly metastatic cancers. Vogetseder et al. (2013) demonstrated that αvβ3 expression increased in several types of cancer cells that metastasize to brain tissue, including melanomas. Melanocytes do not express αvβ3. Overexpression of this integrin has been linked to tumor progression and metastasis of melanomas (Van Belle et al. 1999; Felding-Habermann et al. 1992).
Previously, we demonstrated that apoptosis induction of a human melanoma cell line (SK-Mel-28) resulted when the wild-type binding motif (RGDWN) was mutated to RGDDM in recombinant mojastin, r-Moj (Seoane et al. 2010). We are interested in understanding the mechanism by which mutated versions of r-Moj antagonize integrins in the induction of apoptosis of cancer cells. In the present study, six mutated versions of r-Moj containing a second aspartate in the binding motif were produced, purified, and used to test two hypotheses. First, we hypothesized that a second aspartate (D) carboxyl of the RGD is sufficient to induce apoptosis. Second, we hypothesized that r-Moj-D_ peptides bind to αv integrin receptors. Three of r-Moj-D_ motifs have naturally occurring counterparts (RGDDL, RGDDM, and RGDDV), and three do not (RGDDA, RGDDG, and RGDDN). Our research demonstrates that a second aspartate is not sufficient to induce apoptosis, but that r-Moj-D_ peptides bind to αv integrin.
2. Materials and methods
2.1. Production of five additional aspartate mutants from r-Moj-DM cDNA
A mutant r-Moj-DM cDNA was previously obtained (Seoane et al. 2010). Additional r-Moj-D_ mutants were obtained using the methods described in Seoane et al. (2010). The mutant mojastin peptides were designated as r-Moj-DA, r-Moj-DG, r-Moj-DL, r-Moj-DN, and r-Moj-DV. The designation corresponds to the two amino acids following the RGD tripeptide.
2.2. Expression and purification of r-Moj-DA, r-Moj-DG, r-Moj-DL, r-Moj-DM, r-Moj-DN, and r-Moj-DV peptides
Expression and partial purification of r-Moj-DA, r-Moj-DG, r-Moj-DL, r-Moj-DM, r-Moj-DN, and r-Moj-DV peptides were performed with a method described earlier (Seoane et al. 2010), with the following modifications. Removal of the GST-tagged was performed using a thrombin cleavage capture kit while bound to the Glutathione Sepharose 4B beads using biotinylated thrombin for 16 h at 4°C with no agitation. Streptavidin agarose beads and spin filters (Novagen) were used to remove the thrombin from the supernatant containing the cleaved r-Moj-DA, r-Moj-DG, r-Moj-DL, r-Moj-DM, r-Moj-DN, or r-Moj-DV peptides at room temperature for 30 min with gentle rotation.
2.3. Structural protein modeling of r-Moj-DA, r-Moj-DG, r-Moj-DL, r-Moj-DM, r-Moj-DN, and r-Moj-DV peptides
Three-dimensional structural models of r-Moj-D_ peptides were produced using the methods described by Seoane et al. (2010).
2.4. Cell culture conditions
SK-Mel-28 cells were grown in Eagle's minimum essential medium (ATCC). Media was supplemented with 10% fetal bovine serum (FBS) and penicillin-100 (IU/mL), streptomycin (0.1 mg/mL), and amphotericin B (0.25μg/mL). HUVECs were obtained from ATCC and grown using Lonza EGM-2 media supplemented with the EGM-2 SingleQuots. Cells were grown at 37°C in a humidified incubator with 5% CO2.
2.5. Integrin αv gene expression knockdown
Inhibition of integrin αv expression was performed in SK-Mel-28 cells using integrin αv shRNA (h) lentiviral particles (Santa Cruz Biotech, sc-29373-v). Control shRNA lentiviral particles (sc-108080) were used as a negative scrambled shRNA sequence control. Cells were plated in 12-well plates, 24 h prior to viral infection with 1 mL of complete EMEM media. Then, the media was changed with complete media containing 5 μg/mL of Polybrene (sc-134220). Integrin αv shRNA (h) lentiviral particles were thawed and added to the cells, mixed gently, and incubated overnight in a humidified 5% CO2 air incubator at 37 °C. After 24 h, the media was changed with 1 mL of complete media without Polybrene and incubated overnight. To select stable clones, cells were split in the ratio of 1:5 and incubated for 24 h in complete media. After 48 h, stable clones expressing αv shRNA were selected using Puromycin dihydrochloride (sc-108071) at 5 μg/ml. The cells were expanded and grown in puromycin containing complete media until ready for use.
