Skip to main content
NCBI home page
Cell Cycle logoLink to Cell Cycle
. 2016 May 27;15(14):1929–1937. doi: 10.1080/15384101.2016.1191710

Cell cycle re-entry sensitizes podocytes to injury induced death

Manuel Hagen a, Eva Pfister a, Andrea Kosel a, Stuart Shankland b, Jeffrey Pippin b, Kerstin Amann a, Christoph Daniel a,✉
PMCID: PMC4968909  PMID: 27232327

ABSTRACT

Podocytes are terminally differentiated renal cells, lacking the ability to regenerate by proliferation. However, during renal injury, podocytes re-enter into the cell cycle but fail to divide. Earlier studies suggested that re-entry into cell cycle results in loss of podocytes, but a direct evidence for this is lacking. Therefore, we established an in vitro model to test the consequences of re-entry into the cell cycle on podocyte survival. A mouse immortalized podocyte cell line was differentiated to non-permissive podocytes and stimulated with e.g. growth factors. Stimulated cells were analyzed for mRNA-expression or stained for cell cycle analysis using flow cytometry and immunocytofluorescence microscopy. After stimulation to re-entry into cell cycle, podocytes were stressed with puromycin aminonucleoside (PAN) and analyzed for survival. During permissive stage more than 40% of immortalized podocytes were in the S-phase. In contrast, S-phase in non-permissive differentiated podocytes was reduced to 5%. Treatment with b-FGF dose dependently induced re-entry into cell cycle increasing the number of podocytes in the S-phase to 10.7% at an optimal bFGF dosage of 10 ng/ml. Forty eight hours after stimulation with bFGF the number of bi-nucleated podocytes significantly increased. A secondary injury stimulus significantly reduced podocyte survival preferentially in bi-nucleated podocytes In conclusion, stimulation of podocytes using bFGF was able to induce re-entry of podocytes into the cell cycle and to sensitize the cells for cell death by secondary injuries. Therefore, this model is appropriate for testing new podocyte protective substances that can be used for therapy.

KEYWORDS: bi-nucleation, injury, kidney, podocytes, re-entry into cell cycle

Introduction

Progressive glomerular scarring (glomerulosclerosis) is the major final common pathway and pathologic process leading to end- stage renal disease (ESRD).1 In the United States alone, more than 500,000 patients have ESRD, with costs exceeding $35 billion per year.2 Increasing evidence shows that loss of podocytes may be a crucial factor underlying glomerulosclerosis in classic proteinuric glomerular diseases.3 Moreover, other glomerular diseases such as IgA nephropathy,4 diabetic nephropathy5 and hypertensive nephrosclerosis6 also show a direct correlation between podocyte loss and glomerulosclerosis.

Podocytes are terminally differentiated renal epithelial cells. During renal development, podocyte precursor cells migrate to the glomerular tuft where differentiation7 begins accompanied by changes in cell cycle regulation. Cell cycle proteins favoring proliferation decrease, whereas the expression of cell cycle inhibitors (CKI) p27 and p57 increase.8 These cell cycle events ultimately lead to cell cycle arrest and a quiescent phenotype characteristic of the adult podocyte phenotype. Several authors assume that the cell cycle exit is necessary to maintain the normal function and structure of adult podocytes.9 However, after injury podocytes are able to re-enter the cell cycle. In response to stress stimuli, levels of cyclin A and cyclin dependent kinase 2 increase and a limited DNA synthesis occurs.10 However, the number of podocytes typically remains constant due to increasing expression of the CKI p21 and p27.10 Furthermore, mature podocytes are not able to form an efficient mitotic spindle based on the lack of Aurora kinase B expression.11,12 Nevertheless, biopsies of IgA nephropathy, focal segmental glomerulosclerosis and Lupus nephritis show bi- and poly-nucleated podocytes.13 This is consistent with cell cycle entry, but abnormal mitosis. Recently, several studies suggested that aberrant mitosis of podocytes leads to podocyte loss, proteinuria and subsequently to the progression of glomerular disease.12,14,15 However, objective evidence for susceptibility of bi- and poly-nucleated podocytes to stress is still lacking. In this study we hypothesize that binucleation sensitizes podocytes to injury induced cell death. Since it is difficult to investigate these phenomena in vivo, we established an in vitro model to investigate consequences of podocyte re-entry into the cell cycle.

