Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2017 Aug 1.
Published in final edited form as: Inflamm Bowel Dis. 2016 Aug;22(8):1847–1858. doi: 10.1097/MIB.0000000000000790

L-arginine Availability and Metabolism Is Altered in Ulcerative Colitis

Lori A Coburn 1,2, Sara N Horst 1,2, Margaret M Allaman 2, Caroline T Brown 2, Christopher S Williams 1,2,4, Mallary E Hodges 2, Jennifer P Druce 2,6, Dawn B Beaulieu 2, David A Schwartz 2, Keith T Wilson 1,2,3,4,5,*
PMCID: PMC4956554  NIHMSID: NIHMS765967  PMID: 27104830

Abstract

Background

L-arginine (L-Arg) is the substrate for both inducible nitric oxide (NO) synthase (NOS2) and arginase (ARG) enzymes. L-Arg is actively transported into cells via cationic amino acid transporter (SLC7) proteins. We have linked L-Arg and arginase 1 activity to epithelial restitution. Our aim was to determine if L-Arg, related amino acids, and metabolic enzymes are altered in ulcerative colitis (UC).

Methods

Serum and colonic tissues were prospectively collected from 38 controls and 137 UC patients. Dietary intake, histologic injury, and clinical disease activity were assessed. Amino acid levels were measured by HPLC. mRNA levels were measured by real-time PCR. Colon tissue samples from 12 Crohn’s disease (CD) patients were obtained for comparison.

Results

Dietary intake of arginine and serum L-Arg levels were not different in UC patients versus controls. In active UC, tissue L-Arg was decreased, while L-citrulline (L-Cit) and the L-Cit/L-Arg ratio were increased. This pattern was also seen when paired involved (left) versus uninvolved (right) colon tissues in UC were assessed. In active UC, SLC7A2 and ARG1 mRNA levels were decreased, while ARG2 and NOS2 were increased. Similar alterations in mRNA expression occurred in tissues from CD patients. In involved UC, SLC7A2 and ARG1 mRNA levels were decreased, and NOS2 and ARG2 increased, when compared to uninvolved tissues.

Conclusions

UC patients exhibit diminished tissue L-Arg, likely attributable to decreased cellular uptake and increased consumption by NOS2. These findings combined with decreased ARG1 expression, indicate a pattern of dysregulated L-Arg availability and metabolism in UC.

Keywords: amino acids, L-arginine, cationic amino acid transporter, gene expression, inflammatory bowel disease

Introduction

There are 2 main forms of inflammatory bowel disease (IBD), ulcerative colitis (UC) and Crohn’s disease (CD), with approximately 1.6 million Americans affected.1 IBD is characterized by relapsing and remitting episodes of mucosal inflammation. We have therapeutics aimed at dampening the immune dysregulation such as anti-TNF-α antibodies that have demonstrated efficacy2–4, but they are often complicated by significant adverse effects and cost considerations. In addition, anti-TNF-α antibody therapies lead to a therapeutic response in only approximately half of patients5, and the specific etiology of IBD has yet to be determined. As ongoing research continues to further define the pathophysiology of IBD to find new therapeutic targets, patients are increasingly interested in the utility of adjunctive therapy, especially dietary supplements that include micronutrients. L-arginine (L-Arg) is one supplement that has been extensively promoted in the lay media for enhancement of immunity and for use in a variety of health concerns. L-Arg is a semi-essential amino acid that is important in protein synthesis, but it can be synthesized by the body, so dietary intake is not essential to maintain nitrogen balance in normal adults.6 However, total body L-Arg may become depleted under stressful conditions.7,8

There are four enzymes that use L-Arg as a substrate: arginase, nitric oxide (NO) synthase (NOS), arginine:glycine amidinotransferase, and arginine decarboxylase.9 The arginase enzymes are the endogenous antagonists to inducible NOS (iNOS, NOS2) because they compete for the same L-Arg substrate by metabolizing it to L-ornithine (L-Orn) and urea10, whereas NOS2 metabolizes L-Arg to NO and L-citrulline (L-Cit). Arginase exists in two isoforms: arginase 1 (ARG1) is abundant in liver and is important for the urea cycle, and arginase 2 (ARG2) is abundant in kidney and localizes to mitochondria.11,12 Cellular L-Arg uptake is an active transport process mediated by the cationic amino acid transporter (CAT, SLC7) family of proteins, also known as y+ transporters.13 Four CAT proteins have been described. CAT1 (SLC7A1) is constitutively expressed.14 CAT2 (SLC7A2) is the inducible transporter, which includes the alternatively spliced isoforms CAT2A, a low affinity-transporter primarily in the liver, and CAT2B, the high-affinity L-Arg transporter known to be abundant in macrophages.15 CAT3 (SLC7A3) is found in brain and thymus, while the function of CAT4 (SLC7A4) is currently unknown.16 CAT proteins, in particular, are subject to competitive inhibition by L-Orn and L-lysine (L-Lys)16–18, which can lead to alterations in the arginine availability index (AAI)19,20, calculated as [L-Arg]/([L-Lys] + [L-Orn]).

Altered L-Arg metabolism in the alimentary tract has been described in animal models of ischemic colitis and inflammatory bowel disease.21 L-Arg supplementation attenuated the degree of tissue damage in intestinal ischemia and promoted healing of intestinal mucosa, in a rat model.22 We have previously shown in the Citrobacter rodentium infection model of murine colitis that there is a significant decrease in the serum L-Arg concentration versus uninfected control mice, and that L-Arg supplementation is clinically beneficial.23 Additionally, we have shown that L-Arg supplementation in an epithelial injury and repair model of murine colitis induced by dextran sulfate sodium (DSS), a heparin-like polysaccharide, leads to decreased body weight loss, mucosal permeability, and mortality.20 The significant induction of multiple tissue proinflammatory chemokines/cytokines and the influx of myeloperoxidase (MPO)-positive immune cells into the colon in response to DSS were abrogated by L-Arg supplementation.20 In addition to the damping of the inflammatory changes seen after exposure to DSS, L-Arg supplementation led to increased epithelial cell migration, but not proliferation, which is an important component of epithelial wound repair.20 We have shown that epithelial migration is dependent on L-Arg concentration and arginase activity in both the young adult mouse colon (YAMC) cell line and in isolated colonic epithelial cells (CECs).24 Furthermore, we demonstrated that colonic epithelial restitution is dependent on the transport of L-Arg into cells by SLC7A2 via wound repair and cell migration studies using shRNA knockdown of SLC7A2 in YAMC cells and by using CECs from Slc7a2−/− mice, respectively.24 Further, we showed that the beneficial effects of L-Arg uptake on epithelial restitution were dependent on downstream utilization by ARG1.24 We have subsequently shown that mice lacking the inducible L-Arg transporter, SLC7A2, are more susceptible to DSS-induced colitis with increased body weight loss, mortality, and histologic injury.25 Mice lacking SLC7A2 lost the clinical benefit of L-Arg supplementation and had an exaggerated chemokine response with a shift from a Th1 to a Th17 response.25