2.6. Integrin αvβ3 expression using flow cytometry
Integrin αvβ3 expression analyses were performed using fluorescently labeled anti-αvβ3 antibody and flow cytometry on untreated cells, shRNA scramble control cells, and αv knockdown cells. The antibody against αvβ3 (αvβ3 sc-7312 FITC) and respective isotype were purchased from Santa Cruz Biotechnology. Cells were cultured to 90-95% confluency and detached from the flask surface using 0.05% trypsin EDTA. Trypsin was neutralized with complete culture media. Cells were resuspended in 1× PBS to a final concentration of 106 cells/mL, and blocked with 1 μ L/mL normal rabbit serum, for 25 min at room temperature. After blocking, cells were washed with 1mL 1× PBS, centrifuged, and resuspended in FCM Wash Buffer (Santa Cruz Biotechnology) to 106 cells/mL. One hundred microliters of cells were distributed in three, 12 Å∼ 75 mm round bottom glass test tubes and fixed in 1% formaldehyde for 1 h. After fixation, cells were washed three times in 1× PBS. Four hundred microliters of 1× binding buffer were added and the samples analyzed using a Becton Dickinson FACScan flow cytometer and FACSCalibur software. Isotype control samples were used to determine gating parameters. Expression of αvβ3 on untransduced, shRNA scramble control, and αv knockdown cells was normalized and compared with isotype control samples. Data are presented as means of percentages of αvβ3 expression for three independent experiments.
2.7. Apoptotic assay
Five hundred thousand SK-Mel-28 cells were seeded in six wells of a 12 well plate and allowed to grow for 24 h. Cells were treated for 24 h with 5μM r- Moj-DA, r-Moj-DG, r-Moj-DL, r-Moj-DM, r-Moj-DN, or r-Moj-DV peptides, or no treatment. Then, non-adherent cells were transferred to a flow cytometry tube, followed by the remaining cells detached with 0.05% trypsin EDTA. Cells were centrifuged at 300×G for 5 min and fixed in 1% paraformaldehyde for 1 h. Cells were washed twice with 1× PBS and resuspended in 70% ethanol. Cell suspensions were stored at -20°C for 24 h. Cells were processed using an APO-BRDU™ Apoptosis Detection Kit (BD Biosciences) according to the manufacturer's protocol. Cell suspensions were analyzed using a Becton Dickinson FACSCalibur flow cytometer with CellQuest software. Experiments were performed in triplicates.
2.8. Chromatin condensation
SK-Mel 28 cells were grown on chambered slides. One and a half million cells were grown in 2 mL of media for 24 h. After initial incubation, cells were treated with 5μM r- Moj-DA, r-Moj-DG, r-Moj-DL, r-Moj-DM, r-Moj-DN, or r-Moj-DV peptides for 24 h. The media was aspirated and the cells washed twice with 1× PBS. Cells were fixed on the slide with 3% formaldehyde for 1 h, followed by two washes with 1× PBS. Ten micrograms/mL of Hoechst stain was added to cells and incubated in the dark for 15 min. Excess Hoechst stain was removed by two 1× PBS washes. Slides were mounted with 30% glycerol and viewed at 100×, oil immersion, with a Zeiss AXIO fluorescent microscope.
2.9. Cell Proliferation Assay
The effects of r-Moj-D_ peptides on cell proliferation were determined using the WST-1 assay (GenDEPOT). Fifty thousand SK-Mel-28 cells/well were added to a 96-well plate grown for 24 h at 37°C in a 5% CO2 incubator. After 24 h, growth media was aspirated. Then, 100 mL of culture media containing 3.5 mM of r-Moj-D_ peptide were added to their respective wells. Negative controls consisted of cells treated with equal volume of PBS. After 24 h all wells were then treated with 10 mL of WST-1 cell proliferation assay reagent for 1 h. The same volume of culture medium and WST-1 reagent used to treat the cells was used as the control blank for the microplate reader. The formation of the formazan product was measured at 450 nm. The reference wavelength was 630 nm. A dual wavelength reading was used to obtain the results, where the reference wavelength was subtracted from the reading wavelength, 450–630 nm. Percentage of cell proliferation inhibition was calculated using the following formula: (Abs450nm–600nm of treated O Abs450nm–600nm of untreated) × 100. Experiments were performed in triplicate.
2.10. Wound Healing Assay
The effects of r-Moj-D_ peptides on cell migration were determined using the method described by Carey et al. (2012).
