Skip to main content
OncoTargets and Therapy logoLink to OncoTargets and Therapy
. 2016 Jul 11;9:4225–4237. doi: 10.2147/OTT.S103581

Interleukin-32α inactivates JAK2/STAT3 signaling and reverses interleukin-6-induced epithelial–mesenchymal transition, invasion, and metastasis in pancreatic cancer cells

Jingfeng Chen 1,2,*, Silu Wang 1,*, Jiadong Su 1, Guanyu Chu 1, Heyi You 1, Zongjing Chen 1, Hongwei Sun 1, Bicheng Chen 1,3,, Mengtao Zhou 1,
PMCID: PMC4948719  PMID: 27471397

Abstract

Interleukin (IL)-32 is a newly discovered cytokine that has multifaceted roles in inflammatory bowel disease, cancer, and autoimmune diseases and participates in cell apoptosis, cancer cell growth inhibition, accentuation of inflammation, and angiogenesis. Here, we investigated the potential effects of IL-32α on epithelial–mesenchymal transition, metastasis, and invasion, and the JAK2/STAT3 signaling pathway in pancreatic cancer cells. The human pancreatic cancer cell lines PANC-1 and SW1990 were used. Epithelial–mesenchymal transition-related markers, including E-cadherin, N-cadherin, Vimentin, Snail, and Zeb1, as well as extracellular matrix metalloproteinases (MMPs), including MMP2, MMP7, and MMP9, were detected by immunofluorescence, Western blotting, and real-time polymerase chain reaction. The activation of JAK2/STAT3 signaling proteins was detected by Western blotting. Wound healing assays, real-time polymerase chain reaction, and Western blotting were performed to assess cell migration and invasion. The effects of IL-32α on the IL-6-induced activation of JAK2/STAT3 were also evaluated. In vitro, we found that IL-32α inhibits the expressions of the related markers N-cadherin, Vimentin, Snail, and Zeb1, as well as JAK2/STAT3 proteins, in a dose-dependent manner in pancreatic cancer cell lines. Furthermore, E-cadherin expression was increased significantly after IL-32α treatment. IL-32α downregulated the expression of MMPs, including MMP2, MMP7, and MMP9, and decreased wound healing in pancreatic cancer cells. These consistent changes were also found in IL-6-induced pancreatic cancer cells following IL-32α treatment. This study showed that reversion of epithelial–mesenchymal transition, inhibition of invasiveness and metastasis, and activation of the JAK2/STAT3 signaling pathway could be achieved through the application of exogenous IL-32α.

Keywords: EMT, MMPs, IL-32α, JAK2, STAT3

Introduction

Pancreatic cancer, a common malignant neoplasm of the digestive system, is an extremely malignant tumor that is characterized by locally advanced or metastatic disease at diagnosis. Its 5-year survival rate is <5%.1 Only ~10% to 20% of people undergo resection, yet the majority of them (~80%) still achieve <2 years’ median survival after surgery.2 At present, researchers are devoting great attention to identifying biologically targeted therapies and chemotherapeutic drugs to develop a comprehensive treatment for pancreatic tumors.

Interleukin (IL)-32 was previously reported as natural killer transcript 4, which has been described.3,4 This cytokine is primarily elevated in activated T lymphocytes, natural killer cells, and epithelial cells. The gene encoding IL-32 is located on human chromosome 16p13.3 and comprises a 705 bp coding sequence that is organized into eight exons. There are six major splice variants (IL-32α, IL-32β, IL-32γ, IL-32δ, IL-32ε, and IL-32ζ), and a particular subtype has been reported. IL-32α is the most common transcript.59 This protein has various roles in inflammation, cancer, and autoimmune diseases and participates in cell apoptosis, cancer cell growth inhibition, accentuation of inflammation, and angiogenesis. Several studies have indicated that IL-32 is a typical pro-inflammatory cytokine that enhances the secretion of IL-1β, tumor necrosis factor-α, IL-6, and IL-8 through the p38 mitogen-activated protein kinase, nuclear factor-κB, and JNK signal transduction pathways.10,11 However, the role of IL-32α in pancreatic cancer invasion and metastasis has not yet been elucidated.

Metastasis of pancreatic tumor cells is associated with epithelial–mesenchymal transition (EMT), and epithelial cells obtain new mesenchymal features through EMT. EMT is a key biological process in cancer progression by which incipient tumor cells lose their apical–basal polarity, dissolve cell–cell junctions, gain invasive and migratory properties, and increase in drug resistance, resulting in escape from the preinvasive neoplasm, invasion to the edge of the normal tissue, and migration to distant areas.12,13 Previous studies have shown that EMT is an essential process in invasion and metastasis in various human epithelial carcinomas, including pancreatic cancer. The loss of E-cadherin expression and the overexpression of many mesenchymal markers, such as Vimentin, N-cadherin, Snail, Slug, Twist, Zeb1, and Zeb2, are generally regarded as markers of the EMT process.14,15 It is well known that tumor invasion and metastasis occur through an intricate and multistep process. Dissolving the extracellular matrix is also a key sign of invasion and metastasis in pancreatic cancer. Extracellular matrix metalloproteinases (MMPs) can degrade the cell basal lamina and extracellular matrix, and these enzymes maintain a balance with tissue inhibitors of metalloproteinases, which play vital roles in the invasion and metastasis of malignant tumors.16,17

Signal transducer and activator of transcription 3 (STAT3) plays an important role in EMT. STAT3, a potential therapeutic target in pancreatic cancer, results from the phosphorylation of a conserved tyrosine residue. Two STAT3 monomers form a homodimer (p-STAT3) through reciprocal phosphotyrosine–SH2 tyrosine interaction. The dimer translocates into the nucleus and binds to response elements, thus regulating the transcription of target genes and modulating fundamental cellular processes, such as apoptosis, invasion, and metastasis.18,19 Several extracellular signals, including some cytokines and growth factors, can trigger the JAK/STAT3 signaling pathway and induce a cascade of biological processes.20,21 IL-6 secretion increases remarkably in the pancreatic tumor microenvironment, and this increase is significantly related to the invasion and metastasis of pancreatic cancer.22 Moreover, JAK/STAT3 signaling is constitutively activated by IL-6 and frequently observed in various human cancers, including pancreatic cancer.2325

In this context, we attempted to assess the function of IL-32α in pancreatic cancer. Our results show that IL-32α can inactivate novel JAK2/STAT3 signaling, with the additional effect of reversing IL-6-induced EMT, invasion, and metastasis in pancreatic cancer cells.