Results

Cell cycle arrest in differentiated podocytes in vitro

To establish an in vitro model in which differentiated podocytes are cell cycle arrested, we initially cultured a mouse immortalized podocyte cell line under growth permissive conditions with 50 U/ml INF-ɣ supplementation at 33°C. After propagation, podocytes were switched to restrictive conditions without INF-ɣ at 37°C for 12 days. Podocytes stained with propidium iodide were analyzed by flow cytometry (Fig. 1A). The S-phase fraction was reduced from 41.5% under permissive conditions to 5.2% under non- permissive conditions (Fig. 1B).

Figure 1.

Figure 1.

Open in a new tab

Flow cytometry analysis of cell cycle in podocytes. Cell cycle phases of undifferentiated (A), differentiated (B) and stimulated (C, 10 ng/ml bFGF) podocytes. After staining with propidium iodide, cells were analyzed by flow cytometry using Flow-Jo software. Under permissive conditions 41.5 % of the cells were found to be in S-phase (A, yellow area). After 12 days under restrictive conditions, the S- phase fraction was reduced to 5.2% (B, yellow area). Stimulation with bFGF were able to rise the S- phase fraction to 10.7% (C, yellow areal). (D) Dose depended effect of bFGF on the cell cycle progression was assessed by determination of S-phase using FlowJo-software.

Identification of stimuli that force cell cycle re-entry of differentiated podocytes

Next, we searched for potential cytokines/growth factors that forced quiescent cultured podocytes to re-enter the cell cycle. Differentiated podocytes were incubated with bFGF, TGFβ, INFβ, TNFα, EGF and LPS for 24 and 48 hours at 37°C at different concentrations, followed by cell cycle analysis using flow cytometry and FlowJo- software. Table 1 only shows the effects of the most effective concentrations. INFβ, TNFα, EGF and LPS had no influence on cell cycle phases (Table 1). In contrast, bFGF and TGFβ induced cell cycle re-entry, where the S-phase fraction was elevated from 5.2% to 8.9% by TGFβ (2 ng/ml), although this was not dose dependent. S-phase increased to 10.7% by bFGF (10 ng/ml) in a dose-dependent manner. Cell cycle re-entry started at 1 ng/ml bFGF, and reached a maximum effect at 10ng/ml bFGF (Fig. 1D). In addition, bFGF treatment significantly reduced the number of G0/1 and increased the number of G2/M-phase podocytes (Table 1). Based on these results, the majority of subsequent experiments were performed with bFGF.

Table 1.

Identification of stimuli that promote re-entry into cell cycle. Differentiated podocytes were treated with different stimuli for 48 h at 37°C followed by staining with propidium iodide and flow cytometry analysis.

Substance [conc.] G0/1- phase [%] S- phase [%] G2/M- phase [%]
control 65.87 ± 0.67 5.20 ± 0.13 27.83 ± 1.19
TNFα [1 ng/ml] 63.97 ± 0.56 5.45 ± 0.50 28.22 ± 0.72
INFβ [500 U/ml] 63.84 ± 1.40 5.43 ± 0.19 29.32 ± 1.65
EGF [30 nmol] 65.31 ± 1.52 5.64 ± 0.23 28.73 ± 0.85
LPS [25 µg/ml] 66.60 ± 1.27 5.60 ± 0.38 27.70 ± 0.64
TGFβ [2 ng/ml] 62.85* ± 1.60 8.90* ± 1.42 27.86 ± 1.27
bFGF [10 ng/ml] 60.75*± 1.96 10.68*± 1.67 30.84* ± 1.24
Open in a new tab

Data were shown as means ± SEM. TGFβ and bFGF

*

p < 0.05 vs control were able to induce cell cycle re-entry. Experiments were performed three times for each substance.