2.11. Detection of rac-1 expression levels by QPCR after r- Moj-DA, r-Moj-DL, r-Moj-DM, r-Moj-DN, or r-Moj-DV peptide treatment
One million SK-Mel 28 cells were treated with r- Moj-DA, r-Moj-DL, r-Moj-DM, r-Moj-DN, or r-Moj-DV peptides for 1 h, 2 h, 4 h, and 6 h. Total RNA was extracted from each sample using the RNeasy Mini Kit (Qiagen). Total RNA was quantified by the use the NanoDrop spectrophotometer. One thousand nanograms of total RNA were isolated from any contaminating genomic DNA with the use of gDNA Wipeout Buffer from the QuantiTect Reverse Transcription Kit (Qiagen). The isolated RNA was reverse transcribed at 42°C for 15 min using Quantiscript Reverse Transcriptase (Qiagen). Reactions were prepared for each sample cDNA with correlating primers. Sample reactions containing 2.5ul of cDNA and 1.0uM of forward (AAGAGAAAATGCCTGCTGTTGTAA) and reverse (GCGTACAAAGGTTCCAAGGG) primers were prepared in triplicate wells with the use of QuantiTect SYBR Green PCR kit (Qiagen). The PCR conditions were 1 cycle of 95°C for 5 min, followed by 40 cycles of amplification (95°C for 10 sec and 60°C for 30 sec), and a final extension cycle at 95°C for 15 sec and 60°C for 1 min. A melting curve was used to verify the presence of one specific peak for the gene. Average Ct was used to calculate relative fold change. Normalization of the data was performed by the use an endogenous control, HPRT primers (forward: ATGACCAGTCAACAGGGGAC, and reverse: GGTCCTTTTCACCAGCAAGC), and an untreated control sample.
3. Results
3.1. Six asparate mojastin mutants
Six aspartate mojastin mutants were produced and purified without the GST tag (Figs. 1A-1B). Three-dimensional models showed that single amino acid substitutions after the second aspartate (RGDD_) altered the predicted orientations in their RGD loops and C-termini (Fig. 1C).
Fig. 1.

(A) Alignment of amino acid sequences for r-Moj-D_ mutant peptides. The RGD tripeptide is shaded in gray. In bold are shown the two amino acids carboxyl to the RGD motif. (B) SDS-PAGE of expressed protein resolved in a 4–12 % NuPAGE Bis–Tris gel under reducing conditions. Lane 1: Protein marker. Lane 2: r-Moj-DA. Lane 3: r-Moj-DG. Lane 4: r-Moj-DL. Lane 5: r-Moj-DN. Lane 6: r-Moj-DV. (C) r-Moj-D_ peptide models displayed in surface style. The RGD is shown in red. The two amino acids carboxyl to the RGD are colored. The other amino acids are shown in gray.
3.2. Production of stable SK-Mel-28 αv knockdown and scrambled control cell lines
Expression of αvβ3 integrin was significantly reduced in cells that were transduced with αv shRNA lentiviral particles (p<0.001), as compared to untransduced cells or cells that were transduced with a scrambled shRNA control sequence (Fig. 2).
Fig. 2.

αvβ3 integrin cell surface expression on untransduced, scrambled shRNA, and αv stable knocked down SK-Mel-28 cells. p<0.001 (***). αvβ5 integrin expression was not examined since we demonstrated that SK-Mel-28 cells do not express the β5 subunit (Seoane et al. 2010).
3.3. Apoptotic inducing activity of r-Moj-DL, r-Moj-DM, and r-Moj-DN
Only three r-Moj-D_ mutant peptides (r-Moj-DL, r-Moj-DM, and r-Moj-DN) induced apoptosis of SK-Mel-28 cells (Fig. 3). The strongest apoptotic inducer was r-Moj-DN, a novel peptide. All three peptides induced apoptosis by binding to αv integrin, as apoptotic induction was inhibited in the treated stable αv knocked down cells.
Fig. 3.

r-Moj-DL, r-Moj-DM, and r-Moj-DN peptides induced apoptosis of SK-Mel-28 cells by binding to the αv integrin. p=0.05 (*), p=0.01 (**), p<0.001 (***).
Apoptotic activation was confirmed by examining chromatin condensation. Only cells treated with r-Moj-DL, r-Moj-DM, or r-Moj-DN showed chromatin condensation, a morphological characteristic of apoptotic cells (Fig. 4).
Fig. 4.

r-Moj-DL, r-Moj-DM, and r-Moj-DN peptides induced chromatin fragmentation of SK-Mel-28 cells. A representative cell is shown in each panel.
3.4. Cell proliferation inhibition
All r-Moj-D_ peptides inhibited cell proliferation significantly (p<0.001, Fig 5). Recombinant Moj-DA was the strongest inhibitor (79%) and r-Moj-DN was the weakest (50%). All r-Moj-D_ mutant peptides tested inhibited cell proliferation by binding to αv, as inhibition was reduced or abolished (r-Moj-DL and r-Moj-DN) in the treated stable αv knocked down cells.
