Type 3 muscarinic receptors contribute to intestinal mucosal homeostasis and clearance of Nippostrongylus brasiliensis through induction of T_H2 cytokines

Abstract

Despite increased appreciation for the role of nicotinic receptors in the modulation of and response to inflammation, the contribution of muscarinic receptors to mucosal homeostasis, clearance of enteric pathogens, and modulation of immune cell function remains relatively undefined. Uninfected and Nippostrongylus brasiliensis-infected wild-type and type 3 muscarinic receptor (M3R)-deficient (Chrm3^−/−) mice were studied to determine the contribution of M3R to mucosal homeostasis as well as host defense against the T_H2-eliciting enteric nematode N. brasiliensis. Intestinal permeability and expression of T_H1/T_H17 cytokines were increased in uninfected Chrm3^−/− small intestine. Notably, in Chrm3^−/− mice infected with N. brasiliensis, small intestinal upregulation of T_H2 cytokines was attenuated and nematode clearance was delayed. In Chrm3^−/− mice, T_H2-dependent changes in small intestinal function including smooth muscle hypercontractility, increased epithelial permeability, decreased epithelial secretion and absorption, and goblet cell expansion were absent despite N. brasiliensis infection. These findings identify an important role for M3R in host defense and clearance of N. brasiliensis, and support the expanding role of cholinergic muscarinic receptors in maintaining mucosal homeostasis.

acetylcholine is a classic neurotransmitter that binds and activates nicotinic and muscarinic receptors. Nicotinic receptors (NR) are cationic channels that are expressed on a number of neural and nonneural cell types. The combination of α and β subunits comprising each NR determines receptor function (2). Muscarinic receptors (MR) are G protein-coupled receptors that mediate cholinergic neurotransmission at effector cells. Five MR are identified (designated M1R–M5R, encoded by Chrm1-5). Post-MR signaling involves activation of phospholipase C with subsequent changes in cellular levels of inositol phosphate, cAMP, and calcium. Intestinal epithelial cells lack NR (43), but express M1R and M3R (9). In mice and humans, smooth muscle cell contractility in response to acetylcholine is mediated by M2R and M3R (51). Enteric neurons also express M3R (20). Prior reports link M1R activity to barrier function in T84 cells (25) and M3R activity to transcellular transport of macromolecules (7). Whereas immune regulation of MR expression impacts smooth muscle function (1), the role of MR in immune regulation of epithelial barrier function is relatively unexplored (37).

Vagal tone and cholinergic signaling are implicated in modulating both systemic (5, 18, 41, 56) and local (6, 35, 54) inflammation. The α7 NR is considered the primary receptor responsible for transducing anti-inflammatory signals from the vagus through local nerves (56). In vitro studies examining the ability of cholinergic tone to modulate inflammatory states demonstrated that nicotine, acting through α7 NR, reduced the T_H17 response in CD4⁺ T cells (28). MR activity has been associated with pro- or anti-inflammatory actions depending on the tissue and MR subtype studied (8, 24, 27). We demonstrated that although the T_H1/T_H17 response to Citrobacter rodentium, a gram-negative attaching/effacing bacterium, is intact in the absence of M3R, mucin production is attenuated prolonging bacterial adherence (37). Similarly, ablation of M3R is associated with delayed clearance of the type 2 helper T cell (T_H2)-inducing nematode Nippostrongylus brasiliensis (N. brasiliensis) (12).

Interactions between enteric nematodes and their mammalian hosts have coevolved to benefit both organisms. Enteric nematode infection is associated with pathology, but many hosts tolerate colonization with minimal ill-effects (4, 22). Mammals respond to enteric nematodes by generating T_H2 immune response, characterized by the production of cytokines such as IL-4, IL-13, IL-5, and IL-10 (15, 45). There are also several characteristic T_H2-dependent physiological changes that facilitate nematode expulsion including smooth muscle hypercontractility, increased epithelial permeability, decreased epithelial secretion, decreased glucose absorption, and goblet cell expansion (4, 23, 29, 30, 63). Current evidence supports the hypothesis that nematode infection protects against autoimmune diseases including type 1 diabetes (60), rheumatoid arthritis (19), multiple sclerosis (16), and Crohn's disease (CD) (14) by upregulating T_H2 cytokines.

The current study was designed to investigate the contributions of M1R and M3R to small intestinal mucosal homeostasis. We also sought to further characterize the impact of M3R on host defense against N. brasiliensis. The results of our studies demonstrate that M3R contributes to mucosal homeostasis in the absence of enteric nematode infection as well as to T_H2 cytokine mediated expulsion of N. brasiliensis. M3R-deficient (Chrm3^−/−) mice are unable to mount an appropriate cytokine response to N. brasiliensis infection, suggesting that M3R is required for the full T_H2 response in enteric nematode infection. We conclude that M3R activity contributes to small intestinal barrier function and mucosal homeostasis, and also to the generation of a T_H2 cytokine response to enteric nematode infection.

METHODS

Animal studies.