The goal of the current study was to investigate L-Arg availability and metabolism at the tissue level in UC. In this prospective study, we report that tissue L-Arg is decreased in active UC versus non-UC controls. Tissue L-Arg levels and the AAI were inversely correlated with disease activity. In addition, mRNA expression of SLC7A2 was decreased in active UC and inversely correlated with disease activity. While the tissue L-Arg was decreased, tissue L-Cit was increased leading to an increased L-Cit/L-Arg ratio pointing to L-Arg consumption by NOS2. NOS2 mRNA expression was increased at all levels of active UC versus control and inactive disease. Colonic tissues from CD patients also had decreased SLC7A2 and increased NOS2 mRNA expression. ARG1 mRNA expression was decreased in both CD and UC patients. The decreased tissue L-Arg levels in UC patients which correspond to decreased inducible transporter expression, increased utilization by NOS2, and decreased ARG1 mRNA expression, indicate a potential mechanism for deficient wound repair in UC.

MATERIALS AND METHODS

Patients

The study protocol was approved by the Institutional Review Board at Vanderbilt University. Written informed consent was obtained from control and UC subjects for analyses of demographics, medical, and dietary intake histories as well as for serum and tissue biopsies obtained at the time of endoscopic procedures as a part of the clinical trial “Effects of L-Arginine in Colitis and Colon Cancer”, identifier NCT01091558 (clinicaltrials.gov). De-identified colonic tissue samples from patients with CD were obtained from the Vanderbilt IBD repository under a separate IRB protocol for comparison of specific targets.

This study focused on UC, given that we have previously published that serum amino acids and L-Arg availability is altered in human subjects with UC.19 Further, we were concerned that patients with CD may have impairments in amino acid absorption, including L-Arg, in the small intestine due to inflammation in that region, which was likely to be a major confounding effect. Subjects were prospectively recruited in the clinic or endoscopy unit at Vanderbilt University Medical Center prior to outpatient colonoscopy for either colorectal cancer screening or UC surveillance purposes between September 2009 and September 2011. Patient participation in the current study ended after completion of the dietary history interviews. As previously described, after appropriate exclusions, there were 137 UC patients with varying disease activity and 38 controls completing the study.26 Exclusion criteria for the study were: pregnancy, known coagulopathy or bleeding disorders, known renal or hepatic impairment, history of organ transplantation, or unable to give informed consent. All subjects underwent an overnight fast and received polyethylene glycol electrolyte solution for bowel preparation prior to colonoscopy.

All study patients consented to undergo serum collection as well as three additional tissue biopsies for research purposes in four colonic segments (ascending, transverse, descending and rectum) at the time of scheduled colonoscopy. Study serum and tissue biopsies were snap frozen with dry ice and then stored at –80°C. Surveillance biopsies from UC patients were reviewed by the Department of Pathology at Vanderbilt University and graded accordingly as: normal, quiescent, mild, moderate, or severe activity. The Mayo Disease Activity Index (DAI) was determined for UC patients at the time of colonoscopy by standard measures (0 – 12 scale).27,28 Endoscopic severity was determined by gastroenterologists specializing in IBD (D.A.S.; D.B.B.; S.N.H.) using the following scale: normal, mild disease (erythema, decreased vascular pattern, mild friability), moderate disease (marked erythema, lack of vascular pattern, friability, erosions), or severe disease (spontaneous bleeding, ulceration). For comparison of some of the mRNA expression targets of interest, we were able to obtain de-identified colonic tissue samples from a small set of patients with CD from the Vanderbilt IBD repository.

Dietary Intake of Amino Acids

In addition, each UC and control study participant was asked to complete a 24-hour dietary recall interview that was administered by a trained interviewer (C.T.B.) on 3 separate occasions during the study period. The first interview was done within 1 week of the study colonoscopy, not including the day of or just prior to the colonoscopy, as fasting and colonoscopy preparation would affect dietary intake. Our goal was to sample both weekdays and weekends. Each interview lasted approximately 30 minutes and focused on food, snack, and beverage intake during the previous 24-hour period. We used a multiple-pass interview approach as optimized by the Nutrition Coordinating Center at the University of Minnesota using their specific software, Nutrient Data System for Research (NDSR; St. Paul, MN) as delineated on their website http://www.ncc.umn.edu/products/ndsr.html. There are well-documented reports that 24-hour recall multiple pass interviews conducted by telephone are effective for such analyses and are equally accurate as in-person interviews.29,30 Average daily intake of arginine, lysine, proline, total kilocalories, total grams/day, total carbohydrates, total protein, vegetable protein, and animal protein was calculated. The recall was expanded to capture supplements (including any arginine-containing supplements) used by study participants as previously described.31

Assessment of Human Serum and Tissue Amino Acid Concentrations

Human serum and tissue samples were obtained as above. Frozen colonic tissue (~10 mg, 4 biopsies obtained from 2 passes of the biopsy forceps) was lysed in 60 µL of a 10% 5-sulfosalicylic acid solution (SSA) (wt/vol) with a mortar and pestle-type rotary homogenizer. The precipitated proteins were pelleted via centrifugation at 13,400 × g for 10 min and the supernatant removed, snap frozen, and stored at −80°C for subsequent amino acid analysis. Protein concentration was measured in the lysates by the bicinchoninic acid (BCA) method as previously described.15,20

Serum samples and tissue supernatants were provided to the Vanderbilt Hormone Assay Core for amino acid analysis via high-performance liquid chromatography (HPLC). A dedicated Biochrom (Holliston, MA) 30 Amino Acid Analyzer equipped with an autosampler was used for the determination of amino acid concentrations. Serum samples were de-proteinized with an equal volume of 10% SSA containing L-norleucine, which was added as an internal standard. Tissue supernatants were diluted 1:1 with loading buffer containing L-norleucine. Amino acid separation was achieved utilizing a lithium citrate buffering system on an ion exchange column, followed with a ninhydrin post column derivatization at 135°C, and photometric detection. The peak areas at 440 nm and 570 nm were integrated using EZChrom software (Agilent Technologies, Santa Clara, CA).