Fig. 5.

All r-Moj-D_ mutant peptides inhibited proliferation of SK-Mel-28 cells by binding to the αv integrin. The scrambled shRNA control treated cells are not shown, since these cells grew at much slower rate than untransduced or αv knocked down cells.
3.5. Cell migration inhibition and rac-1 mRNA expression
Cell migration of untransduced SK-Mel-28 cells was inhibited by all r-Moj-D_ mutant peptides (Fig. 6A). Recombinant r-Moj-DL was the most potent cell migration inhibitor (100%). Whether r-Moj-D peptides induce cell migration inhibition through αv integrin could not be determined directly, as untreated stable αv knocked down cells failed to migrate. Rac-1 mRNA expression was downregulated in five of the six treatments (Fig 6B). The effect on rac-1 gene expression was fast and detected 1 h after treatment. The r-Moj-DA effect on rac-1 gene expression was short lived. In contrast, gene expression effects were longer lasting in r-Moj-DL and r-Moj-DN treated cells. Recombinant r-Moj-DL also induced the highest down regulation at 2 h (13 fold change). Recombinant r-Moj-DV had no effect on rac-1 mRNA expression.
Fig. 6.

(A) All r-Moj-D_ mutant peptides inhibited cell migration. (B) rac-1 mRNA expression was downregulated as early as 1 h after treatment.
4. Discussion
4.1. Apoptosis induction by r-Moj-DL, r-Moj-DM, and r-Moj-DN peptides
Apoptosis can prevent cells attached to either the ECM or adjacent cells from beginning to migrate by activating either intrinsic or extrinsic cell death pathways (Gilmore 2005). Apoptotic avoidance is one of the established hallmarks of cancer development (Hanahhan and Weinberg 2011; Reed 1999). Others include: induction of angiogenesis, activation of invasion and metastasis, evasion of tumor suppression, reproductive immortality, and sustaining proliferative signaling (Hanahhan and Weinberg 2011). An approach for the development of innovative chemotherapies is the screening, selection, modification, and synthesis of compounds that can inhibit multiple landmarks of cancer development (for example, angiogenesis, cell migration, metastasis, and cell proliferation) while inducing apoptosis. Our previous research with two recombinant disintegrins (r-Rub and r-Moj-DM) provided us with good models to investigate this approach (Carey et al. 2012; Seoane et al. 2010).
Seven disintegrins with a second asparate carboxyl to their RGD induce apoptosis (Ribeiro et al 2014; Minea et al. 2010; Seoane et al. 2010; Alimenti et al. 2004; Hong et al. 2003; Brassard et al. 1999; Zhou et al. 1999; Yeh et al. 1998). Therefore, we hypothesized that the second aspartate is sufficient to induce apoptosis. The results of our present study refute this hypothesis. Of the six r-Moj-D_ mutant peptides tested, only three induced apoptosis of SK-Mel-28 cells (r-Moj-DL, r-Moj-DM, and r-Moj-DN). Two of these mutants have naturally occurring counterparts (RGDDL and RGDDM) and one does not (RGDDN). Our results suggest that the amino acid immediately carboxyl of the second aspartate is important. Two of the apoptotic inducing r-Moj-D_ mutant peptides contain a non-polar amino acid after the second aspartate. But the strongest apoptotic inducer, r-Moj-DN has a polar amino acid in that position instead.
4.2. Knockdown of αv integrin revealed its significance in signal transduction pathways induced by r-Moj-D_ mutant peptides
Several integrins involved in tumor progression are not expressed, or are expressed at low levels in normal epithelial tissue (Desgrosselier and Cheresh 2010). Among these, the αvβ3 integrin is expressed at high levels on many types melanomas (Vogetseder et a. 2013; Mitjans et al. 2000). In addition, αvβ3 activates transduction signals that target the P13K-PKB/AKT and the Lyn pathways, resulting in cell survival and apoptosis avoidance (Chudakova et al. 2008; Hullinger et al. 1998).
Alpha v subunits can form heterodimers with β1, β3, β5, β6, and β8 integrin subunits (Koistinen and Heino 2002). We have previously shown that SK-Mel-28 cells express αv, β1, and β3, but not β5 or β6 (Seoane et al. 2010). Expression of β8 subunits was not determined in our previous study. Since SK-Mel-28 cells express αvβ3 at high levels (Seoane et al. 2010), it is possible that αvβ1 is expressed at low levels or not at all. Koistenen and Heino (2002) demonstrated that in melanomas, αvβ1 is only expressed after the other αv heterodimers are formed, such as αvβ3. Our data suggest that r-Moj-D_ peptides antagonize αvβ3 based on the significant reduction of expression of this integrin on the αv knocked down cells. However, we cannot discard the possibility that these cells express αvβ1 or αvβ8 and that the r-Moj-D_ peptides also antagonize these integrins. These possibilities remain to be studied.