Age- and sex-matched wild-type (C57Bl/6 littermates) and M3R-deficient (Chrm3^−/−) mice on a C57BL/6 background were purchased from Taconic Farms (Germantown, NY). Mice were housed at the United States Department of Agriculture animal facility and provided food and water ad libitum. Also, age- and sex-matched WT, M1R-deficient (Chrm1^−/−), Chrm3^−/−, and dual M1R/M3R-deficient (Chrm1,3^−/−) 129/SvEv × CF1 (50%:50%) mice were purchased from Taconic Farms (Germantown, NY) and housed at the Baltimore VA Medical Center animal facility where they were provided food and water ad libitum. Animals were euthanized using ketamine/xylazine prior to performing physiological studies and harvesting of tissues for molecular analysis, histological evaluation, and assessment of nematode burden. The average time to death in this study for mice given ketamine/xylazine was 5–7 s and is consistent with previous reports (44). Although xylazine is a α₂-adrenoceptor agonist (11) intestines were harvested from euthanized mice within 1–2 min of euthanasia. All studies were conducted in accordance with the principles set forth in the Guide for Care and Use of Laboratory Animals, Institute of Laboratory Animal Resources, National Research Council, Health and Human Services Publication (National Institutes of Health 85-23, revised 1996), and the Beltsville Area Animal Care and Use Committee (Protocol no. 10-003). The protocol was also approved by the Institutional Animal Care and Use Committee of the University of Maryland, School of Medicine (Protocol no. 0113014) and by the VA Research and Development Committee.

Histology.

Small intestines were opened longitudinally along the mesenteric border, fixed for 2 h in 4% paraformaldehyde, and embedded in paraffin blocks. Tissue was processed, cut in 5-μm sections, affixed to glass slides, and stained with hematoxylin and eosin (H&E) or Giemsa by Histoserv (Germantown, MD). Images were acquired with an Axio Imager M2 microscope (Carl Zeiss Microscopy; Thornwood, NY) using ZEN Pro 2012 image acquisition software (Carl Zeiss Microscopy). Well-oriented sections of small intestine were scored by two investigators who were unaware of the treatment using the system of Chiu et al. (10). Goblet cells were quantified under light microscopy by counting the numbers of goblet cells per villus in at least 30 villi in well-oriented sections of small intestine. Villus height was determined in well oriented villi by an investigator unaware of the mouse strain.

Microsnapwell assay for mucosal transepithelial electrical resistance and flux of FITC-dextran.

The modified micro-snapwell system is a miniaturized version of the Ussing chamber designed to measure mucosal transepithelial electrical resistance (TEER) (13). Segments of small intestine and colon were harvested from uninfected WT, Chrm1^−/−, Chrm3^−/−, and Chrm1,3^−/− mice stripped of both muscularis externa and serosal layers, and mounted in the micro-snapwell system. Segments of N. brasiliensis-infected small intestine from WT and Chrm3^−/− mice were harvested and studied in the same manner. A total of 250 μl DMEM containing 4.5 g/l glucose, 4 mM l-glutamine, and 1 mM nonessential amino acids was added to the mucosal side. Three milliliters of the same medium was added to the serosal side. The system was incubated at 37°C with 5% CO₂ for 30 min to permit stabilization of pH and TEER was measured every 30 min for 180 min.

After 30 min of equilibration of uninfected WT and Chrm3^−/− small intestine, 100 μl of medium from the serosal side was collected and used to determine the intrinsic fluorescence of DMEM. The mucosal medium was then replaced with DMEM containing FITC-dextran. Medium from the serosal side was collected every 30 min immediately prior to measurement of TEER for a total of 90 min. The concentration of fluorescein in the serosal compartment over time was determined using a Fluoroskan Ascent FL Microplate Reader (Thermo-Scientific; Chicago, IL) at an excitation wavelength of 485 nm and an emission wavelength of 527 nm.

RNA extraction, cDNA synthesis, and quantitative real-time polymerase chain reaction (qRT-PCR).

Total RNA was extracted from tissue samples or bone marrow-derived macrophages (BMDM) with TRIzol reagent (Invitrogen; Carlsbad, CA) according to manufacturer's instructions. The muscularis externa was stripped from intestine prior to processing. RNA integrity, quantity, and genomic DNA contamination were assessed using the Agilent Bioanalyzer 2100 and RNA 6000 Labchip kit (Agilent Technologies; Palo Alto, CA). Only RNA samples with 28S/18S ratios between 1.5 and 2 without DNA contamination were studied further. RNA samples (2 μg) were reverse-transcribed to cDNA using the First Strand cDNA Synthesis Kit (MBI Fermentas; Hanover, MD) with random hexamer primer.

Amplification reactions were performed on an iCycler detection system (Bio-Rad Laboratories; Hercules, CA). Primer sequences were designed using Beacon Designer 5.0 (Premier Biosoft International; Palo Alto, CA), and synthesized by the Biopolymer Laboratory of the University of Maryland. PCR was performed in 25-μl wells using SYBR Green Supermix (Bio-Rad Laboratories). Amplification conditions were 95°C for 3 min, 60 cycles at 95°C for 15 s, 60°C for 15 s, and 72°C for 20 s. The fold-change in mRNA expression for targeted genes (Table 1) was calculated relative to respective control genes after normalization to 18s rRNA. 18s rRNA was selected as the internal standard based on preliminary studies demonstrating no significant differences in 18s rRNA level among different groups of samples studied.