The relative L-Arg availability was assessed in serum and tissues. This was determined by the arginine availability index (AAI)19, calculated as [L-Arg]/([L-Lys] + [L-Orn]).

mRNA Analysis

A dedicated cryotube containing 4 biopsies of colonic tissue was utilized for isolation of mRNA as previously described.20,26,32 The RNA quality of each sample was determined using the Experion™ system in conjunction with the Experion™ RNA StdSens Analysis Kit (Bio-Rad, Hercules, CA) per manufacturer’s instructions. The Experion™ software then calculated the RNA quality indicator (RQI) based on the ratio of 28S/18S ribosomal RNA. We only used samples with a RQI greater than 7 for further assessment. Of those samples with an RQI > 7, 1 µg of RNA was reverse-transcribed using an iScript cDNA synthesis kit (Bio-Rad, Hercules, CA). Each PCR reaction was performed with 2 µl of cDNA and 2× LightCycler® 480 SYBR Green I Master Mix (Roche, Indianapolis, IN, USA). Primers for β-actin were used as described.26,33 The sequence for the human primers were as follows: SLC7A2 (F) 5' GTTGACTGCAGGGGTCATTT 3', and (R) 5' ACATTTGGGCTGGTCGTAAG 3'; SLC7A1 (F) 5' GGCTGTCCTCTGGTGAGAAG 3', and (R) 5' GGCCACCAGATCAAAAGTGT 3'; ARG1 (F) 5' CCCTTTGCTGACATCCCTAA 3', and (R) 5' GACTCCAAGATCAGGGTGGA 3'; ARG2 (F) 5' GACACTGCCCAGACCTTTGT 3', and (R) 5' CGTTCCATGACCTTCTGGAT 3'; NOS2 (F) 5' ACCTCAGCAAGCAGCAGAAT 3', and (R) 5' ATCTGGAGGGGTAGGCTTGT 3'. The thermal cycling conditions and the methods used to calculate relative expression have been described previously.26,34–36

Statistical Analysis

Quantitative data in the tables are shown as the median (25th, 75th percentile). For the graphs, all data points are shown, with medians depicted where appropriate. Outlier testing using the Grubbs method, also called the extreme studentized deviate method, and statistical analyses were performed with GraphPad Prism 5.0 (San Diego, CA). Where two groups were compared, unpaired data was evaluated by Mann-Whitney U test, while paired data was evaluated by Wilcoxon signed rank test. The fold change data for the paired samples is presented in the text as the mean fold change followed by 95% confidence intervals in parentheses. Data with more than two groups were first analyzed by Kruskal-Wallis H test (nonparametric ANOVA) and if P < 0.05, then pairwise comparisons using the Mann-Whitney U test were performed. Correlations were determined by Spearman rank correlation coefficient.

RESULTS

Patient Characteristics

To test the hypothesis that L-Arg availability and utilization are altered in UC patients, we analyzed dietary amino acid intake, serum and tissue amino acid levels, and L-Arg metabolic pathway-associated gene expression in human subjects. We prospectively collected serum and colonic tissue samples from control subjects and UC patients with varying histologic disease severity and disease extent. The demographic information for the 38 control subjects and 137 UC patients used in this study is as previously published.26 Briefly, there were no significant differences in gender distribution or smoking between groups. However, the UC patients were significantly younger than the control subjects, due to the control subjects being evaluated for colon cancer screening or other non-IBD related indications.26 The body mass index was significantly lower in patients with active UC than in control subjects.26 More than 90% of the UC patients were on therapy for IBD with the majority of patients on 5-aminosalicylate therapy.26 Of the 175 subjects from whom we obtained serum and tissue samples, we were able to obtain dietary intake information on 28 control subjects and 100 UC patients (73.1% of the study subjects with no significant differences between the groups).

We were able to obtain colonic tissue samples from 12 CD patients with histologically active disease at the biopsy site (2 mild, 6 moderate, 4 severe) with RQI > 7. Of these 12 patients, 10 were on some form of IBD therapy.

Tissue L-Arg Is Decreased in Active UC Defined by DAI

Colonic tissue L-Arg levels were decreased in UC patients with clinically active disease, when assessed by DAI, compared to control subjects (Fig. 1A); there were no differences seen in L-Lys, L-Orn, L-Pro, or the AAI (Fig. 1B, C, E, F). There was a significant increase in L-Cit (Fig. 1D) and a mean fold increase with 95% confidence intervals of 3.09 (2.37, 4.02) in the L-Cit/L-Arg ratio (Fig. 1G) in active UC versus control subjects, which taken together with the decreased L-Arg is indicative of increased L-Arg metabolism by NOS2. L-Pro was the only amino acid significantly increased in inactive UC compared to control subjects (Fig. 1E). When comparing active and inactive UC, tissue L-Arg and L-Lys were decreased, and the L-Cit/L-Arg ratio was increased in active UC (Fig. 1A, B, G). When active disease was assessed by histology (Table 1), there was a modest decrease in L-Arg and a significant increase in L-Cit, with a consequent increase in the L-Cit/L-Arg ratio (Table 1), again suggestive of increase metabolism of L-Arg by NOS2.

Figure 1. Tissue amino acid levels categorized by DAI.

Figure 1

Colonic tissue samples were snap frozen, and subsequently were lysed and the amino acid levels were measured by HPLC, with each sample corrected for tissue lysate protein concentration, all as described in the Methods. For A – G, active disease in the UC patients was defined as a DAI > 2, inactive disease as DAI ≤ 2. For A – G, n = 26 for control, n = 36 for inactive colitis, and n = 39 for active colitis. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control. ##P < 0.01, ###P < 0.001 vs. inactive colitis.

Table 1.

Tissue Amino Acids

Control
(n = 26)
Quiescent UC
(n = 29)
Active UC
(n = 47)
L-arginine 3.0 (2.3, 4.6) 4.0 (2.6, 5.7) 2.8 (1.8, 4.0)§§
L-lysine 5.0 (3.8, 7.5) 6.7 (3.6, 9.2) 4.5 (3.5, 6.3)
L-ornithine 0.5 (0.3, 0.8) 0.7 (0.3, 1.2) 0.6 (0.4, 0.8)
L-citrulline 0.3 (0.2, 0.4) 0.4 (0.2, 0.8) 0.5 (0.2, 0.7)*
L-proline 3.0 (2.2, 3.7) 4.0 (2.8, 5.6)* 3.6 (2.8, 5.8)*
L-citrulline/L-arginine Ratio 0.08 (0.05, 0.12) 0.12 (0.07, 0.12)* 0.16 (0.09, 0.30)***§
Arginine Availability Index 0.5 (0.5, 0.62) 0.6 (0.5, 0.6) 0.5 (0.4, 0.6)

UC status determined by histologic activity. Values are presented as nmol/mg protein. Median (25th, 75th percentile). If P < 0.05 by Kruskal-Wallis H test for an individual amino acid, then Mann-Whitney U pairwise comparisons were performed.