Stable knockdowns of αv integrin subunit and scrambled shRNA controls were used to examine the role of r-Moj-D_ peptide antagonism to αv integrin because of the importance of αvβ3 in regulating survival/apoptosis, cell migration, and angiogenesis. The results from knockdown experiments allowed us to make some interesting conclusions. The apoptotic inhibition reduction was not equivalent in the r-Moj-D_ treatments of αv knocked down cells, suggesting that these peptides do not antagonize the receptor with the same strength. It is also possible that in the case of r-Moj-DM, another integrin receptor is more important for apoptotic induction. Our results suggest that r-Moj-DM is not as efficient at antagonizing αv when all of the functional assays we performed with αv knocked down cells are considered. Perhaps, r-Moj-DM exerts most of the apoptotic activity through another integrin receptor, possibly containing a β1 subunit. The α5β1 integrin is not a possibility since α5 is not expressed on SK-Mel-28 cells (Seoane et al. 2010).
4.3. Potential relationship between cell proliferation inhibition and apoptotic induction
Cell proliferation was inhibited in all treated cells. The αv knockdown results for the cell proliferation experiment suggest that not all the cell proliferation inhibition is due to cell death. Recombinants r-Moj-DL and r-Moj-DN failed to inhibit cell proliferation of αv knocked down cells, but apoptosis induction was not completely abolished in these cells. However, it is possible that the difference in cell proliferation and apoptotic results is due to the sensitivity of the tunnel assay used to analyze apoptosis and the indirect measurement of cell proliferation obtained using the WST-1 assay. Furthermore, cell proliferation reduction results caused by r-Moj-DA, r-Moj-DG, and r-Moj-DV are not due to cell death, since these do not induce apoptosis.
4.4. Downregulation of rac-1 mRNA expression as a result of r-Moj-D_ peptide treatments
Integrins' role in regulating cell migration and metastasis is well studied (Desgrosellier and Cheresh 2010; Selistre-de-Araujo et al. 2010). Our study suggests that αv integrin is required for SK-Mel-28 cell migration, as a knockdown of this subunit renders these cells unable to migrate in the absence of treatment. It has been demonstrated that αvβ3 and αvβ5 are expressed on highly malignant cells that can initiate cell migration (Ummanni et al. 2008). It has also been demonstrated that αvβ3 is critical for transendothelial migration of cancer cells during metastasis (Bauer et al. 2007).
Cross-talk between several growth factor receptors involved in cell migration and certain integrins result in the activation of cell migration and tumor progression of cells that can move away from the ECM while avoiding apoptosis (Brunton et al. 2004). This mechanistic connection between cell migration and apoptosis provides investigators with the drive to find potential single therapies that block the pathways that connect apoptosis avoidance and cell migration activation of malignant cells.
Rac1, a Rho-GTPase, is involved in cell migration activation and exerts its function downstream of integrin signaling by altering actin-based cytoskeleton dynamics (Lawson and Burridge 2014; Oberoi et al 2012; Yang et al. 2012; Brunton et al. 2004). Rac1 activation also leads to the activation of survival signals such as NFκb (Tong and Tergaonkar 2014). We investigated the expression of rac-1mRNA in order to begin elucidating the signal transduction pathways that result in the cell migration inhibition exerted by r-Moj-D_ peptide treatments. All six r-Moj-D_ peptides inhibited SK-Mel-28 cell migration at high levels (69% to 100%). Our research demonstrated that as a consequence, rac-1 mRNA expression levels were significantly reduced as early as 1 h after treatment, suggesting that rac-1 mRNA downregulation is an outcome of most r-Moj-D_ peptide treatments. Of all six r-Moj-D_ peptides tested, r-Moj-DN has the strongest apoptotic-inducer activity and it induced a long lasting downregulation of rac-1 mRNA expression. Therefore, r-Moj-DN provides us a good model to investigate the possibility of developing a single therapy that targets both apoptotic avoidance and cell migration activation of cancer cells.