Table 1.

Sequences of sense and antisense primers use for quantitative real-time polymerase chain reaction (RT-PCR)

Gene	Sense Primer	Antisense Primer
IFN-γ	TGGCTGTTTCTGGCTGTTACTG	AGGTGTGATTCAATGACGCTTATG
IL-17A	TCCAGAATGTGAAGGTCAAC	TCATTGCGGTGGAGAGTC
TNF-α	GTGGAACTGGCAGAAGAG	AATGAGAAGAGGCTGAGAC
IL-4	CGGAGATGGATGTGCCAAAC	GCACCTTGGAAGCCCTACAG
IL-5	GACAAGCAATGAGACGATGAGG	CCCACGGACAGTTTGATTCTTC
IL-10	TCTCCCCTGTGAAAATAAGAG	GCCTTGTAGACACCTTGG
IL-13	GACCAGACTCCCCTGTGCAA	TGGGTCCTGTAGATGGCATTG
Arg-1	GAGTATGACGTGAGAGAC	TTCTTCACAATTTGAAAGGA

Nippostrongylus brasiliensis infection and worm expulsion.

Infective, third stage N. brasiliensis larvae (L₃) were propagated and stored at room temperature in fecal/charcoal/peat moss culture plates as previously described (63). Age- and sex-matched groups of C57Bl/6 littermates and Chrm3^−/− mice were inoculated subcutaneously with 500 L₃ and studied 5–9 days later. Stool was collected from WT and Chrm3^−/− mice throughout the course of N. brasiliensis infection to determine fecal egg content. After euthanasia, the proximal small intestine (duodenum) from WT and Chrm3^−/− mice was collected and nematodes residing within were counted directly.

In vitro smooth muscle function.

Smooth muscle contractility was measured as described previously (63). The response to 10 nM to 0.1 mM acetylcholine and the amplitude of spontaneous contractions was determined. Tension was expressed as force per cross-sectional area (62). Responses from all tissue segments exposed to acetylcholine from an individual animal were averaged resulting in a mean response per animal and then averaged to yield a mean value per group.

Ussing chambers.

One-centimeter segments of jejunal mucosa were stripped of muscularis externa and mounted in Ussing chambers with 0.126 cm² of the epithelium exposed to 10 ml of Krebs buffer. The potential difference across the tissue was measured using agar-salt bridges and electrodes. Every 50 s, the tissue was short circuited at 1 V (World Precision Instruments DVC 1000 voltage clamp; Sarasota, FL) for 2 s to allow calculation of tissue resistance utilizing Ohm's law (V = IR). In addition, the short-circuit current (I_sc) was monitored continuously. Basal I_sc, representing the net ion flux at baseline, and tissue resistance, an indication of tissue permeability, were determined after a 15-min period of equilibration. Following a second 15-min period of equilibration, concentration-dependent changes in I_sc were measured in response to the cumulative addition of glucose to the mucosal side. For all tissue segments taken from an individual mouse (n = 3–4 per mouse), resistance, basal I_sc, and changes in I_sc in response to glucose were averaged to yield a mean response per animal and then averaged to yield a mean value per group.

Preparation and treatment of bone marrow-derived macrophages.

Macrophages were prepared from bone marrow mononuclear cells as previously described (59). For each experiment mononuclear cells were obtained by flushing bone marrow from femurs, tibiae, and humeri of 3–5 WT or Chrm3^−/− mice with HyClone alpha MEM medium (Thermo-Scientific; Chicago, IL) preequilibrated at 37°C. Cells were cultured overnight in alpha MEM medium containing 10% FBS and 1% penicillin/streptomycin in a humidified incubator at 37°C with 5% CO₂. Nonadherent cells were collected by centrifugation after lysis of red blood cells using red blood cell lysis buffer and mononuclear cells were counted and plated. Mature macrophages were generated by differentiating isolated mononuclear cells with 20 ng/ml rM-CSF (R&D Systems; Minneapolis, MN) for 7 days. We confirmed that these cells were macrophages by determining cell expression of CD11b and F4/80 (37). WT and Chrm3^−/− macrophages were then treated with IL-4 for 24 h to determine their ability to attain an alternatively activated macrophage (AAM) phenotype, as indicated by the expression of known AAM marker, arginase-1 (32, 38, 47, 61, 66, 67).

Solutions and drugs.

All drugs used for physiological studies were obtained from Sigma-Aldrich (St. Louis, MO) unless otherwise indicated.

Data analysis.

For multiple comparisons, statistical analyses were performed using a one-way analysis of variance (ANOVA) with post hoc analysis for multiple comparisons. For two comparisons, statistical analyses were performed using Student's t-test. Data analyses were performed using GraphPad Prism software version 3.03. Differences between groups were considered statistically significant at P values ≤ 0.05.