*

P < 0.05,

***

P < 0.001 vs control;

§

P < 0.05,

§§

P < 0.01 vs quiescent UC.

Serum L-Arg Levels Are Not Significantly Different in Patients with Active UC Defined by DAI

In this prospective cohort, there were no alterations in the serum levels of L-Arg or other amino acids related to L-Arg metabolism in patients with clinically active UC (Table 2). There was no difference in the L-Cit/L-Arg ratio. There was an increase in the serum AAI in patients with clinically active UC (Table 2). Additionally, there were no differences when patients were categorized by histologic severity (quiescent, mild, moderate, or severe; data not shown).

Table 2.

Serum Amino Acids

Control
(n = 34)
Inactive UC
(n = 49)
Active UC
(n = 72)
L-arginine 71.9 (63.7, 81.1) 75.5 (63.2, 88.0) 71.8 (61.5, 93.2)
L-lysine 177.8 (151.1, 203.8) 176.6 (149.8, 198.0) 162.0 (141.6, 193.3)
L-ornithine 53.3 (38.0, 60.3) 55.6 (46.6, 74.0) 58.2 (43.4, 71.9)
L-citrulline 15.3 (12.3, 19.9) 17.3 (14.8, 20.5) 15.2 (12.7, 20.5)
L-proline 112.9 (84.6, 143.4) 123.4 (100.9, 144.6) 108.6 (76.2, 150.2)
L-citrulline/L-arginine Ratio 0.21 (0.18, 0.25) 0.22 (0.20, 0.23) 0.21 (0.16, 0.27)
Arginine Availability Index 0.31 (0.28, 0.36) 0.32 (0.27, 0.40) 0.36 (0.30, 0.41)*

UC status determined by DAI. Values are presented as µM. Median (25th, 75th percentile). If P < 0.05 by Kruskal-Wallis H test for an individual amino acid, then Mann-Whitney U pairwise comparisons were performed.

*

P < 0.05 vs control.

Dietary Intake Is Not Significantly Different in UC

There were no alterations in the dietary intake of arginine, lysine, or proline in patients with histologically active or inactive UC compared to control subjects (Table 3). It should be noted that the NDSR software did not provide information on the dietary intake of ornithine or citrulline, and does not distinguish between the L- and D- forms of amino acids. Overall, there were also no significant differences in the intake of total kilocalories, total grams/day, total carbohydrates, total protein, vegetable protein, or animal protein. No differences in the dietary intake of these categories were seen when the UC patients were stratified by clinical disease activity (data not shown). These data indicate that alterations that we have detected in amino acids in UC patients are not related to dietary factors.

Table 3.

Dietary Intake

Control
(n = 28)
Quiescent UC
(n = 27)
Active UC
(n = 73)
Arginine 3.5 (2.4, 4.4) 3.4 (2.5, 4.4) 3.6 (2.7, 4.7)
Lysine 4.3 (2.8, 5.4) 4.5 (3.1, 5.3) 4.7 (3.3, 5.9)
Proline 4.1 (3.2, 4.8) 4.7 (3.5, 5.3) 4.5 (3.4, 5.3)
Total kilocalories 1376.0 (1112.0, 1712.0) 1579.0 (1269.0, 1948.0) 1621.0 (1303.0, 2160.0)
Total grams 2581.0 (2117.0, 3254.0) 2514.0 (1948.0, 3546.0) 2632.0 (2154.0, 3228.0)
Total protein 64.5 (43.6, 76.2) 67.8 (49.9, 79.6) 66.5 (52.5, 86.6)
Total carbohydrates 185.0 (133.1, 204.2) 190.4 (137.4, 248.8) 200.0 (150.8, 289.4)
Vegetable protein 18.6 (14.9, 30.3) 22.0 (15.0, 32.2) 20.9 (15.0, 26.8)
Animal protein 45.0 (29.5, 55.5) 47.9 (29.9, 54.0) 47.8 (34.2, 60.9)

UC status determined by histologic activity. Values are presented as g/day. Median (25th, 75th percentile). If P < 0.05 by Kruskal-Wallis H test for an individual amino acid, then Mann-Whitney U pairwise comparisons were performed.

Tissue L-Arg and AAI Are Inversely Correlated with the DAI, Whereas the L-Cit/L-Arg Ratio Is Directly Correlated with DAI

When the tissue amino acids were compared to the DAI for each patient, we found an inverse correlation between L-Arg and DAI (Fig. 2A). There were no other significant correlations seen when similar assessments were performed with tissue L-Lys, L-Orn, L-Cit or L-Pro (data not shown). There was an inverse correlation between the AAI and DAI (Fig. 2B). Similar to the finding in Fig. 1G, the L-Cit/L-Arg ratio was directly correlated with the DAI (Fig. 2C).

Figure 2. Tissue L-Arg levels and the arginine availability index are inversely correlated with the DAI while the L-Cit/L-Arg ratio is positivity correlated with the DAI.

Figure 2

Tissue amino acid levels were measured as in Fig. 1. For A – C, there are no data from control subjects undergoing colonoscopy for non-UC indications, as a DAI was not obtained in control subjects. Spearman correlation coefficient shown. n = 75 for UC patients.

L-Arg Metabolic Pathway Gene Expression Is Altered in Clinically Active UC and Correlates with the DAI

Given the decrease in tissue L-Arg concentration in active UC, we assessed the gene expression of major contributors to the L-Arg metabolic pathway in colonic tissues. There was a significant decrease in the mRNA expression of the inducible L-Arg transporter, SLC7A2, in active UC versus control subjects with no alteration in SLC7A1 (Fig. 3A, B). The mRNA levels of the L-Arg metabolic enzymes NOS2 and ARG2 were significantly increased (Fig. 3C, E), while the level of ARG1 was significantly decreased (Fig. 3D). Only NOS2 and ARG2 were significantly increased in active UC compared to inactive UC (Fig. 3C, E).