Materials and methods

Reagents

Recombinant human IL-32α was purchased from Sino Biological Inc. (Beijing, People’s Republic of China), and recombinant IL-6 was obtained from Pepro Tech (Rocky Hill, NJ, USA). Dimethyl sulfoxide and fetal calf serum were purchased from Sigma-Aldrich (St Louis, MO, USA). Dulbecco’s Modified Eagle’s Medium (DMEM), Roswell Park Memorial Institute medium-1640 (RPMI-1640), trypsin-ethylenediaminetetraacetic acid penicillin, streptomycin, and TRIzol were obtained from Gibco-BRL (Thermo Fisher Scientific. Waltham, MA, USA). Antibodies against phospho-JAK2, JAK2, phospho-STAT3 (Tyr705), STAT3, E-cadherin, N-cadherin, Vimentin, Snail, Zeb1, MMP2, MMP9, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were obtained from Cell Signaling Technology Inc. (Boston, MA, USA). Horseradish peroxidase-conjugated goat antirabbit/mouse secondary antibodies were purchased from Bio-World Co (Nanjing, People’s Republic of China).

Cell lines and culture conditions

The human pancreatic cancer cell lines PANC-1 and SW1990 were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, People’s Republic of China). The PANC-1 cell line was cultured with DMEM, and the SW1990 cell line was maintained in RPMI-1640 supplemented with 10% fetal calf serum containing 100 µ/mL penicillin and 100 µg/mL streptomycin. Cancer cells were cultured in a humidified incubator with 5% CO2 and at 37°C. No ethical approval was required for this set of experiments because the experiments were performed on commercially available cell lines, and the ethical committee of the First Affiliated Hospital of Wenzhou Medical University deems approval unnecessary for such studies.

Quantification by real-time PCR

Total RNA was isolated from pancreatic cancer cells according to the manufacturer’s instructions for the TRIzol Reagent. Subsequently, a spectrophotometer was used to determine the purity and concentration of the RNA. Single-stranded cDNA was then synthesized using a One-Step RT-polymerase chain reaction (PCR) kit (Thermo Fisher Scientific, Waltham, MA, USA). We obtained the amplified cDNAs by PCR using an ABI Prism 7500 real-time system (Applied Biosystems). The RT-PCR thermal cycler protocol consisted of initial denaturation at 95°C for 10 minutes, denaturation at 95°C for 15 seconds, and annealing and extension at 62°C for 60 seconds. The primer sequences are listed in Table 1.

Table 1.

The primers used in real-time PCR

Gene Sense (5′-3′) Antisense (5′-3′)
E-cadherin TCACGCTGTGTCATCCAACGG TAGGTGTTCACATCATCGTCCGC
N-cadherin CATCATCATCCTGCTTATCCTTGT GGTCTTCTTCTCCTCCACCTTCTT
Vimentin AATCCAAGTTTGCTGACCTCTCTGA ACTGCACCTGTCTCCGGTACTC
Snail CTTCTCCTCTACTTCAGTCTCTTCC TGAGGTATTCCTTGTTGCAGTATTT
Zeb1 CGCTTCTCACACTCTGGGTCTTATT CCTCTTCCCTTGTAAACTCTCT
MMP2 GGGGGAAGATGCTGCTGTT AGCGGTCCTGGCAGAAATAG
MMP9 CAGTCCACCCTTGTGCTCTTCC CATCTCTGCCACCCGAGTGTAAC
MMP7 AGTGAGCTACAGTGGGAACAGGC CATTATTTCTATGACGCGGGAGT
GAPDH GGGTGTGAACCATGAGAAGTATG GATGGCATGGACTGTGGTCAT

Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; MMP, matrix metalloproteinase; PCR, polymerase chain reaction.

Western blotting analysis

Pancreatic cancer cells were collected and lysed in RIPA Lysis Buffer (Beyotime, Shanghai, People’s Republic of China) after treatment. Subsequently, protein concentrations were determined using a protein assay kit (Beyotime). Lysates containing 50 µg of protein were dissolved in loading buffer with SDS and heated for 5 minutes at 100°C. Next, the sample was separated by 8%–12% SDS-PAGE at 55 V for 30 minutes and 110 V for 90 minutes. Then, the protein was transferred onto PVDF membranes by wet blotting. The PVDF membranes were incubated in Tris-Buffered Saline with Tween 20 (TBS-T) buffer containing 5% defatted milk and TBS-T at room temperature for 1.5 hours, after which the membranes were immersed in solutions containing the primary antibodies, including anti-p-JAK2 and anti-JAK2 (1:1,000 dilution), anti-p-STAT3, and anti-STAT3 (1:2,000 dilution), anti-MMP2 and anti-MMP9 (1:1,000 dilution), anti-E-cadherin, anti-N-cadherin, anti-Vimentin, anti-Snail, and anti-ZEB1 (1:1,000 dilution), and anti-GAPDH (1:1,000 dilution) at 4°C overnight.

After incubation with primary antibodies, the membrane was washed three times with TBS-T for 5 minutes each time. The membranes were probed with a horseradish peroxidase-conjugated rabbit IgG or mouse IgG secondary antibody (1:5,000 dilution) for 1.5 hours at room temperature. After washing with TBS-T, the signal was detected using Amersham TM ECL TM Prime, and the expression levels of the specific proteins were quantified and captured using Image Quant TM 400.

Immunofluorescence staining

The pancreatic cancer cell lines PANC-1 and SW1990 were maintained on cover glasses in an incubator for 24 hours according to a previously described method. Then, the cells were washed with phosphate-buffered saline (PBS) and fixed in 4% paraformaldehyde for 15 minutes at 37°C. Cell membranes were perforated using PBS containing 0.3% Triton X-100 for 10 minutes. After the cells were saturated with PBS containing 10% goat serum (Beyotime) for 1.5 hours, they were incubated with anti-N-cadherin (1:200 dilution) and anti-Vimentin (1:200 dilution) in PBS overnight. After that, the cells were washed three times with PBS at room temperature, followed by incubation with secondary antibody conjugated with AlexaFluor 488 to detect Vimentin and N-cadherin. The samples were washed with PBS three times, and the cells nuclei were stained with 4′,6-diamidino-2-phenylindole (Beyotime). Finally, the glass slides were photographed using an automated upright microscope system (Leica, DM4000B Leica Microsystems, Wetzlar, Germany).