4.5. Conclusions
Recombinant disintegrins with mutations in the binding motif are sources of integrin antagonists with potentially different biological activities. Our data demonstrate that a second aspartate immediately carboxyl to the RGD is not sufficient to induce apoptosis. However our second hypothesis was supported, as all of the tested r-Moj-D_ peptides failed to induce or induced lower activities of αv knocked down SK-Mel-28 cells. Our research demonstrates that recombinant disintegrins with non-naturally found binding motifs (RGDDA, RGDDG, RGDDN) are more potent in most of the functional assays we used in our study. It would be of interest to determine if substituting a different polar amino acid immediately carboxyl to the second aspartate is sufficient to render the resulting disintegrin similarly potent as r-Moj-DN. The altered binding motif predicted by the 3-D peptide modeling may provide a testable hypothesis about strength of signal and altered activities of r-Moj-D_ mutant peptides. Recombinant Moj-D_ peptide binding to soluble or bound αvβ3 integrins and structural analysis are interesting possibilities for future studies.
Highlights.
r-Moj-DL, r-Moj-DM, and r-Moj-DN induced apoptosis of SK-Mel-28 cells.
All r-Moj-D_ mutant peptides antagonize the αv integrin subunit.
All r-Moj-D_ peptides inhibited cell proliferation and cell migration.
All, but r-Moj-DV, treatments resulted in the downregulation of rac-1 expression.
Acknowledgments
We thank Stephanie Mandal for the preparation and labeling of composite figures. Funding for this project was provided by NSF-REU Grant # DBI 1004350, NIH Grant # R25GM071381, NIH Grant # 5R25GM71381, NIH Grant # 5T34GM008253-27, NCRR/Viper # 2P40RR018300, and NIH/ORIP Grant # 5P40OD010960. The writing of this manuscript was supported while serving at the National Science Foundation. Any opinion, findings, and conclusions or recommendations expressed in this material are those of the author(s) and do not necessarily reflect the views of the National Science Foundation.
Footnotes
Conflict of interest statement: The authors declare that there is no conflict of interest.
Ethical statement: Our manuscript has not been published and is not under consideration for publication in other journals. All co-authors in the manuscript carefully read the manuscript, carried-out the experiments, and agreed on the content presented in the manuscript.
Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
References
- Alimenti E, Tafuri S, Scibelli A, D'Angelo D, Manna L, Pavone LM, Belisario MA, Staiano NN. Pro- apoptotic signaling pathway activated by echistatin in GD25 cells. Biochim Biophys Acta. 2004;1693:73–80. doi: 10.1016/j.bbamcr.2004.05.007. [DOI] [PubMed] [Google Scholar]
- Bauer K, Mierke C, Behrens J. Expression profiling reveals genes associated with transendothelial migration of tumor cells: a functional role of αvβ3 integrin. Int J Cancer. 2007;121:1910–1918. doi: 10.1002/ijc.22879. [DOI] [PubMed] [Google Scholar]
- Brassard DL, Maxwell E, Malkowski M, Nagabhushan TL, Kumar CC, Armstrong L. Integrin alpha(v)beta(3)-mediated activation of apoptosis. Exp Cell Res. 1999;251:33–45. doi: 10.1006/excr.1999.4559. [DOI] [PubMed] [Google Scholar]
- Brunton VG, MacPherson IR, Frame MC. Cell adhesion receptors, tyrosine kinases and actin modulators: a complex three-way circuitry. Biochim Biophys Acta. 2004;1692:121–144. doi: 10.1016/j.bbamcr.2004.04.010. [DOI] [PubMed] [Google Scholar]