Figure 3. L-Arg metabolic pathway gene expression is altered when categorized by DAI.

Figure 3

Colonic tissue samples were snap frozen, and subsequently RNA was extracted and mRNA expression assessed by real-time PCR. For A – E, tissue mRNA expression of L-Arg metabolic pathway genes: L-Arg transporters SLC7A2 (A) and SLC7A1 (B), and the metabolic enzymes NOS2 (C), ARG1 (D), and ARG2 (E). Active disease in the UC patients was defined as a DAI > 2, where inactive disease was DAI ≤ 2. For A – E, n = 21 for control, n = 19 for inactive colitis, and n = 30 for active colitis. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control. ##P < 0.01, ###P < 0.001 vs. inactive colitis. For F – I, there are no data from control subjects undergoing colonoscopy for non-UC indications, as a DAI was not obtained in control subjects. Spearman correlation coefficient shown. n = 49 for UC patients.

Gene expression of SLC7A2 was inversely correlated with the DAI (Fig. 3F) while SLC7A1 had no relationship to DAI (data not shown). The mRNA expression levels of NOS2 and ARG2 were directly correlated with the DAI (Fig. 3G, I), while ARG1 was inversely correlated with the DAI (Fig. 3H).

L-Arg Metabolic Pathway Genes Are Altered When Stratified by Histologic Disease Severity

When UC patients were stratified by histologic disease severity, SLC7A2 mRNA expression was decreased in mild, moderate, and severe disease versus control subjects or UC patients with quiescent disease (Fig. 4A). Again, there were no differences in SLC7A1 mRNA levels in histologically active UC versus controls or quiescent UC (Fig. 4B). NOS2 mRNA expression was increased in mild, moderate, and severe disease versus control subjects or UC patients with quiescent disease (Fig. 4C). ARG1 mRNA expression was decreased in quiescent, moderate, and severe disease versus control subjects. Additionally, in patients with severe UC, ARG1 mRNA expression was decreased versus UC patients with either quiescent or mild disease (Fig. 4D). ARG2 mRNA expression was significantly increased in mild or severe UC versus quiescent UC patients (Fig. 4E).

Figure 4. L-Arg metabolic pathway gene expression is altered by histologic disease severity.

Figure 4

Tissue samples were snap frozen, and subsequently RNA was extracted and mRNA expression assessed by real-time PCR as in Fig. 3. For A – E, gene expression patterns in colonic tissue for control and UC patients stratified by histologic disease severity. n = 21 for control (Ctrl) and n = 49 for UC. *P < 0.05, **P < 0.01, ***P < 0.001 vs. control. #P < 0.05, ##P < 0.01, ###P < 0.001 vs. quiescent colitis. §P < 0.05 vs. mild colitis.

Amino Acid Levels and L-Arg Metabolic Pathway Genes Are Altered in Paired Involved and Uninvolved Colonic Tissues in UC Patients with Left-Sided Colitis

Given the alterations seen in both tissue amino acid levels and mRNA expression of associated genes in active UC, we assessed paired tissue samples from areas of active disease (involved) and normal colonic tissue (uninvolved) from the same UC patient in cases limited to left-sided colitis. We found a 2.28 (1.81, 2.89) fold decrease in L-Arg (Fig. 5A) with a 2.06 (1.41, 3.01) fold increase in L-Cit, and an associated 5.42 (3.67, 8.00) fold increase in the L-Cit/L-Arg ratio (Fig. 5C, F) in areas involved with left-sided colitis versus uninvolved right colon. There was a 1.85 (1.54, 2.21) fold decrease in L-Lys level (Fig. 5B), but no differences in L-Orn levels (Fig. 5D). The AAI was decreased 1.31 (1.16, 1.48) fold in involved areas of colitis (Fig. 5E).

Figure 5. Tissue amino acid levels and L-Arg metabolic pathway gene expression are altered in involved versus uninvolved tissues in UC patients with colitis limited to the left colon.

Figure 5

For A – F, amino acid levels were measured in paired uninvolved (right-sided) tissue and involved (left-sided) tissues as in Figures 1 and 2. n = 23 paired samples from UC patients. **P < 0.01, ***P < 0.001 vs. paired uninvolved tissue. For G – J, tissue samples were snap frozen, and subsequently RNA was extracted and mRNA expression assessed by real-time PCR as in Figures 3 and 4. n = 17 paired samples from UC patients. **P < 0.01, ***P < 0.001 vs. paired uninvolved tissue.

When paired samples from UC patients with left-sided colitis were assessed by real-time qPCR and expressed as fold change versus control subjects, we found that SLC7A2 mRNA expression was decreased 3.54 (1.80, 6.94) fold in involved areas of colitis (Fig. 5G). There was no significant difference in SLC7A1 mRNA levels (data not shown). NOS2 mRNA expression was increased 9.92 (3.83, 25.70) fold (Fig. 5H). ARG1 mRNA expression was decreased 8.54 (3.66, 19.95) fold while ARG2 mRNA expression was increased 3.56 (2.01, 6.29) fold in areas with active colitis (Fig. 5I, J).

L-Arg Metabolic Pathway Genes Are Altered in Colonic Tissue from CD Patients

In order to test if the differences in gene expression related to L-Arg uptake and metabolism detected in UC may also occur in histologically active colonic CD, a cross-sectional analysis from a tissue repository was conducted. Similar to our findings in UC, when a group of CD patients were compared to our control subjects, there was a significant decrease in the mRNA expression of both SLC7A2 (Fig. 6A) and ARG1 (Fig. 6D), while NOS2 (Fig. 6C) and ARG2 (Fig. 6E) mRNA levels were increased. There was also a decrease in SLC7A1 in CD tissues (Fig. 6B) that was not observed in UC.

Figure 6. L-Arg metabolic pathway gene expression is altered in CD.

Figure 6

Snap frozen colonic tissue samples from CD patients were obtained, and subsequently RNA was extracted and mRNA expression assessed by real-time PCR. For A – E, gene expression patterns in colonic tissue for control and CD patients. n = 8 for control (Ctrl) and n = 12 for Crohn’s. **P < 0.01, ***P < 0.001 vs. control.