Wound healing assay

To assess cell motility, confluent cells were seeded in 6 cm culture dishes, and after the cells were grown to 80%–90% confluence, a wound ~500 µm was created as a linear scratch using a sterile p200 pipette tip. The cells were washed twice with PBS and incubated for 24 hours in serum-free DMEM (for PANC-1) or serum-free RPMI-1640 (for SW1990) containing 25 µg/mL IL-32α and/or 100 ng/mL IL-6. The images of cell migration were captured microscopically at 0 and 24 hours after wounding. The wound area was captured using Image Pro Plus. The migration rate = (wound area/wound height after 0 hour – wound area/wound height after 24 hours)/24.

Transwell invasion assay

The invasive abilities of PANC-1 and SW1990 were investigated using a particular invasion chamber (BD Biosciences, San Jose, CA, USA), and an 8 µm porosity polyethylene terephthalate membrane with basement membrane matrix was inserted (Corning Incorporated, Corning, NY, USA). Culture medium containing 10% fetal bovine serum (FBS) was placed in the lower compartment as a chemical inducer. After treatment with IL-32α (25 µg/mL) and/or IL-6 (100 ng/mL), 105 pancreatic cancer cells (PANC-1 or SW1990) that had been cultivated in 0.2 mL medium RPMI-1640 (for SW1990) or DMEM (for PANC-1) with 0.2% bovine serum albumin were placed in the upper compartment and incubated at 37°C for 24 hours. Then, the cells on the upper surface of the filter were removed by scraping. Subsequently, the filters were washed with PBS three times and fixed for 20 minutes using 4% paraformaldehyde. Afterward, the cells in the lower compartment were stained with crystal violet. Finally, the cells that invaded across the basement membrane to the lower compartment of the filter were counted under an automated upright microscope system (Leica, DM4000B).

Statistical analysis

All experiments were repeated three times, and data are expressed as the mean ± standard deviation. Student’s t-test was used to assess significance by checking the statistical correlation of data between groups. Differences with P<0.05 were considered to be statistically significant. All analyses were performed using SPSS 19.0 software (IBM Corporation, Armonk, NY, USA).

Results

Inhibition of EMT by IL-32α in a dose-dependent manner in pancreatic cancer cell lines

In our experiment, we used serum-free medium to avoid the growth factors that are contained in serum. We treated PANC-1 and SW1990 with 0, 10, 25, and 50 µg/mL concentrations of IL-32α, respectively. Then, the EMT of pancreatic cancer cells was assessed after treatment with IL-32α for 24 hours.

First, we investigated EMT-related genes in pancreatic cancer cell lines. The mRNA levels of E-cadherin gene (CDH1), N-cadherin gene (CDH2), Vimentin, Snail, and Zeb1 were quantified by real-time PCR as shown in Figure 1A and B, and the results suggested that IL-32α reduced the mRNA expression of N-cadherin gene (CDH2), Vimentin, Snail, and Zeb1 and increased the mRNA expression of E-cadherin gene (CDH1) in a dose-dependent manner. However, the expression of Snail mRNA was increased when treated with IL-32α in SW1990 cell lines.

Figure 1.

Figure 1

Figure 1

Dose-dependent inhibition of EMT in SW1990 and PANC-1 cell lines by IL-32α.

Notes: (A, B) Fold change in mRNA expression of Vimentin, CDH1 (E-cadherin), CDH2 (N-cadherin), snail, and Zeb1 in PANC-1 and SW1990 cells; GAPDH was used as an endogenous control. (CF) The expression of E-cadherin, N-cadherin, Snail, Zeb1, and Vimentin was measured by Western blotting using IL-32α in PANC-1 and SW1990. GAPDH was used as a loading control. The relative densities of each group are presented in graphs (D) and (F). (G, H) Expression of N-cadherin and Vimentin detected by immunofluorescence. Minimal staining (membranous expression of N-cadherin and Vimentin) was observed in PANC-1 and SW1990 cells after incubation with IL-32α for 24 hours. PANC-1 and SW1990 cell lines were treated with IL-32α at concentrations of 0, 10, 25, and 50 µg/mL for 24 hours. Data are represented as the mean ± SEM, n=3, *P<0.05 vs 0 µM group; #P<0.05 vs 10 µM group; &P<0.05 vs 25 µM group. Magnification details are as follows; PANC-1N-cadherin 400×; PANC-1Vimentin 400×; SW1990 N-cadherin 200×; SW1990 Vimentin 400×. Comparisons among multiple groups were made with a one-way analysis of variance followed by Least Significant Difference or Dunnett’s t-test.

Abbreviations: DAPI, 4′,6-diamidino-2-phenylindole; EMT, epithelial–mesenchymal transition; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL, interleukin; mRNA, messenger RNA; SEM, standard error of mean.

We also detected several protein levels by Western blotting, including the epithelial-like marker E-cadherin and the mesenchymal-like markers N-cadherin, Vimentin, Snail, and Zeb1. As shown in Figure 1C–F, N-cadherin, Vimentin, Snail, and Zeb1 expression levels are reduced, while the protein levels of E-cadherin are increased after treatment with IL-32α in a dose-dependent manner.

To verify that IL-32α suppressed the process of EMT, the cellular protein levels of N-cadherin and Vimentin were examined by immunofluorescence, and the results showed that these two proteins, which can inhibit EMT, were increased after IL-32α treatment in a dose-dependent manner (Figure 1G and H). N-cadherin and Vimentin are well-defined mesenchymal-like markers for EMT. The progression of EMT is always associated with expression levels of N-cadherin and Vimentin. Taken together, our findings revealed that IL-32α was able to reverse the EMT process in the PANC-1 and SW1990 cell lines.