RESULTS

Permeability is increased in Chrm1^−/− and Chrm3^−/− small intestine in the absence of mucosal damage.

Evaluation of H&E-stained small intestinal sections from WT and Chrm3^−/− C57BL/6 mice (Fig. 1, A and B) demonstrated no significant differences in intestinal morphology as assessed using the Chiu scoring system among WT (0.03 ± 0.02), Chrm1^−/− (0.07 ± 0.05), Chrm3^−/− (0.06 ± 0.04), and Chrm1,3^−/− (0.04 ± 0.04). There were no significant differences in villus height among WT (232 ± 23 μM), Chrm1^−/− (185 ± 19 μM), Chrm3^−/− (191 ± 6 μM), and Chrm1,3^−/− (191 ± 10 μM). Similarly, there were no significant differences in the amount of cellular infiltrates visualized in Giemsa-stained sections of small intestine from WT, Chrm1^−/−, Chrm3^−/−, and Chrm1,3^−/− 129S6/SvEv:CF1 (50%:50%) mice (Fig. 1, C–F). To determine if permeability is constitutively altered with M1R, M3R, or combined M1R/M3R deficiency, we measured TEER of muscle-free small intestine from WT, Chrm1^−/−, Chrm3^−/−, and Chrm1,3^−/− mice. Compared with WT small intestine, TEER was decreased to a similar extent in small intestine from Chrm3^−/− and Chrm1,3^−/− mice (Fig. 2A). Compared with WT small intestine, TEER was also decreased in Chrm3^−/− small intestine on the C57BL/6 background (Fig. 2B), thereby demonstrating that decreased TEER was a consequence of genetic ablation of M3R and not a unique property associated with either the 129S6/SvEv:CF1 (50%:50%) or C57BL/6 genetic backgrounds.

Fig. 1.

Representative sections of H&E-stained small intestine from wild-type (WT) C57BL/6 (A) and Chrm3^−/− C57BL/6 mice (B) and Giemsa-stained small intestine from WT (C), Chrm1^−/− (D), Chrm3^−/− (E), and Chrm1,3^−/− (F) 129S6/SvEv:CF1 (50%:50%) mice. Bar, 50 μm. Magnification, 10×. Hatched line square is area of higher magnification (20×) inset in respective panel.

Fig. 2.

TEER of muscle-free small intestine from WT, Chrm1^−/−, Chrm3^−/−, and Chrm1,3^−/− 129S6/SvEv:CF1 (50%:50%) mice (N = 12–15 mice per group) (A) and WT and Chrm3^−/− C57BL/6 mice (N = 4–5 mice per group) (B). C: flux of 4 kDa FITC-dextran across WT (closed squares) and Chrm3^−/− (open squares) muscle-free smooth intestine at various time points (N = 4–5 mice per group). TEER of muscle-free colon from WT (n = 7), Chrm1^−/− (n = 2), Chrm3^−/− (n = 4) and Chrm1,3^−/− (n = 6) 129S6/SvEv:CF1 (50%:50%) mice measued in microsnapwells (N = 2–7 mice per group) (D) and Ussing chambers (N = 8–13 mice per group) (E). TEER, transepithelial electrical resistance. **P < 0.01, *P < 0.05 vs. WT.

FITC-dextran flux across small intestinal mucosa was measured to confirm the permeability defect suggested by TEER measurements. Dextran flux was greater across Chrm3^−/− compared with WT small intestinal mucosa (Fig. 2C). In addition, TEER did not differ between WT, Chrm1^−/−, Chrm3^−/−, and Chrm1,3^−/− colon (Fig. 2, D and E). Gene expression of Chrm1, Chrm2, Chrm4, and Chrm5 did not differ in Chrm3^−/− small intestine (Table 2). Together, these data indicate that deletion of M3R is associated with increased paracellular flux in the small intestine.

Table 2.

Gene expression of muscarinic receptors in uninfected and N. brasiliensis-infected WT and Chrm3^−/− small intestine

	WT (n = 5)	Chrm3−/− (n = 3)	N. brasiliensis-Infected WT (n = 9)	N. brasiliensis-Infected Chrm3−/− (n = 6)	P Value
Chrm1	1.0 ± 0.4	1.4 ± 0.7	1.3 ± 0.2	1.2 ± 0.3	0.87
Chrm2	1.0 ± 0.6	1.2 ± 0.4	0.8 ± 0.2	0.7 ± 0.1	0.60
Chrm4	1.0 ± 0.5	1.3 ± 0.1	1.7 ± 0.3	1.4 ± 0.4	0.62
Chrm5	1.0 ± 0.4	1.0 ± 0.3	0.9 ± 0.1	1.0 ± 0.2	0.97

N = 3–5 mice per uninfected group and N = 6–9 mice per infected group.

Upregulation of proinflammatory cytokine expression in Chrm3^−/− intestine.