Basic FGF-stimulation increased the number of bi-nucleated podocytes

Following differentiation, 6.4 ± 0.6% of podocytes were bi-nucleated. The number of bi-nucleated podocytes increased significantly following 24 h of stimulation with bFGF (Fig. 2A). This effect was also dose-dependent, ranging from 9.5 ± 0.7% of podocyte being bi-nucleated when exposed to 1 ng/ml bFGF, to 11.5 ± 1.0% at 20ng/ml bFGF. The fraction of podocytes with bi-nucleated nuclei further increased following 48 h of stimulation, being 10.5 ± 0.65% at 1 ng/ml and 14.5 ± 0.65% at 20ng/ml bFGF (Fig. 2B). A representative picture showing 2 bi-nucleated podocytes 48 h after stimulation with 20ng/ml bFGF is shown (Fig. 2C).

Figure 2.

Figure 2.

Open in a new tab

Basic FGF induced bi-nucleation in differentiated podocytes. Twenty four (A) and 48 hours (B) after stimulation with bFGF, the number of bi-nucleated podocytes was increased significantly (p < 0.05). The fraction of bi-nucleated cells raised dose dependently and was higher after 48 hours compared to 24 hours. Immunostaining of bi-nucleated podocytes with DAPI (blue fluorescence) and nephrin (green fluorescence) is shown in C. White arrows indicate bi-nucleated podocytes.

Basic FGF stimulation induced proliferation markers in differentiated podocytes

To confirm the re-entry of differentiated podocytes into the cell cycle following bFGF stimulation, cell proliferation markers were measured by real-time PCR and immunofluorescence staining (IF). The pan-proliferation marker Ki67 was expressed in more than 60% of undifferentiated, nephrin negative podocytes, as assessed by IF (Fig. 3A, B, M). In contrast, the percentage of Ki67-positive podocytes was below 3.5% in differentiated, nephrin positive PBS-stimulated controls (Fig. 3C, D, M). However, 48 h after treatment of differentiated podocytes with 10 ng/ml bFGF, the fraction of Ki67-positive cells was nearly doubled compared to PBS-stimulated controls (Fig. 3E, F, M). The bFGF-mediated increase in Ki67 expression in differentiated podocytes was confirmed at the mRNA-level, showing more than a 2-fold higher expression levels compared to unstimulated controls when 1 to 20 ng/ml bFGF were used for stimulation (Fig. 3O). In addition, similar observations in podocytes could be made for phosphorylated histone H3 (P-H3), a marker of G2/M-cell cycle phase. P-H3 was detectable in 12.2 ± 1.1% of undifferentiated and in only 1.4 ± 0.7% of non-stimulated differentiated podocytes (Fig. 3G-J, N). In contrast, following 48 h of stimulation with 10 ng/ml bFGF, the percentage of P-H3 positive podocytes raised on 3.4 ± 0.4% being more than 2-times higher than controls (Fig. 3K, L, N).

Figure 3.

Figure 3.

Open in a new tab

Basic FGF stimulation induced cell proliferation markers in differentiated podocytes. Undifferentiated (A, B, G, H) differentiated (C, D, I, J) and bFGF stimulated differentiated podocytes (E, F, K, L) were stained with DAPI (blue fluorescence), nephrin (green fluorescence) and cell cycle markers (red fluorescence; Ki67, and H3). White scale bar represents 100 µm. 48 hours after stimulation (10 ng/ml bFGF), the expression of Ki67 (M; p = 0.011), H3 (N; p = 0.035) was increased significantly compared to unstimulated podocytes. Treatment of differentiated podocytes using different bFGF concentrations resulted in Ki67 mRNA upregulation as assessed by Real-time PCR (O; *p < 0.05 vs. control).