Effect of IL-32α on the expression of genes associated with invasion and metastasis in pancreatic cancer cell lines

Cadherin switching (from E-cadherin to N-cadherin) and increased expression of MMPs are related to the acquisition of invasiveness and metastatic potential in cancer cells. To investigate the effects of IL-32α on pancreatic cancer cell invasion and metastasis, we analyzed the mRNA expression of MMP2, MMP7, MMP9, CDH1, and CDH2 by real-time PCR (Figures 1A and B and 2A and B). Decreased mRNA levels of MMP2, MMP7, and CDH2 in combination with elevated mRNA levels of CDH1 and MMP9 after IL-32α treatment suggested that IL-32α can reverse EMT in pancreatic cancer cell lines. IL-32α also suppressed the protein levels of MMP2 and MMP9 in a dose-dependent manner (Figure 2C–F). Furthermore, IL-32α upregulated the protein expression of E-cadherin, whereas the N-cadherin protein level was decreased (Figure 1C–F). It is well known that E-cadherin can increase the ability to form cell–cell junctions and, thus, adhesion. As shown earlier, our results indicated that IL-32α partially inhibited metastasis and invasion by affecting proteolytic activation and adhesive activity.

Figure 2.

Figure 2

Effect of IL-32α on the expression of genes associated with invasion and metastasis in pancreatic cancer cell lines.

Notes: (A, B) Fold change in mRNA expression of MMP2, MMP7, and MMP9 in PANC-1 and SW1990 cells. GAPDH was used as an endogenous control. (CF) The expression of MMP2 and MMP9 was measured by Western blotting after treatment with IL-32α in PANC-1 and SW1990. GAPDH was used as a loading control. The relative densities of each group are presented in graphs (D) and (F). PANC-1 and SW1990 cell lines were treated with IL-32α at concentrations of 0, 10, 25, and 50 µg/mL for 24 hours. Data are represented as the mean ± SEM, n=3, *P<0.05 vs 0 µM group; #P<0.05 vs 10 µM group; &P<0.05 vs 25 µM group. Comparisons among multiple groups were made with a one-way analysis of variance followed by Least Significant Difference or Dunnett’s t-test.

Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL, interleukin; MMPs, metalloproteinases; mRNA, messenger RNA; SD, standard deviation; SEM, standard error of mean.

Suppression of activation of JAK2/STAT3 signaling proteins following exogenous IL-32α treatment in pancreatic cancer cell lines PANC-1 and SW1990

The JAK/STAT3 pathway is known to be involved in the EMT process and MMP expression in pancreatic cancer. Our Western blotting results showed that exogenous IL-32α inhibited JAK2, p-JAK2, and p-STAT3 in a dose-dependent manner but had little effect on STAT3 expression (Figure 3A–D).

Figure 3.

Figure 3

Dose-dependent inactivation of JAK2/STAT3 signaling in SW1990 and PANC-1 cells by IL-32α.

Notes: (AD) The expression of the signaling proteins JAK2, p-JAK2, STAT3, and p-STAT3 measured by Western blotting after treatment with various concentrations of IL-32α for 24 hours in PANC-1 and SW1990 cells. The relative densities of each group are presented in graphs (B) and (D). PANC-1 and SW1990 cell lines were treated with IL-32α at concentrations of 0, 10, 25, and 50 µg/mL for 24 hours. Data are represented as the mean ± SEM, n=3, *P<0.05 vs 0 µM group; #P<0.05 vs 10 µM group; &P<0.05 vs 25 µM group.

Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL, interleukin; mRNA, messenger RNA; SEM, standard error of mean.

Exogenous IL-32α inhibits IL-6-induced EMT of pancreatic cancer cell lines PANC-1 and SW1990

Many studies have shown that IL-6 can induce EMT in various cancers. Our results also revealed that human recombinant IL-6 (100 ng/mL) induced EMT in PANC-1 and SW1990 (Figure 4A–F). We observed changes in cell morphology; in particular, a transition to a spindle-shaped morphology was detectable in the PANC-1 and SW1990 cell lines after treatment with IL-6 for 24 hours (Figure 4G and H). Our studies indicated that EMT characteristics and JAK2/STAT3 activity were both inhibited by IL-32α (Figures 1 and 3). Growing evidence has suggested that stimulation of the JAK/STAT3 sig-naling pathway might enhance the process of EMT in cancer cells.21,25 IL-6 has been used to activate the JAK2/STAT3 signaling pathway in vitro.24 Hence, we attempted to suppress the JAK2/STAT3 signaling by treatment with IL-32α and activate it by treatment with IL-6 in pancreatic cancer cells. Then, we observed the effects on EMT-related molecular markers. We found that IL-32α stimulation decreased levels of p-JAK2, JAK2, and p-STAT3 in cells induced with IL-6, although total STAT3 levels did not change in cells treated with IL-6 and/or IL-32α (Figure 5A–D). Moreover, our Western blotting analysis demonstrated that IL-32α exerted significant effects on the expression of important EMT markers, including E-cadherin, N-cadherin, Vimentin, Snail, and Zeb1, in PANC-1 and SW1990 cells induced with IL-6 for 24 hours (Figure 4C–F).

Figure 4.

Figure 4

Inhibition of IL-6-induced EMT in PANC-1 and SW1990 cell lines following treatment with IL-32α.

Notes: (A, B) Fold change in mRNA expression of Vimentin, CDH1, CDH2, Zeb1, and Snail in PANC-1 and SW1990 cells. GAPDH was used as an endogenous control. (CF) Protein expression levels of E-cadherin, N-cadherin, Vimentin, Snail, and Zeb1 were examined by Western blotting for 24 hours in PANC-1 and SW1990 cells. GAPDH was used as a loading control. The relative densities of each group are presented in graphs (D) and (F). (G, H) Morphological changes after treatment with IL-6 (100 ng/mL) in PANC-1 and SW1990 cells. Cell morphology was observed under an inverted phase-contrast microscope. Original magnification: ×100. PANC-1 and SW1990 cell lines were treated with IL-6 at 100 ng/mL in FBS-free media, and then IL-32α was added at a concentration of 25 µg/mL for 24 hours. Data are represented as the mean ± SEM, n=3, *P<0.05 vs 0 µM group; #P<0.05 vs 10 µM group; &P<0.05 vs 25 µM group. 200× magnification.

Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL, interleukin; mRNA, messenger RNA; SEM, standard error of mean; EMT, epithelial–mesenchymal transition.

Figure 5.

Figure 5

Inactivation of IL-6-induced JAK2/STAT3 signaling pathway in PANC-1 and SW1990 cell lines following treatment with IL-32α.

Notes: (AD) Protein expression levels of JAK2, p-JAK2, STAT3, and p-STAT3 were examined by Western blotting for 24 hours in PANC-1 and SW1990 cells. GAPDH was used as a loading control. The relative densities of each group are presented in graphs (B) and (D). PANC-1 and SW1990 cell lines were treated with IL-6 at 100 ng/mL in FBS-free media and treated with IL-32α at a concentration of 25 µg/mL for 24 hours. Data are represented as the mean ± SEM, n=3, *P<0.05 vs 0 µM group; #P<0.05 vs 10 µM group; &P<0.05 vs 25 µM group.

Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL, interleukin; SEM, standard error of mean.

Using real-time PCR, we also determined the mRNA levels of E-cadherin, N-cadherin, Vimentin, Snail, and Zeb1 in IL-6-induced PANC-1 and SW1990 cells after treatment with IL-32α for 24 hours (Figure 4A and B). The real-time PCR results were in line with the Western blotting results, which indicated that the mesenchymal markers N-cadherin, Snail, Vimentin, and Zeb1 presented the same variation on this trend as p-STAT3, whereas E-cadherin changed oppositely. Taken together, these data showed that exogenous IL-32α inhibited IL-6-induced EMT as well as inactivating the JAK2/STAT3 signaling pathway in the pancreatic cancer cell lines PANC-1 and SW1990.

Exogenous IL-32α inhibits IL-6-induced migration and invasion of pancreatic cancer cell lines PANC-1 and SW1990

Our results also demonstrated that IL-6 can enhance the expression of genes that facilitate metastasis and invasion, as determined by Western blotting and real time-PCR (Figure 6A–F). Additionally, to evaluate the effects on the metastasis and invasiveness of pancreatic cancer cells treated with IL-32α and IL-6, we performed wound assays and invasion assays in vitro. Our experimental results indicated that IL-6 not only enhanced the migration rate but also promoted the invasiveness of the pancreatic cancer cell lines PANC-1 and SW1990 (P<0.05) (Figure 7A–D). Subsequently, we investigated whether IL-32α could weaken the IL-6-induced invasiveness and metastasis in PANC-1 and SW1990 cells induced with IL-6. After treatment with IL-32α, the mRNA levels of MMP2, MMP7, and MMP9 and the protein expression of MMP2 and MMP9 were significantly decreased in IL-6-induced PANC-1 and SW1990 (Figure 6A–F). According to the migration rate determined for each image and the number of invasive cells found on every filter, IL-32α markedly reduced the metastasis and invasiveness of PANC-1 and SW1990 cells (P<0.05) compared with IL-6-treated cells (Figure 7A–D). Taken together, our study results indicated that IL-32α was able to weaken IL-6-induced migration and invasion in the pancreatic cancer cell lines PANC-1 and SW1990.

Figure 6.

Figure 6

IL-32α inhibition of IL-6-induced MMP secretion in PANC-1 and SW1990 cell lines.

Notes: (A, B) Fold change in mRNA expression of MMP2, MMP7, and MMP9 in PANC-1 and SW1990 cells. GAPDH was used as an endogenous control. (CF) Protein expression levels of MMP2 and MMP7 were examined by Western blotting for 24 hours in PANC-1 and SW1990 cells. GAPDH was used as a loading control. The relative densities of each group are presented in graphs (D) and (F). PANC-1 and SW1990 cell lines were treated with IL-6 at 100 ng/mL in FBS-free media, and then IL-32α was added at a concentration of 25 µg/mL for 24 hours. Data are represented as the mean ± SEM, n=3, *P<0.05 vs 0 µM group; #P<0.05 vs 10 µM group; &P<0.05 vs 25 µM group.

Abbreviations: GAPDH, glyceraldehyde 3-phosphate dehydrogenase; IL, interleukin; MMPs, matrix metalloproteinases; mRNA, messenger RNA; SEM, standard error of mean.

Figure 7.

Figure 7

IL-32α inhibition of IL-6-induced metastasis and invasiveness in PANC-1 and SW1990 cell lines.

Notes: (A) The wound healing assay was performed in various treatment groups of PANC-1 and SW1990 cells. Original magnification: ×40. (B) Analysis of the migration rate after wounding in various treatment groups of PANC-1 and SW1990 cells. (C) The invasion assay was performed in various treatment groups of PANC-1 and SW1990 cells using a specialized invasion chamber. The blue-stained cells were those that invaded the ECMatrix and migrated through the polycarbonate membrane to the lower surface of the membrane (original magnification: ×200). (D) The number of invaded cells per image in various treatment groups of PANC-1 and SW1990 cells. The results are presented as the mean ± SD of experiments performed in triplicate. Data are represented as the mean ± SEM, n=3, *P<0.05 vs 0 µM group. Adobe Photoshop CS6 was used to merge the immunofluorescence images. Graph Pad Prism 6 Demo was used to create bar graphs. Western blotting was analyzed using Image Lab.PANC-1 and SW1990 cell lines were treated with IL-6 (100 ng/mL) alone or in combination with IL-32α (25 µg/mL) for 24 hours. 400× magnification.

Abbreviations: ECMatrix, basement membrane matrix; IL, interleukin; SD, standard deviation; SEM, standard error of mean.

Discussion

Previous studies indicated that IL-32α was involved in many tumor biological processes, including promoting inflammation, angiogenesis, and cell apoptosis. However, its effects on pancreatic cancer metastasis and EMT-relevant signaling pathways had not yet been revealed. In this study, we found that exogenous IL-32α could deactivate JAK2/STAT3 signaling and suppress EMT and MMP secretion in pancreatic cancer cells in a dose-dependent manner. IL-6 was used to induce EMT and facilitate invasiveness and metastasis in pancreatic tumor cells in our study, and we found that IL-32α could reverse IL-6-induced EMT, invasiveness, and metastasis in pancreatic cancer cells in vitro.