Discussion

In this study, we utilized prospectively collected serum and colonic tissue from UC patients and control subjects to demonstrate specific alterations in L-Arg levels, related amino acids, and L-Arg metabolic enzymes in UC. We found no difference in the dietary intake of the amino acids arginine, lysine, and proline, or intake of total kilocalories, total grams or various forms of protein in UC patients versus controls (Table 3), implicating alterations in endogenous amino acid transport and metabolism rather than simple changes in the diet in UC patients. Serum L-Arg, L-Lys, L-Orn, L-Cit, and L-Pro levels were not different in active UC. While we had previously reported an increase in serum L-Arg level in UC, it should be noted that the prior study was a pilot study of banked serum in which the change in serum L-Arg was found in 8 severe UC cases compared to 14 controls19, and the current study was a larger prospective cohort. Also, there was now an increase in the serum AAI in active UC (Table 2), while in the prior study there was a modest increase in AA1 that did not reach significance.19 Though these findings could suggest more L-Arg availability, importantly we found that tissue L-Arg was decreased in active UC versus either control or inactive UC, and there was decreased L-Arg and AAI in involved versus uninvolved tissues in patients with left-sided colitis. These alterations in tissue L-Arg availability have not been previously described in UC, and may provide key insights into UC pathogenesis.

In addition, tissue L-Cit was increased in active UC, leading to an increased tissue L-Cit/L-Arg ratio and a similar pattern occurred in the involved versus uninvolved cases in patients with left-sided colitis. Interestingly, the increase in L-Cit and decrease in L-Arg in inflamed colonic tissue is similar to a previous report37 in RAW 267.4 macrophages activated with lipopolysaccharide, which is well known to be associated with increased NO production.

To further examine factors that would alter the uptake of L-Arg, we found that mRNA expression of the inducible transporter, SLC7A2, was decreased in active UC patients compared to control subjects while SLC7A1 mRNA expression was not altered. CD patients had a similar decrease in SLC7A2 mRNA expression. This finding of decreased expression of the SLC7A2 L-Arg transporter in both UC and CD patients is consistent with our prior reports that mice with targeted deletion of Slc7a2 exhibit an exacerbation of DSS colitis when compared to wild-type (WT) mice.25 When taken together with the data presented in the current report, we speculate that there is a defect in SLC7A2 function in UC. A diminished ability to import sufficient L-Arg likely contributes to cellular dysfunction leading to phenotypes that include impaired epithelial restitution and protein translation, and altered immune responses.19,25

Alterations in colonic tissue L-Arg were associated with increased mRNA expression of the downstream L-Arg metabolic enzymes ARG2 and NOS2, but decreased expression of ARG1. This pattern of gene expression was also seen when paired colonic tissues from UC patients with left-sided colitis were compared to uninvolved right colon tissues, or when tissues from CD patients with colonic involvement were compared to controls. The changes in gene expression could be in response to the low tissue L-Arg, or due to other factors that may affect transcription of these genes, such as activation of pro-inflammatory signaling or bacterial factors, which are known to activate NOS2, for example.38

Furthermore, we found that both the tissue L-Arg and AAI were inversely correlated with the DAI, while the L-Cit/L-Arg ratio was directly correlated with the DAI. We also found that the mRNA expression of SLC7A2 and ARG1 were inversely correlated with the DAI while NOS2 levels were directly correlated. Consistent patterns were seen whether patients were stratified by histologic injury or clinical disease activity. Taken together, these data suggest that decreased L-Arg in colonic tissues may have an important functional role in UC pathogenesis. Also, the specific pattern of decreased expression of the inducible L-Arg transporter and a switch of the NOS2/ARG1 expression ratio is functionally important because of the increase in L-Cit and the L-Cit/L-Arg ratio. It should be noted that NOS2 is the prototype marker for M1, classically activated macrophages, and ARG1 is a primary marker of M2, alternatively activated macrophages.39 However NOS2 and ARG1 can also be derived from non-immune cells in colitis as we and others have described.20, 23, 25,40

NOS activity has been shown to be increased in colonic biopsies from both UC and CD patients.41 We have shown that L-Arg is required for NOS2 translation25,34, and that both colonic Nos2 mRNA and NOS2 protein expression are increased in WT mice exposed to DSS.20 Mice lacking NOS2 had a similar clinical course as WT mice after exposure to DSS, though they lost the benefit of L-Arg supplementation that we showed in WT mice.20 Furthermore, decreased NOS2 expression and subsequent decreased NO production in human intestinal microvascular endothelial cells isolated from patients with IBD have previously been shown to lead to increased leukocyte adhesion likely contributing to the chronic inflammation.42 In addition, there may be dysfunction of arginase in IBD as we have reported that pharmacologic inhibition of arginase exacerbates colitis in mouse models.23,43

Our study is the first to assess L-Arg transporter expression and the expression of downstream metabolic enzymes in a prospective cohort of UC patients and a small cohort of CD patients. In considering L-Arg as a therapy in humans, our data indicate that there is diminished tissue L-Arg levels and availability in UC tissues; leading to the possibility that supplementation could correct this deficiency. However, we also identified a reduction in the gene expression of the inducible transporter of L-Arg, SLC7A2, which likely contributes substantially to the diminished tissue L-Arg we observed. Thus, it is difficult to predict if the diminished SLC7A2 could be overcome by L-Arg supplementation. In mice with a total tissue knockout of Slc7a2, L-Arg supplementation was not beneficial in the DSS model25, but in humans with IBD we found substantial variability in expression levels, not absolute deficiency. Because expression of SLC7A2 has not been previously examined in human IBD, we sought to corroborate our mRNA data with protein levels; however, we have tested multiple available antibodies for SLC7A2 and have not found one that is suitable for immunohistochemistry in humans. It could prove useful in future studies to relate baseline tissue L-Arg levels and SLC7A2 expression to any future clinical trials of L-Arg supplementation in IBD patients to assess if these parameters influence clinical response. This could provide needed insight to help understand if L-Arg supplementation would allow for increased functional availability of L-Arg by overcoming the decrease in SLC7A2 and L-Arg availability caused by competitive inhibition of uptake by L-Orn and L-Lys, and thus have a benefit in UC as we have reported in mouse models of colitis.20,23

Acknowledgments

We would like to thank James C. Slaughter, DrPH, Department of Biostatistics, Vanderbilt University Medical Center for his thoughtful discussions related to this manuscript.

David A. Schwartz has consultancy agreements with Abbvie, UCB, Janssen, Takeda, and Tigenix and is currently receiving grants from Abbvie and UCB. However, these agreements and grants had no relationship to the current research study. Keith T. Wilson has had a consulting agreement with Immune Pharmaceuticals. However, this agreement had no relationship to the current research study and is no longer active.