Gene expression of T_H1/T_H17 and T_H2 cytokines was measured to determine if changes in permeability were associated with alterations in basal cytokine profiles. In muscle-free small intestine from 129S6/SvEv:CF1 (50%:50%) mice, genetic ablation of M3R was associated with upregulation of IFN-γ and TNF-α (Fig. 3A). Similarly, gene expression of IFN-γ, TNF-α, and IL-17A was increased in muscle-free small intestine from Chrm3^−/− C57/BL6 mice (Fig. 3B). Gene expression of the T_H2 cytokine IL-13 was decreased in 129S6/SvEv:CF1 Chrm3^−/− small intestine (Fig. 3C), but was unchanged in C57/BL6 Chrm3^−/− small intestine (data not shown). Gene expression of IL-4 was unchanged in Chrm3^−/− small intestine from either strain. Gene expression of IL-5 was decreased and IL-10 was increased in 129S6/SvEv:CF1 Chrm3^−/− small intestine (Fig. 3D), but was unchanged in C57/BL6 Chrm3^−/− small intestine (Fig. 3E). Together, these data indicate that genetic ablation of M3R is associated with upregulation of proinflammatory T_H1/T_H17 cytokines in uninfected murine small intestine. It should be noted that expression of Chrm1, Chrm2, Chrm4, and Chrm5 did not differ between N. brasiliensis-infected WT and Chrm3^−/− small intestine (Table 2). Chrm3 expression was also unchanged between uninfected and N. brasiliensis-infected WT mice (1.0 ± 0.2 vs. 1.3 ± 0.2, P = 0.39).

Fig. 3.

Gene expression of IFN-γ (IFN), IL-17A (IL-17), and TNF-a (TNF) in WT (black bars) and Chrm3^−/− (white bars) (A) 129S6/SvEv:CF1 (50%:50%) (N = 5–6 mice per group) and C57BL/6 mice (N = 4–5 mice per group) (B). C: gene expression of IL-4 (IL-4) and IL-13 (IL-13) in WT (black bars) and Chrm3^−/− (white bars) 129S6/SvEv:CF1 (50%:50%) mice (N = 5–6 mice per group). Gene expression of IL-5 (IL-5) and IL-10 (IL-10) in WT (black bars) and Chrm3^−/− (white bars) 129S6/SvEv:CF1 (50%:50%) (D) and C57BL/6 (E) mice (N = 5–6 mice per group). WT, wild type; Chrm3^−/−, M3R-deficient. *P < 0.05, **P < 0.01 vs. WT.

Clearance of N. brasiliensis from Chrm3^−/− mice is impaired.

WT and Chrm3^−/− mice were infected with N. brasiliensis and fecal egg counts were determined 9 days postinfection (DPI). Feces from Chrm3^−/− mice had higher egg counts than feces from WT mice (Fig. 4A). To confirm that this was due to greater intestinal worm burden, nematodes residing within the proximal small bowel (duodenum) were counted (Fig. 4B). The number of nematodes within the proximal small intestine was greater in Chrm3^−/− compared with WT mice. These data indicate delayed clearance of N. brasiliensis in Chrm3^−/− mice. These changes were not attributed to changes in intestinal morphology as damages scores [Chiu et al. (Ref. 10) system of 1–5] were not significantly different among WT control (0.03 ± 0.02), WT Nb9 (0.07 ± 0.03), Chrm3^−/− control (0.02 ± 0.02), and Chrm3^−/− Nb9 (0.10 ± 0.05).

Fig. 4.

A: fecal egg content at 9 DPI from WT (black bars) and Chrm3^−/− (white bars) mice (N = 4–5 mice per group). B: nematode count within the proximal small intestine (duodenum) at 9 DPI (N = 4–5 mice per group). **P < 0.01, *P < 0.05 vs. WT.

Upregulation of T_H2 cytokines is abrogated in N. brasiliensis-infected Chrm3^−/− small intestine.

As expected, both IL-13 and IL-4 were upregulated significantly in N. brasiliensis-infected WT small intestine (Fig. 5, A and B). In contrast, the upregulation of IL-13 and IL-4 was abrogated in N. brasiliensis-infected Chrm3^−/− small intestine (Fig. 5, A and B). Expression of T_H1/T_H17 cytokines was also determined. IFN-γ was upregulated modestly in N. brasiliensis-infected Chrm3^−/− mucosa, but not in WT mucosa. Neither TNF-α nor IL-17 was upregulated in N. brasiliensis-infected Chrm3^−/− mucosa (Fig. 5C). Gene expression of CD3 was similar in uninfected and N. brasiliensis-infected WT and Chrm3^−/− mice (data not shown) suggesting intact T cell recruitment to GI mucosa despite the absence of M3R. These data indicate that genetic ablation of M3R is associated with impaired generation of T_H2 cytokines in response to enteric nematode infection.

Fig. 5.

Gene expression of IL-13 (A) and IL-4 (B) in uninfected and N. brasiliensis-infected (7–9 DPI) WT (black bars) and Chrm3^−/− (white bars) intestine (N = 3–5 mice per uninfected group and N = 6–9 mice per infected group). C: gene expression of T_H1/T_H17 cytokines in N. brasiliensis-infected (7–9 DPI) WT (black bars) and Chrm3^−/− (white bars) intestine. (N = 6–9 mice per group.) *P < 0.05 vs. WT.