Pancreatic carcinoma is one of the most malignant tumor diseases. It is believed that the high invasiveness of pancreatic cancer cells plays a critical role in the disastrous prognoses associated with this disease. EMT is a pivotal biological process in cancer progression that enables the initial tumor cells to obtain invasive and metastatic properties.12 It has been reported that EMT has close relationships with lymph node metastasis, portal vein invasion, and long-term survival in pancreatic carcinoma.26,27 Therefore, EMT is becoming an increasingly important potential clinical target of pancreatic cancer therapy. In our research, IL-32α was shown to reverse the EMT phenotype of pancreatic cancer (Figure 1). We believe that this finding indicates that IL-32α has the potential power to influence the biological properties of pancreatic cancer. Another significant factor was MMPs, which have been regarded as effective regulators of invasion and metastasis in pancreatic cancer.28 MMPs are a family of endopeptidases with proteolytic activity to degrade the basement membrane in the process of EMT. MMP secretion has been verified to increase invasiveness, induce chemoresistance, and promote angiogenesis in pancreatic cancer.2931 In our research, we confirmed that the pancreatic cancer cell lines PANC-1 and SW1990 secrete high levels of MMP2, MMP7, and MMP9 and that these MMPs were downregulated by IL-32α. Regarding the influence of IL-32 on EMT, migration, and invasion, researchers hold different or even opposite views. Jeong et al32 reported that dysregulation of IL-32β stimulates migration through the VEGF-STAT3 signaling pathway. IL-32 has also been reported to facilitate MMP2 and MMP9 expression in primary lung adenocarcinoma via nuclear factor-κB activation.33 Interleukin-32 contributes to invasion and metastasis of primary lung adenocarcinoma via NF-kappaB induced matrix metalloproteinases 2 and 9 expression. Interleukin-32β stimulates migration of MDA-MB-231 and MCF-7cells via the VEGF-STAT3 signaling pathway. First, we thought that different types and amounts of IL-32 receptors are expressed in different types of cancer, which could explain the different effects caused by IL-32 isoforms. Moreover, we accidentally found that high concentrations of IL-32α can increase the expression of proteins associated with apoptosis in vitro (data not shown). Thus, different concentrations of IL-32α were considered to be another factor influencing EMT, migration, and invasion.

It has been reported that secretion of IL-6 by pancreatic cancer tissues was obviously higher than that of tissue adjacent to carcinoma.34 Therefore, our research employed IL-6 to induce EMT via the activation of the JAK2/STAT3 signaling pathway in pancreatic cancer cells to simulate the tumor microenvironment in vivo. Numerous studies have indicated that elevated levels of IL-6 protein and mRNA in serum and tumor samples from patients with pancreatic cancer are related to increased tumor size, lymphatic metastasis, distant metastasis, and tumor progression.35,36 In our study, IL-6 also induced EMT and enhanced the expression of MMPs, including MMP2, MMP7, and MMP9, in vitro. IL-6, which is secreted by cancer cells and macrophages in the tumor microenvironment, directly binds to its receptor to activate JAKs through certain downstream signaling pathways; in turn, this process increases the activation of STAT3, which is involved in pancreatic cancer initiation and metastasis. Our results showed that IL-6 activation of the JAK2/STAT3 signaling pathway was suppressed by IL-32α, which was consistent with its effects on the expression of genes associated with metastasis and invasion. Moreover, it has been confirmed that the IL-6/JAK2/STAT3 pathway plays an important role in pancreatitis-induced, Kras-dependent pancreatic carcinogenesis.37,38 As a potent inhibitor of JAK2/STAT3 signaling, IL-32α also shows the potential ability to block pancreatic cancer initiation.

Moreover, during our study, we assessed the autonomous phosphorylation of STAT3 (p-STAT3) in four pancreatic cancer cell lines: SW1990, PANC-1, AsPC-1, and BxPC-3. All four cell lines showed high levels of autonomous p-STAT3. Although it is not considered to be a classic pathway interacting with EMT, a recent study confirmed that STAT3 was also shown to contribute to EMT through comprehensive alterations of transcription factors, such as Zeb1.39,40 Our study, however, found that Zeb1 expression levels were increased by the elevation of p-STAT3 signaling in PANC-1 and SW1990 cells, which was in accordance with previous studies. We thought that the significant suppression of high levels of autonomous p-STAT3 by IL-32α could explain its effects of inhibiting EMT and invasiveness in pancreatic cancer but promoting these properties in some other types of cancer. High levels of p-STAT3 may play an important role in sustaining the EMT state and invasiveness in pancreatic cancer cells. Finally, we cannot rule out the possibility of other latent mechanisms conducive to the suppression of IL-6-induced EMT, migration, and invasion by IL-32α. Based on the earlier evidence, the relationship between the effect of IL-32α on EMT and the effect of IL-32α on tumor migration and invasion still requires further investigation.

Our study suggested that IL-32α might have the potential for clinical application as an adjuvant treatment for pancreatic cancer. Clinical pancreatic cancer often shows high invasiveness and a very short course before death. The inhibition of EMT and MMPs by IL-32α might postpone the progression of pancreatic cancer. As IL-32α is an endogenous cytokine, we deem that its upregulation would be a potential strategy to suppress invasion, metastasis, and chemoresistance. This approach would have some distinct advantages compared to traditional chemotherapeutic drugs. For example, IL-32α lacks immunogenicity and has low cytotoxicity, and patients may experience reductions in most side effects and myelosuppression caused by traditional chemotherapeutic agents. Of course, all of these biological functions need further study in vivo.

In conclusion, we found that exogenous IL-32α deactivates JAK2/STAT3 signaling, reverses the process of EMT, and decreases MMP secretion in pancreatic cancer cells. Additionally, our investigation suggests that IL-6-induced EMT, migration, and invasion can be inhibited by IL-32α. Thus, IL-32α may be a potential drug and the JAK2/STAT3 signaling pathway may represent novel potential targets for pharmacological intervention in the management of pancreatic cancer EMT, metastasis, and invasiveness in the future.

Acknowledgments

This work was partly supported by the National Health and Family Planning Commission of Zhejiang Province (2013ZDA014) and the National College Students Innovation and Entrepreneurship Training Program (No 20140343003).