- Carey C, Bueno R, Gutierrez DA, Petro C, Lucena SA, Sanchez EE, Soto JG. Recombinant rubistatin (r-Rub), an MVD disintegrin, inhibits cell migration, proliferation, and it is a strong apoptotic inducer of SK-Mel-28. Toxicon. 2012;59:241–248. doi: 10.1016/j.toxicon.2011.12.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Chudakova DA, Zeidan YH, Wheeler BW, Yu J, Novgorodov SA, Kindy MS, Hannun YA, Gudz TI. Integrin-associated Lyn Kinase Promotes Cell Survival by Suppressing Acid Sphingomyelinase Activity. J Biol Chem. 2008;283:28806–28816. doi: 10.1074/jbc.M803301200. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Desgolier JS, Cheresh D. Integrins in cancer: biological implications and thereapeutic opportunities. Nat Rev Cancer. 2010;10:9–22. doi: 10.1038/nrc2748. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Felding-Habermann B, Mueller BM, Romerdahl CA, Cheresh DA. Involvement of integrin alpha V gene expression in human melanoma tumorigenicity. J Clin Invest. 1992;89:2018–2022. doi: 10.1172/JCI115811. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Gilmore AP. Anoikis. Cell Death Differ. 2005;12:1473–1477. doi: 10.1038/sj.cdd.4401723. [DOI] [PubMed] [Google Scholar]
- Hanahhan, Weinberg Hallmarks of cancer: the next generation. Cell. 2011;144:646–674. doi: 10.1016/j.cell.2011.02.013. [DOI] [PubMed] [Google Scholar]
- Hong S, Lee H, You W, Chung K, Kim D, Song K. The snake venom disintegrin salmosin induces apoptosis by disassembly of focal adhesions in bovine capillary endothelial cells. Biochem Biophys Res Commun. 2003;302:502–508. doi: 10.1016/s0006-291x(03)00213-4. [DOI] [PubMed] [Google Scholar]
- Hsu AR, Veeravagu A, Cai W, Hou LC, Tse V, Chen X. Integrin alpha v beta 3 antagonists for anti-angiogenic cancer treatment. Recent Pat Anticancer Drug Discov. 2007;2:143–158. doi: 10.2174/157489207780832469. [DOI] [PubMed] [Google Scholar]
- Hullinger TG, McCauley LK, DeJoode ML, Somerman MJ. Effect of bone proteins on human prostate cancer cell lines in vitro. Prostate. 1998;36:14–22. doi: 10.1002/(sici)1097-0045(19980615)36:1<14::aid-pros3>3.0.co;2-b. [DOI] [PubMed] [Google Scholar]
- Kang IC, Lee YD, Kim DS. A novel disintegrin salmosin inhibits tumor angiogenesis. Cancer Res. 1999;59:3754–3760. [PubMed] [Google Scholar]
- Koistinen P, Heino J. The selective regulation of αvβ1 integrin expression is based on the hierarchical formation of αv-containing heterodimers. J Biol Chem. 2002;277:24835–24841. doi: 10.1074/jbc.M203149200. [DOI] [PubMed] [Google Scholar]
- Kumar CC, Nie H, Rogers CP, Malkowski M, Maxwell E, Catino JJ, Amonstrong L. Biochemical characterization of the binding of echistatin to integrin alphavbeta3 receptor. J Pharmacol Exp Ther. 1997;283:843–853. [PubMed] [Google Scholar]
- Lawson CD, Burridge K. The on-off relationship of Rho and Rac during integrin-mediated adhesion and cell migration. Small GTPases. 2014;5:e27958. doi: 10.4161/sgtp.27958. 2014. [DOI] [PMC free article] [PubMed] [Google Scholar]
- McLane MA, Joerger T, Mahmoud A. Disintegrins in health and disease. Front Biosci. 2008;13:6617–6637. doi: 10.2741/3177. [DOI] [PubMed] [Google Scholar]
- McLane MA, Sanchez EE, Wong A, Paquette-Straub C, Perez JC. Disintegrins. Curr Drug Targets Cardiovasc Haematol Disord. 2004;4:327–355. doi: 10.2174/1568006043335880. [DOI] [PubMed] [Google Scholar]
- Minea RO, Helchowski CM, Zidovetzki SJ, Costa FK, Swenson SD, Markland FS. Vicrostatin – An anti-invasive multi-integrin targeting chimeric disintegrin with tumor anti-angiogenic and pro-apoptotic activities. PLoS ONE. 2010;5(6):e10929. doi: 10.1371/journal.pone.0010929. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Mitjans F, Meyer T, Fittschen C, Goodman S, Jonczyk A, Marshall JF, Reyes G, Piulats J. In vivo therapy of malignant melanoma by means of antagonists of αv integrins. In J Cancer. 2000;87:716–723. [PubMed] [Google Scholar]
- Mousa SA. Cell adhesion molecules: potential therapeutics & diagnostic implications. Mol Biotechnol. 2008;38:33–40. doi: 10.1007/s12033-007-0072-7. [DOI] [PubMed] [Google Scholar]
- Oberoi TK, Dogan T, Hocking JC, Scholz RP, Mooz J, Anderson CL, Karreman C, zu Herringdorf DM, Schmidt G, Ruonala M, Namikawa K, Harms GS, Carpy A, Mazeck B, Koster RW, Rajalingam K. IAP regulate the plasticity of cell migration by targeting Rac1 for degradation. EMBO J. 2012;31:14–28. doi: 10.1038/emboj.2011.423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ramos OH, Kauskot A, Cominetti MR, Bechyne I, Salla Pontes CL, Chareyre F, Manent J, Vassy R, Giovannini M, Legrand C, Selistre- de-Araujo HS, Crepin M, Bonnefoy A. A novel alpha(v)beta (3)-blocking disintegrin containing the RGD motive, DisBa-01, inhibits bFGF-induced angiogenesis and melanoma metastasis. Clin Exp Metastasis. 2008;25:53–64. doi: 10.1007/s10585-007-9101-y. [DOI] [PubMed] [Google Scholar]