T_H2-dependent changes in gut function are not observed in N. brasiliensis-infected Chrm3^−/− mice.

Upregulation of the T_H2 cytokines IL-4 and IL-13 induces characteristic STAT6-dependent changes in intestinal physiology generating several stereotypic functional changes such as increased permeability, smooth muscle hypercontractility, decreased epithelial secretion, decreased fluid absorption, and goblet cell expansion. These alterations in gut function promote nematode expulsion (15, 29, 30, 45, 63, 64). As expected, small intestinal TEER decreased in N. brasiliensis-infected WT mice, indicating increased epithelial permeability (Fig. 6A). This decrease was not observed in small intestine from N. brasiliensis-infected Chrm3^−/− mice (Fig. 6A). Smooth muscle responses to acetylcholine in Chrm3^−/− mice were ∼29% of the responses in WT mice (Fig. 6B) consistent with prior reports demonstrating that smooth muscle contraction in response to carbachol in Chrm2^−/− and Chrm3^−/− mice is mediated by M2R and M3R, respectively (34, 48, 49, 53). In contrast, the amplitude of spontaneous contractions was similar in WT and Chrm3^−/− mice (Fig. 6B). The characteristic smooth muscle hypercontractility in response to acetylcholine was evident in N. brasiliensis-infected WT mice, but was not observed in N. brasiliensis-infected Chrm3^−/− mice (Fig. 6C). There was a decrease in acetylcholine-induced epithelial secretion in N. brasiliensis-infected WT mice, an effect that was absent in N. brasiliensis-infected Chrm3^−/− mice (Fig. 6D). Glucose-stimulated epithelial absorption was also decreased in N. brasiliensis-infected WT mice, but this change was not observed in small intestine from N. brasiliensis-infected Chrm3^−/− mice (Fig. 6E). Finally, goblet cell expansion occurred in N. brasiliensis-infected WT mice, but was not observed in N. brasiliensis-infected Chrm3^−/− mice (Fig. 7, A–E). No differences in histology existed between uninfected and N. brasiliensis-infected WT and Chrm3^−/− mice (Fig. 7F) (10). Together these data demonstrate that stereotypic physiological changes induced by enteric nematode infection are not observed in Chrm3^−/− mice, emphasizing the dependence of these changes in gut function on generation of T_H2 cytokines and downstream activation of STAT6-dependent genes.

Fig. 6.

A: percent change in TEER in uninfected and N. brasiliensis-infected (9 DPI) WT (black bars) and Chrm3^−/− (white bars) mice. N = 4 mice per group (uninfected) and 3–4 mice per group (infected). B: smooth muscle contraction in response to acetylcholine 100 μM (left) and spontaneous smooth muscle contraction (right) in WT (black bars) and Chrm3^−/− (white bars) mice. N = 3 mice per group. C: smooth muscle contraction in response to acetylcholine 100 μM (left) and spontaneous smooth muscle contraction (right) in WT (black bars) and Chrm3^−/− (white bars) mice. N = 3 mice per group (uninfected) and 4 mice per group (infected). D: percent change in epithelial secretion in response to acetylcholine 100 μM in uninfected and N. brasiliensis-infected (9 DPI) WT (black bars) and Chrm3^−/− (white bars) mice. N = 3–4 mice per group (uninfected) and 4 mice per group (infected). E: percent change in epithelial absorption in response to glucose 40 μM in uninfected and N. brasiliensis-infected (9 DPI) WT (black bars) and Chrm3^−/− (white bars) mice. N = 3–4 mice per group (uninfected) and 4 mice per group (infected). **P < 0.01, *P < 0.05 vs. WT uninfected. TEER, transepithelial electrical resistance; I_SC, change in short-circuit current; WT, wild type. Chrm3^−/−, M3R-deficient.

Fig. 7.

Representative H&E-stained sections from WT uninfected (A), Chrm3^−/− uninfected (B), N. brasiliensis-infected WT (C), and N. brasiliensis-infected Chrm3^−/− small intestine (D). E: mean ± SE of goblet cells per crypt-villus unit in uninfected and N. brasiliensis-infected WT (black bars) and Chrm3^−/− (white bars) intestinal mucosa. Twenty crypt-villus units from 3 mice counted per bar. F: Chiu score of intestinal mucosa from uninfected and N. brasiliensis-infected WT and Chrm3^−/− C57BL/6 mice. Twenty well-oriented fields from 3 mice counted per bar. Bar, 50 μm. Magnification, 10×. Hatched line square = area of higher magnification (20×), inset in respective panel. D9, 9 days postinfection.

Chrm3^−/− macrophages retain their ability to attain an alternatively activated phenotype in the presence of IL-4.