Footnotes

Disclosure

The authors report no conflicts of interest in this work.

References

  • 1.Humphris JL, Johns AL, Simpson SH, et al. Clinical and pathologic features of familial pancreatic cancer. Cancer. 2014;120(23):3669–3675. doi: 10.1002/cncr.28863. [DOI] [PubMed] [Google Scholar]
  • 2.Butturini G, Stocken DD, Wente MN, et al. Influence of resection margins and treatment on survival in patients with pancreatic cancer: meta-analysis of randomized controlled trials. Arch Surg. 2008;143(1):75–83. doi: 10.1001/archsurg.2007.17. [DOI] [PubMed] [Google Scholar]
  • 3.Ishigami S, Arigami T, Uchikado Y, et al. IL-32 expression is an independent prognostic marker for gastric cancer. Med Oncol. 2013;30(2):472. doi: 10.1007/s12032-013-0472-4. [DOI] [PubMed] [Google Scholar]
  • 4.Shoda H, Fujio K, Yamaguchi Y, et al. Interactions between IL-32 and tumor necrosis factor alpha contribute to the exacerbation of immune-inflammatory diseases. Arthritis Res Ther. 2006;8(6):R166. doi: 10.1186/ar2074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Shioya M, Nishida A, Yagi Y, et al. Epithelial overexpression of interleukin-32alpha in inflammatory bowel disease. Clin Exp Immunol. 2007;149(3):480–486. doi: 10.1111/j.1365-2249.2007.03439.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Park ES, Yoo JM, Yoo HS, Yoon DY, Yun YP, Hong J. IL-32gamma enhances TNF-alpha-induced cell death in colon cancer. Mol Carcinog. 2014;53(Suppl 1):E23–E35. doi: 10.1002/mc.21990. [DOI] [PubMed] [Google Scholar]
  • 7.Oh JH, Cho MC, Kim JH, et al. IL-32gamma inhibits cancer cell growth through inactivation of NF-kappaB and STAT3 signals. Oncogene. 2011;30(30):3345–3359. doi: 10.1038/onc.2011.52. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Nold-Petry CA, Rudloff I, Baumer Y, et al. IL-32 promotes angiogenesis. J Immunol. 2014;192(2):589–602. doi: 10.4049/jimmunol.1202802. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Chen Q, Carroll HP, Gadina M. The newest interleukins: recent additions to the ever-growing cytokine family. Vitam Horm. 2006;74:207–228. doi: 10.1016/S0083-6729(06)74008-0. [DOI] [PubMed] [Google Scholar]
  • 10.Kang YH, Park MY, Yoon DY, et al. Dysregulation of overexpressed IL-32alpha in hepatocellular carcinoma suppresses cell growth and induces apoptosis through inactivation of NF-kappaB and Bcl-2. Cancer Lett. 2012;318(2):226–233. doi: 10.1016/j.canlet.2011.12.023. [DOI] [PubMed] [Google Scholar]
  • 11.Kim SH, Han SY, Azam T, Yoon DY, Dinarello CA. Interleukin-32: a cytokine and inducer of TNFalpha. Immunity. 2005;22(1):131–142. doi: 10.1016/j.immuni.2004.12.003. [DOI] [PubMed] [Google Scholar]
  • 12.Thiery JP. Epithelial-mesenchymal transitions in tumour progression. Nat Rev Cancer. 2002;2(6):442–454. doi: 10.1038/nrc822. [DOI] [PubMed] [Google Scholar]
  • 13.Sorrentino C, Di Carlo E. Expression of IL-32 in human lung cancer is related to the histotype and metastatic phenotype. Am J Respir Crit Care Med. 2009;180(8):769–779. doi: 10.1164/rccm.200903-0400OC. [DOI] [PubMed] [Google Scholar]
  • 14.Huang C, Yang G, Jiang T, Zhu G, Li H, Qiu Z. The effects and mechanisms of blockage of STAT3 signaling pathway on IL-6 inducing EMT in human pancreatic cancer cells in vitro. Neoplasma. 2011;58(5):396–405. doi: 10.4149/neo_2011_05_396. [DOI] [PubMed] [Google Scholar]
  • 15.Shaul YD, Freinkman E, Comb WC, et al. Dihydropyrimidine accumulation is required for the epithelial-mesenchymal transition. Cell. 2014;158(5):1094–1109. doi: 10.1016/j.cell.2014.07.032. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Bramhall SR. Stromal degradation by the malignant epithelium in pancreatic cancer and the therapeutic potential of proteolytic inhibition. J Hepato-biliary Pancreat Surg. 1998;5(4):392–401. doi: 10.1007/s005340050063. [DOI] [PubMed] [Google Scholar]
  • 17.Lukaszewicz M, Mroczko B, Szmitkowski M. The role of metalloproteinases and their inhibitors in pancreatic cancer. Postepy Hig Med Dosw. 2008;62:141–147. [PubMed] [Google Scholar]
  • 18.Yu H, Kortylewski M, Pardoll D. Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment. Nat Rev Immunol. 2007;7(1):41–51. doi: 10.1038/nri1995. [DOI] [PubMed] [Google Scholar]
  • 19.Huang S. Regulation of metastases by signal transducer and activator of transcription 3 signaling pathway: clinical implications. Clin Cancer Res. 2007;13(5):1362–1366. doi: 10.1158/1078-0432.CCR-06-2313. [DOI] [PubMed] [Google Scholar]
  • 20.Huang C, Yang G, Jiang T, Huang K, Cao J, Qiu Z. Effects of IL-6 and AG490 on regulation of Stat3 signaling pathway and invasion of human pancreatic cancer cells in vitro. J Exp Clin Cancer Res. 2010;29:51. doi: 10.1186/1756-9966-29-51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Xiong H, Zhang Z-G, Tian X-Q, et al. Inhibition of JAK1, 2/STAT3 signaling induces apoptosis, cell cycle arrest, and reduces tumor cell invasion in colorectal cancer cells. Neoplasia. 2008;10(3):287–297. doi: 10.1593/neo.07971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Peng M, Huang B, Zhang Q, et al. Embelin inhibits pancreatic cancer progression by directly inducing cancer cell apoptosis and indirectly restricting IL-6 associated inflammatory and immune suppressive cells. Cancer Lett. 2014;354(2):407–416. doi: 10.1016/j.canlet.2014.08.011. [DOI] [PubMed] [Google Scholar]