Sources of Funding: Supported by National Institutes of Health (NIH) grants R01AT004821 and 3R01AT004821-02S1 to KTW. LAC was supported by NIH training grant 5T32DK007673, a Vanderbilt Physician Scientist Development Award, and a Veterans Affairs Career Development Award 1IK2BX002126-01. Additional support was provided by NIH Grant P30DK058404 (Vanderbilt Digestive Disease Research Center), NIH grant UL1TR000445 (Vanderbilt CTSA), the Vanderbilt Hormone Assay & Analytical Services Core supported by NIH grant DK20593 (Vanderbilt Diabetes Research and Training Center), NIH R01DK099204 and Veterans Affairs Merit Review Grant I01BX001426 to CSW, NIH grants R01DK053620, R01CA190612, P01CA028842, P01CA116087, and Veterans Affairs Merit Review Grant I01BX001453 to KTW, and the Thomas F. Frist Sr. Endowment to KTW.

Footnotes

Conflicts of Interest: The remainder of the authors declare that they have no conflict of interest.

References

  • 1.Shivashankar R, Tremaine WJ, Harmsen WS, et al. Updated incidence and prevalence of Crohn’s disease and ulcerative colitis in Olmsted County, Minnesota (1970–2010) Am J Gastroenterol. 2014;109:S499. doi: 10.1016/j.cgh.2016.10.039. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Present DH. Review article: The efficacy of infliximab in Crohn's disease--healing of fistulae. Aliment Pharmacol Ther. 1999;13(Suppl 4):23–28. doi: 10.1046/j.1365-2036.1999.00026.x. discussion 38. [DOI] [PubMed] [Google Scholar]
  • 3.Mouser JF, Hyams JS. Infliximab: A novel chimeric monoclonal antibody for the treatment of Crohn's disease. Clin Ther. 1999;21:932–942. doi: 10.1016/s0149-2918(99)80015-0. discussion 931. [DOI] [PubMed] [Google Scholar]
  • 4.Present DH, Rutgeerts P, Targan S, et al. Infliximab for the treatment of fistulas in patients with Crohn's disease. N Engl J Med. 1999;340:1398–1405. doi: 10.1056/NEJM199905063401804. [DOI] [PubMed] [Google Scholar]
  • 5.Clark M, Colombel JF, Feagan BC, et al. American Gastroenterological Association consensus development conference on the use of biologics in the treatment of inflammatory bowel disease, June 21–23, 2006. Gastroenterology. 2007;133:312–339. doi: 10.1053/j.gastro.2007.05.006. [DOI] [PubMed] [Google Scholar]
  • 6.Rose WC. Amino acid requirements of man. Fed Proc. 1949;8:546–552. [PubMed] [Google Scholar]
  • 7.Castillo L, Ajami A, Branch S, et al. Plasma arginine kinetics in adult man: Response to an arginine-free diet. Metabolism. 1994;43:114–122. doi: 10.1016/0026-0495(94)90166-x. [DOI] [PubMed] [Google Scholar]
  • 8.Castillo L, Chapman TE, Sanchez M, et al. Plasma arginine and citrulline kinetics in adults given adequate and arginine-free diets. Proc Natl Acad Sci U S A. 1993;90:7749–7753. doi: 10.1073/pnas.90.16.7749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Coman D, Yaplito-Lee J, Boneh A. New indications and controversies in arginine therapy. Clin Nutr. 2008;27:489–496. doi: 10.1016/j.clnu.2008.05.007. [DOI] [PubMed] [Google Scholar]
  • 10.Mori M. Regulation of nitric oxide synthesis and apoptosis by arginase and arginine recycling. J Nutr. 2007;137:1616S–1620S. doi: 10.1093/jn/137.6.1616S. [DOI] [PubMed] [Google Scholar]
  • 11.Lewis ND, Asim M, Barry DP, et al. Arginase ii restricts host defense to Helicobacter pylori by attenuating inducible nitric oxide synthase translation in macrophages. J Immunol. 2010;184:2572–2582. doi: 10.4049/jimmunol.0902436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Wu G, Morris SM., Jr Arginine metabolism: Nitric oxide and beyond. Biochem J. 1998;336:1–17. doi: 10.1042/bj3360001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Kakuda DK, Sweet MJ, Mac Leod CL, et al. Cat2-mediated l-arginine transport and nitric oxide production in activated macrophages. Biochem J. 1999;340(Pt 2):549–553. [PMC free article] [PubMed] [Google Scholar]
  • 14.Nicholson B, Manner CK, Kleeman J, et al. Sustained nitric oxide production in macrophages requires the arginine transporter cat2. J Biol Chem. 2001;276:15881–15885. doi: 10.1074/jbc.M010030200. [DOI] [PubMed] [Google Scholar]
  • 15.Chaturvedi R, Asim M, Hoge S, et al. Polyamines impair immunity to Helicobacter pylori by inhibiting l-arginine uptake required for nitric oxide production. Gastroenterology. 2010;139:1686–1698. 1698 e1681–1698 e1686. doi: 10.1053/j.gastro.2010.06.060. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Verrey F, Closs EI, Wagner CA, et al. Cats and hats: The slc7 family of amino acid transporters. Pflugers Arch. 2004;447:532–542. doi: 10.1007/s00424-003-1086-z. [DOI] [PubMed] [Google Scholar]
  • 17.Closs EI, Basha FZ, Habermeier A, et al. Interference of l-arginine analogues with l-arginine transport mediated by the y+ carrier hcat-2b. Nitric Oxide. 1997;1:65–73. doi: 10.1006/niox.1996.0106. [DOI] [PubMed] [Google Scholar]
  • 18.Closs EI, Simon A, Vekony N, et al. Plasma membrane transporters for arginine. J Nutr. 2004;134:2752S–2759S. doi: 10.1093/jn/134.10.2752S. discussion 2765S-2767S. [DOI] [PubMed] [Google Scholar]
  • 19.Hong SK, Maltz BE, Coburn LA, et al. Increased serum levels of l-arginine in ulcerative colitis and correlation with disease severity. Inflamm Bowel Dis. 2010;16:105–111. doi: 10.1002/ibd.21035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Coburn LA, Gong X, Singh K, et al. L-arginine supplementation improves responses to injury and inflammation in dextran sulfate sodium colitis. PLoS One. 2012;7:e33546. doi: 10.1371/journal.pone.0033546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Cross RK, Wilson KT. Nitric oxide in inflammatory bowel disease. Inflamm Bowel Dis. 2003;9:179–189. doi: 10.1097/00054725-200305000-00006. [DOI] [PubMed] [Google Scholar]