Macrophages are a critical component of the innate immune system and contribute to host defense. We demonstrated previously that BMDM express MR (37). BMDM were generated and tested to determine the effects of M3R-deficiency on their ability to attain an alternatively activated phenotype after costimulation with the T_H2 cytokine IL-4. As expected, Arg-1 gene expression was upregulated significantly in WT BMDM treated with IL-4 (Fig. 8A). Interestingly, Arg-1 gene expression was upregulated more robustly in Chrm3^−/− BMDM treated with IL-4 compared with WT BMDM treated with IL-4 (Fig. 8A). These data demonstrate that when Chrm3^−/− macrophages are stimulated with the T_H2 cytokine IL-4 they retain their ability to attain an AAM, and attain a more profound degree of alternative activation compared with WT macrophages.

Fig. 8.

A: gene expression of Arg-1 in WT or Chrm3^−/− BMDM treated with vehicle or IL4 (20 ng/ml, white bars). Data are representative of three experiments. B: gene expression of Arg-1 in uninfected and N. brasiliensis-infected WT (black bars) and Chrm3^−/− (white bars) small intestine. N = 3–5 mice per group (uninfected) and 5–8 mice per group (infected). WT, wild type. Chrm3^−/−, M3R-deficient. **P < 0.01 vs. vehicle. ##P < 0.01 vs. WT IL4.

We also examined the ability of Chrm3^−/− macrophages to respond to T_H2 stimulation in vivo by determining gene expression of Arg-1 in N. brasiliensis-infected WT and Chrm3^−/− small intestine. As expected, in WT mice N. brasiliensis infection was associated with increased expression of Arg-1 (Fig. 8B), suggesting an increased proportion of AAM in intestinal mucosa. In contrast, Arg-1 was not upregulated in N. brasiliensis-infected Chrm3^−/− mice (Fig. 8B). Together, these data indicate that macrophages retain their ability to respond to T_H2 stimulation despite the absence of M3R and demonstrate that AAM are not generated in N. brasiliensis-infected Chrm3^−/− intestine due to the impaired production of T_H2 cytokines.

DISCUSSION

M3R are expressed on structural cells such as epithelium, enteric neurons, and smooth muscle cells as well as on immune cells including macrophages and T cells (20, 50). In the present study, mice deficient in M3R have a “leaky gut” coincident with elevated expression of proinflammatory cytokines. Challenging Chrm3^−/− mice with N. brasiliensis infection demonstrated that the development of a T_H2 immune response induces alterations in GI function that facilitate worm expulsion, which are dependent on M3R. These findings suggest a role for acetylcholine acting at M3R in of the modulation of barrier function as well as in the generation of type 2 immune responses.

M3R is important for both smooth muscle and epithelial cell function. In Chrm3^−/− mice, smooth muscle responsiveness to acetylcholine was inhibited markedly, but not abrogated, a finding consistent with a dominant role for M3R and a supporting role for M2R in this regard (53). The absence of an effect of M3R on spontaneous contractions is consistent with prior reports indicating that M3R plays only a modulatory role in rhythmic contractions (52). MR also contribute to epithelial barrier function. Stress-induced increases in permeability were attributed, in part, to neural release of acetylcholine acting at MR expressed on epithelium (17). Subsequent studies showed that MR agonists increased, while MR antagonists decreased, transepithelial transport across unstripped ilea or T84 cells (7). More recently, activation of M1R was found to contribute to restoration of barrier function in ethanol-treated T84 cells (25); however, in the present study TEER was similar in WT and Chrm1^−/− mice. Of note, T84 cells are used as a model for chloride secretion, a property that is associated with crypt cells, which have a lower TEER than mature villous cells in the small intestine (33). In addition, there were no differences in colonic TEER between WT and MR deficient strains. While these discrepancies may be attributed, in part, to the use of cultures of transformed cells vs. whole tissue, the enhanced permeability of small intestine observed in Chrm3^−/− mice may be linked to upregulated expression of pro-inflammatory T_H1/T_H17 cytokines. IFN-γ is known to induce cytoskeletal changes that result in increased epithelial permeability and impaired barrier function (55, 58). Thus, the modest upregulation of T_H1/T_H17 cytokines observed in uninfected Chrm3^−/− small intestine is more likely secondary to immune activation leading to defective barrier function, rather than an undemonstrated anti-inflammatory effect of M3R on intestinal epithelial cells.

Delayed clearance of N. brasiliensis from Chrm3^−/− mice can be attributed directly to a failed upregulation of T_H2 cytokines. Whether basal expression of T_H1/T_H17 cytokines affects the ability of Chrm3^−/− mice to mount a T_H2 response to enteric nematodes is currently unclear, although it is known that increases in IFN-γ can suppress host defense against N. brasiliensis (15). The defect underlying the impaired ability of Chrm3^−/− mice to generate T_H2 cytokines in the setting of nematode infection appears to be T-cell mediated, as isolated T cells from WT mice stimulated with muscarinic or cholinergic agonists increase T_H2 production in a dose-dependent manner with T_H2 production attenuated in Chrm3^−/− T cells (12). Supporting this concept are studies examining the effects of cholinergic stimulation on differentiation of murine T cells. Activation of NR on naïve CD4 cells favored development of the T_H1 lineage while inhibiting T_H17, whereas MR activation promoted T_H2 and T_H17 lineages while inhibiting T_H1 (40), suggesting that MR may play a role in T cell differentiation. Together, these data suggest that in the absence of M3R, T cells (24, 40, 42) specifically impair the response to T_H2-inducing stimuli. This hypothesis is supported by the observation that Chrm3^−/− mice are able to mount a T_H1/T_H17 response against Citrobacter rodentium (37); M3R activation specifically modulates the development of a T_H2 response, but not a T_H1/T_H17 response.