- Reed Mechanisms of apoptosis avoidance in cancer. Curr Opin Oncol. 1999;11:68–75. doi: 10.1097/00001622-199901000-00014. [DOI] [PubMed] [Google Scholar]
- Ribeiro LCA, Massimino LC, Durante AC, Tansini A, Urbaczek A, Selistre-de Araujo HS, Carlos IZ. Recombinant disintegrin targets a(v) b(3) integrin and leads to mediator production. Cell Adhesion & Migration. 2014;8:60–65. doi: 10.4161/cam.27698. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ridley AJ, Schwartz MA, Burridge K, Firtel RA, Ginsberg MH, Borisy G, Parsons JT, Horwitz AR. Cell migration: integrating signals from front to back. Science. 2003;302:1704–1709. doi: 10.1126/science.1092053. [DOI] [PubMed] [Google Scholar]
- Ruoslahti E. RGD and other recognition sequences for integrins. Annu Rev Cell Dev Biol. 1996;12:697–715. doi: 10.1146/annurev.cellbio.12.1.697. [DOI] [PubMed] [Google Scholar]
- Sánchez EE, Lucena SE, Reyes S, Soto JG, Cantu E, Lopez-Johnston JC, Guerrero B, Salazar AM, Rodríguez-Acosta A, Galán JA, Tao WA, Pérez JC. Cloning, expression, and hemostatic activities of a disintegrin, r-mojastin 1, from the Mohave rattlesnake (Crotalus scutulatus scutulatus) Thromb Res. 2010;126:211–219. doi: 10.1016/j.thromres.2010.06.006. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Selistre-de-Araujo HS, Pontes CLS, Montenegro CF, Martin ACBM. Snake venom disintegrins and cell migration. Toxins. 2010;2:2606–2621. doi: 10.3390/toxins2112606. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Seoane AI, Tran VL, Sanchez EE, White SA, Choi JL, Gaytán B, Chavez N, Reyes SR, Ramos CJ, Tran LH, Lucena SE, Sugarrek M, Perez JC, Mandal SA, Ghorab S, Rodriguez-Acosta A, Fung BK, Soto JG. The mojastin mutant Moj-DM induces apoptosis of the human melanoma Sk-Mel-28, but not the mutant Moj-NN nor the non-mutated recombinant Moj-WN. Toxicon. 2010;56:391–401. doi: 10.1016/j.toxicon.2010.04.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Tong L, Tergaonkar V. Rho protein GTPases and their interactions with NFκB: crossroads of inflammation and matrix biology. Biosci Rep. 2014;34 doi: 10.1042/BSR20140021. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Ummani R, Teller S, Junker H, Zimmermann U, Venz S, Scharf C, Giebel J, Walther R. Altered expression of tumor protein D52 regulates apoptosis and migration of prostrate cells. J Biol Chem. 2008;283:28806–28816. doi: 10.1111/j.1742-4658.2008.06697.x. [DOI] [PubMed] [Google Scholar]
- Van Belle PA, Elenitsas R, Satyamoorthy K, Wolfe JT, Guerry D, Schuchhter L, Van Belle TJ, Abelda S, Tahin P, Herlyn M, Elder DE. Progression-related expression of beta3 integrin in melanomas and nevi. Hum Pathol. 1999;30:562–567. doi: 10.1016/s0046-8177(99)90202-2. [DOI] [PubMed] [Google Scholar]
- Vogetseder A, Thies S, Ingold B, Roth P, Weller M, Schramal P, Goodman SL, Moch H. αv-Integrin isoform expression in primary tumors and brain metastases. Int J Cancer. 2013;133:2362–2371. doi: 10.1002/ijc.28267. [DOI] [PubMed] [Google Scholar]
- Yang WH, Lan HY, Huang CH, Tai SK, Tzeng CH, Kao SY, Wu KJ, Hung MC, Yang MH. Rac1 activation mediates Twist-1 cancer cell migration. Nat Cell Biol. 2012;11:366–374. doi: 10.1038/ncb2455. [DOI] [PubMed] [Google Scholar]
- Yeh CH, Peng HC, Huang TF. Accutin, a new disintegrin, inhibits angiogenesis in vitro and in vivo by acting as integrin alphavbeta3 antagonist and inducing apoptosis. Blood. 1998;92:3268–3276. [PubMed] [Google Scholar]
- Zhou Q, Nakada MT, Arnold C, Shieh KY, Markland FS. Contortrostatin, a dimeric disintegrin from Agkistrodon contortrix contortrix, inhibits angiogenesis. Angiogenesis. 1999;3:259–69. doi: 10.1023/a:1009059210733. [DOI] [PubMed] [Google Scholar]