  • 23.Yang J, Liao X, Agarwal MK, Barnes L, Auron PE, Stark GR. Unphosphorylated STAT3 accumulates in response to IL-6 and activates transcription by binding to NFkappaB. Genes Dev. 2007;21(11):1396–1408. doi: 10.1101/gad.1553707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lamy S, Akla N, Ouanouki A, Lord-Dufour S, Beliveau R. Diet-derived polyphenols inhibit angiogenesis by modulating the interleukin-6/STAT3 pathway. Exp Cell Res. 2012;318(13):1586–1596. doi: 10.1016/j.yexcr.2012.04.004. [DOI] [PubMed] [Google Scholar]
  • 25.Liu RY, Zeng Y, Lei Z, et al. JAK/STAT3 signaling is required for TGF-beta-induced epithelial-mesenchymal transition in lung cancer cells. Int J Oncol. 2014;44(5):1643–1651. doi: 10.3892/ijo.2014.2310. [DOI] [PubMed] [Google Scholar]
  • 26.Kohler I, Bronsert P, Timme S, et al. Detailed analysis of epithelial-mesenchymal transition and tumor budding identifies predictors of long-term survival in pancreatic ductal adenocarcinoma. J Gastroenterol Hepatol. 2015;30(Suppl 1):78–84. doi: 10.1111/jgh.12752. [DOI] [PubMed] [Google Scholar]
  • 27.Yamada S, Fuchs BC, Fujii T, et al. Epithelial-to-mesenchymal transition predicts prognosis of pancreatic cancer. Surgery. 2013;154(5):946–954. doi: 10.1016/j.surg.2013.05.004. [DOI] [PubMed] [Google Scholar]
  • 28.Haage A, Schneider IC. Cellular contractility and extracellular matrix stiffness regulate matrix metalloproteinase activity in pancreatic cancer cells. FASEB J. 2014;28(8):3589–3599. doi: 10.1096/fj.13-245613. [DOI] [PubMed] [Google Scholar]
  • 29.Lu G, Zheng M, Zhu Y, Sha M, Wu Y, Han X. Selection of peptide inhibitor to matrix metalloproteinase-2 using phage display and its effects on pancreatic cancer cell lines PANC-1 and CFPAC-1. Int J Biol Sci. 2012;8(5):650–662. doi: 10.7150/ijbs.3897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Su HY, Lai HC, Lin YW, et al. Epigenetic silencing of SFRP5 is related to malignant phenotype and chemoresistance of ovarian cancer through Wnt signaling pathway. Int J Cancer. 2010;127(3):555–567. doi: 10.1002/ijc.25083. [DOI] [PubMed] [Google Scholar]
  • 31.Deryugina EI, Quigley JP. Pleiotropic roles of matrix metalloproteinases in tumor angiogenesis: contrasting, overlapping and compensatory functions. Biochim Biophys Acta. 2010;1803(1):103–120. doi: 10.1016/j.bbamcr.2009.09.017. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Park JS, Choi SY, Lee JH, et al. Interleukin-32beta stimulates migration of MDA-MB-231 and MCF-7 cells via the VEGF-STAT3 signaling pathway. Cell Oncol. 2013;36(6):493–503. doi: 10.1007/s13402-013-0154-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Zeng Q, Li S, Zhou Y, et al. Interleukin-32 contributes to invasion and metastasis of primary lung adenocarcinoma via NF-kappaB induced matrix metalloproteinases 2 and 9 expression. Cytokine. 2014;65(1):24–32. doi: 10.1016/j.cyto.2013.09.017. [DOI] [PubMed] [Google Scholar]
  • 34.Holmer R, Goumas FA, Waetzig GH, Rose-John S, Kalthoff H. Interleukin-6: a villain in the drama of pancreatic cancer development and progression. Hepatobiliary Pancreat Dis Int. 2014;13(4):371–380. doi: 10.1016/s1499-3872(14)60259-9. [DOI] [PubMed] [Google Scholar]
  • 35.Ebrahimi B, Tucker SL, Li D, Abbruzzese JL, Kurzrock R. Cytokines in pancreatic carcinoma: correlation with phenotypic characteristics and prognosis. Cancer. 2004;101(12):2727–2736. doi: 10.1002/cncr.20672. [DOI] [PubMed] [Google Scholar]
  • 36.Masui T, Hosotani R, Doi R, et al. Expression of IL-6 receptor in pancreatic cancer: involvement in VEGF induction. Anticancer Res. 2002;22(6C):4093–4100. [PubMed] [Google Scholar]
  • 37.Lesina M, Kurkowski MU, Ludes K, et al. Stat3/Socs3 activation by IL-6 transsignaling promotes progression of pancreatic intraepithelial neoplasia and development of pancreatic cancer. Cancer Cell. 2011;19(4):456–469. doi: 10.1016/j.ccr.2011.03.009. [DOI] [PubMed] [Google Scholar]
  • 38.Fukuda A, Wang SC, Morris JP, et al. Stat3 and MMP7 contribute to pancreatic ductal adenocarcinoma initiation and progression. Cancer Cell. 2011;19(4):441–455. doi: 10.1016/j.ccr.2011.03.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Balanis N, Wendt MK, Schiemann BJ, Wang Z, Schiemann WP, Carlin CR. Epithelial to mesenchymal transition promotes breast cancer progression via a fibronectin-dependent STAT3 signaling pathway. J Biol Chem. 2013;288(25):17954–17967. doi: 10.1074/jbc.M113.475277. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Guo L, Chen C, Shi M, et al. Stat3-coordinated Lin-28-let-7-HMGA2 and miR-200-ZEB1 circuits initiate and maintain oncostatin M-driven epithelial-mesenchymal transition. Oncogene. 2013;32(45):5272–5282. doi: 10.1038/onc.2012.573. [DOI] [PubMed] [Google Scholar]

Articles from OncoTargets and therapy are provided here courtesy of Dove Press

RESOURCES