Expulsion of N. brasiliensis begins between 7 and 9 DPI and is facilitated by STAT6-dependent stereotypic changes in gut function (15, 29, 30, 45, 63, 64). In the present study, the failure to develop the stereotypic smooth muscle hypercontractility, enhanced epithelial permeability, reduced mucosal secretion and absorption, and goblet cell expansion can be attributed directly to the inability of Chrm3^−/− mice to elevate intestinal T_H2 cytokine production. This is similar to results obtained from mice deficient in IL-4 receptor α (21) or its signaling transducer STAT6 (29, 30, 63). However, these studies do not exclude a critical role for M3R on smooth muscle or epithelial cells in mediating the functional effects of nematode infection. Within the lung, markedly reduced levels of IL-4, IL-5, and eotaxin were observed in ovalbumin-stimulated mice treated with bencycloquidium bromide, a M3R antagonist (8), further supporting a role for M3R in the generation of T_H2 cytokines. We showed previously that nematode infection increases expression of M3R (36), induces hypercontractility of smooth muscle, and decreases epithelial response to acetylcholine (30, 63). Others showed that T_H2 cytokines increase the affinity of M3R to agonist-mediated contractions on smooth muscle (1). We did not observe any change in the expression of other MR in Chrm3^−/− mice indicating that changes in MR distribution are unlikely to contribute to the observed phenotype. Our data indicate that M3R activation by acetylcholine or other ligands plays a key role in both the adaptive immune response to nematode infection, as well as the downstream functional changes that promote worm clearance.

Enteric nematode infection is associated with reduced risk of autoimmune diseases, including IBD, as well as attenuated severity of colitis in murine models (26, 57). In addition to stimulating production of T_H2 cytokines, enteric nematode infection triggers recruitment of immune cells including mast cells, eosinophils, basophils, and macrophages (31). Nematode infection induces STAT6-dependent development of AAM (3, 65) that is critical for smooth muscle hypercontractility (63) and impaired glucose transport in epithelial cells (39). The lack of AAM in N. brasiliensis-infected Chrm3^−/− mice can be attributed directly to impaired upregulation of T_H2 cytokines.

With α7 NR, M3R is one of at least two cholinergic receptors capable of modulating macrophage phenotype and function. Our in vitro data demonstrate that M3R modulates macrophage phenotype in response to a T_H2 stimulus (IL-4), with enhanced expression of Arg-1 in the absence of M3R, indicating that M3R function on macrophages is in opposition to that of α7 NR. Although further studies are required, it is plausible that cholinergic tone affecting macrophage phenotype is regulated by interplay between α7 NR and M3R, with α7 NR driving macrophages towards an AAM phenotype or inhibiting development of the CAM phenotype and M3R serving a counterregulatory role suppressing AAM polarization or promoting CAM development. This may explain, in part, why mice with DSS-induced colitis develop exacerbated colitis and increased expression of pro-inflammatory cytokines after treatment with α7 NR-specific agonists (46).

Overall, our studies indicate that M3R activity contributes to mucosal barrier function in uninfected small intestine as well as the generation of a T_H2 response to N. brasiliensis infection. Similar observations have been made regarding the possible contribution of M3R to T_H2 immunity in pulmonary models (8). Our data suggest that in addition to its role in immune response to enteric nematode infection, M3R may serve a counterregulatory role in the generation of AAM, demonstrating that MR, specifically M3R, play a key and previously unappreciated role in mucosal homeostasis as well as immune regulation and the response to enteric nematodes.

GRANTS

This work was supported by National Institutes of Health Grants R01-A1/DK-049316 (to T. Shea-Donohue), R01-DK-083418 (to A. Zhao), and USDA/ARS 1235-51000-055 (to A. Smith and J. F. Urban). L. P. McLean was supported by NIH Grants T32-DK-067872 and P30-DK-090868. R. Sun was supported by NIH Grant T32-DK-067872.

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

AUTHOR CONTRIBUTIONS

L.P.M. and T.S.-D. conception and design of research; L.P.M., A.S., L.C., R.S., V.G., N.D., A.Z., and T.S.-D. performed experiments; L.P.M., A.S., A.Z., J.-P.R., and T.S.-D. analyzed data; L.P.M., A.S., J.F.U.J., A.Z., J.-P.R., and T.S.-D. interpreted results of experiments; L.P.M. and T.S.-D. prepared figures; L.P.M. and T.S.-D. drafted manuscript; L.P.M., A.S., J.F.U.J., J.-P.R., and T.S.-D. edited and revised manuscript; L.P.M., A.S., L.C., J.F.U.J., R.S., V.G., N.D., A.Z., J.-P.R., and T.S.-D. approved final version of manuscript.