  • 22.Fotiadis C, Adamis S, Misiakos EP, et al. The prophylactic effect of l-arginine in acute ischaemic colitis in a rat model of ischaemia/reperfusion injury. Acta Chir Belg. 2007;107:192–200. [PubMed] [Google Scholar]
  • 23.Gobert AP, Cheng Y, Akhtar M, et al. Protective role of arginase in a mouse model of colitis. J Immunol. 2004;173:2109–2117. doi: 10.4049/jimmunol.173.3.2109. [DOI] [PubMed] [Google Scholar]
  • 24.Singh K, Coburn LA, Barry DP, et al. L-arginine uptake by cationic amino acid transporter 2 is essential for colonic epithelial cell restitution. Am J Physiol Gastrointest Liver Physiol. 2012;302:G1061–G1073. doi: 10.1152/ajpgi.00544.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Singh K, Coburn LA, Barry DP, et al. Deletion of cationic amino acid transporter 2 exacerbates dextran sulfate sodium colitis and leads to an il-17-predominant t cell response. Am J Physiol Gastrointest Liver Physiol. 2013;305:G225–G240. doi: 10.1152/ajpgi.00091.2013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Coburn LA, Horst SN, Chaturvedi R, et al. High-throughput multi-analyte luminex profiling implicates eotaxin-1 in ulcerative colitis. PLoS One. 2013;8:e82300. doi: 10.1371/journal.pone.0082300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Schroeder KW, Tremaine WJ, Ilstrup DM. Coated oral 5-aminosalicylic acid therapy for mildly to moderately active ulcerative colitis. A randomized study. N Engl J Med. 1987;317:1625–1629. doi: 10.1056/NEJM198712243172603. [DOI] [PubMed] [Google Scholar]
  • 28.Rutgeerts P, Sandborn WJ, Feagan BG, et al. Infliximab for induction and maintenance therapy for ulcerative colitis. N Engl J Med. 2005;23:2462–2476. doi: 10.1056/NEJMoa050516. [DOI] [PubMed] [Google Scholar]
  • 29.Casey PH, Goolsby SL, Lensing SY, et al. The use of telephone interview methodology to obtain 24-hour dietary recalls. J Am Diet Assoc. 1999;99:1406–1411. doi: 10.1016/S0002-8223(99)00340-5. [DOI] [PubMed] [Google Scholar]
  • 30.Tran KM, Johnson RK, Soultanakis RP, et al. In-person vs telephone-administered multiple-pass 24-hour recalls in women: Validation with doubly labeled water. J Am Diet Assoc. 2000;100:777–783. doi: 10.1016/S0002-8223(00)00227-3. [DOI] [PubMed] [Google Scholar]
  • 31.Harnack L, Stevens M, Van Heel N, et al. A computer-based approach for assessing dietary supplement use in conjunction with dietary recalls. J Food Compost Anal. 2008;21:S78–S82. doi: 10.1016/j.jfca.2007.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Singh K, Chaturvedi R, Barry DP, et al. The apolipoprotein e-mimetic peptide cog112 inhibits nf-kappab signaling, proinflammatory cytokine expression, and disease activity in murine models of colitis. J Biol Chem. 2011;286:3839–3850. doi: 10.1074/jbc.M110.176719. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Gobert AP, Cheng Y, Wang JY, et al. Helicobacter pylori induces macrophage apoptosis by activation of arginase ii. J Immunol. 2002;168:4692–4700. doi: 10.4049/jimmunol.168.9.4692. [DOI] [PubMed] [Google Scholar]
  • 34.Chaturvedi R, Asim M, Lewis ND, et al. L-arginine availability regulates inducible nitric oxide synthase-dependent host defense against Helicobacter pylori. Infect Immun. 2007;75:4305–4315. doi: 10.1128/IAI.00578-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Chaturvedi R, Cheng Y, Asim M, et al. Induction of polyamine oxidase 1 by Helicobacter pylori causes macrophage apoptosis by hydrogen peroxide release and mitochondrial membrane depolarization. J Biol Chem. 2004;279:40161–40173. doi: 10.1074/jbc.M401370200. [DOI] [PubMed] [Google Scholar]
  • 36.Cheng Y, Chaturvedi R, Asim M, et al. Helicobacter pylori-induced macrophage apoptosis requires activation of ornithine decarboxylase by c-myc. J Biol Chem. 2005;280:22492–22496. doi: 10.1074/jbc.C500122200. [DOI] [PubMed] [Google Scholar]
  • 37.Suh JH, Kim RY, Lee DS. A new metabolomic assay to examine inflammation and redox pathways following lps challenge. J Inflamm (Lond) 2012;9:37. doi: 10.1186/1476-9255-9-37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Lowenstein CJ, Alley EW, Raval P, et al. Macrophage nitric oxide synthase gene: Two upstream regions mediate induction by interferon gamma and lipopolysaccharide. Proc Natl Acad Sci U S A. 1993;90:9730–9734. doi: 10.1073/pnas.90.20.9730. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Munder M, Mallo M, Eichmann K, et al. Murine macrophages secrete interferon gamma upon combined stimulation with interleukin (il)-12 and il-18: A novel pathway of autocrine macrophage activation. J Exp Med. 1998;187:2103–2108. doi: 10.1084/jem.187.12.2103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Singer II, Kawka DW, Scott S, et al. Expression of inducible nitric oxide synthase and nitrotyrosine in colonic epithelium in inflammatory bowel disease. Gastroenterology. 1996;111:871–885. doi: 10.1016/s0016-5085(96)70055-0. [DOI] [PubMed] [Google Scholar]
  • 41.Guihot G, Guimbaud R, Bertrand V, et al. Inducible nitric oxide synthase activity in colon biopsies from inflammatory areas: Correlation with inflammation intensity in patients with ulcerative colitis but not with Crohn's disease. Amino Acids. 2000;18:229–237. doi: 10.1007/s007260050020. [DOI] [PubMed] [Google Scholar]
  • 42.Binion DG, Rafiee P, Ramanujam KS, et al. Deficient inos in inflammatory bowel disease intestinal microvascular endothelial cells results in increased leukocyte adhesion. Free Radic Biol Med. 2000;29:881–888. doi: 10.1016/s0891-5849(00)00391-9. [DOI] [PubMed] [Google Scholar]
  • 43.Cheng Y, Xu H, Forman JS, et al. Inhibition of colitis by the arginase-odc pathway. Gastroenterology. 2003;124:A473. [Google Scholar]

RESOURCES