Basic FGF lowered the threshold to puromycin aminonucleoside (PAN) induced cell death

Given the relationship of cell cycle entry, mitotic arrest and apoptosis, we next investigated the apoptotic susceptibility of podocytes with reactivated cell cycle to injury. bFGF (10 ng/ml) exposed podocytes were incubated with 30µg/ml PAN for 24h. As shown in Figure 4, the percentage of PAN-induced dead cells was significantly increased by about 50% in bFGF treated cells compared to untreated podocytes, as assessed by trypan blue exclusion assay (Fig. 4A, p = 0.032). Similar results were assessed by analysis of cell culture supernatants using LDH activity assay (Fig. 4B, p = 0.057). bFGF stimulation for itself had no cytotoxic effect compared to control (Fig. 4A, B). In addition, preferentially bi-nucleated podocytes were susceptible for injury by PAN, as shown by more than 35% trypan blue positive bi-nucleated podocytes (Fig. 4C, p = 0.047).

Figure 4.

Figure 4.

Open in a new tab

Re-entry into cell cycle reduced survival of differentiated podocytes after PAN stimulation. Podocyte death was investigated by trypan blue ingestion assay (A) and cytotoxicity was assessed by LDH assay (B). Differentiated podocytes were treated with PBS (ctrl., white bars), 10 ng/ml bFGF (bFGF, light gray bars), PBS + 30 µg/ml PAN (PAN, medium gray bars) or bFGF followed by PAN stimulation (bFGF + PAN, dark gray bars). Primarily bi- nucleated podocytes were susceptible for injury by PAN (C).

Podocytes with aberrant nuclear division are more prone to puromycin aminonucleoside (PAN) induced cell death

Nuclear division in podocytes may occur in a regular or aberrant manner, with the latter implying asymmetric nuclear divisions and micronuclei. Therefore, we analyzed the number of podocytes with asymmetric nuclear morphology as well as podocytes with more than 2 nuclei. In non-stimulated differentiated podocytes 16.6 ± 5.9% of binucleated podocytes showed nuclei with asymmetric morphology (Fig. 5A-C). In contrast, bFGF-treatment doubled the number of asymmetric podocyte nuclei compared to controls (Fig. 5A-C). Multinuclear podocytes were rarely found in non-stimulated control cells (0.2 ± 0.2%) but were significantly increased to 1.5 ± 0.4% in differentiated podocytes stimulated by bFGF (Fig. 5D-F, p < 0.05). Next, we evaluated if changes in nuclear morphology of bi- and multinucleated podocytes are more prone to puromycin aminonucleoside induced cell death. After stimulation of differentiated podocytes with bFGF and subsequent PAN-induced injury, only 9.7 ± 2.0% mono-nucleated podocytes were found to be trypan blue positive (Fig. 5G). Compared to the mono-nucleated podocytes this percentage was significantly increased 2-fold in binucleated podocytes with regular nuclei and 3-times higher in bi-nucleated podocytes with asymmetric nuclei (Fig. 5G-I). The mean percentage of trypan blue positive cells was highest in multinuclear podocytes, but did not reach the significance level compared to the susceptibility of mono-nucleated podocytes due to low frequency of these cells and resulting high standard deviation (Fig. 5G).

Figure 5.

Figure 5.

Open in a new tab

Podocytes with aberant nuclear division are more prone to puromycin aminonucleo-side (PAN) induced cell death. The percentage of binucleated podocytes with asymmetric nuclei was evaluated in non-treated, bFGF-treated, PAN-treated and bFGF + PAN-treated differentiated podocytes (A). A representative differentiated podocyte with asymmetric nuclear morphology DNA-staining by DAPI (B, C) and nephrin staining (C). The percentage of multinucleated podocytes were evaluated in all 4 treatment groups (D). A representative multinuclear differentiated podocyte was shown using DAPI DNA-staining (E, F) and nephrin staining (F). In differentiated podocytes treated with bFGF and PAN the number of mononucleated, regular binucleated (H), asymmetric binucleated (I) and multinucleated death podocytes was evaluated using trypan blue ingestion assay (G). *p < 0.05 vs. control; Scale bars represent 30 µm.

Discussion

Loss of podocytes is a key event in the progression of human glomerular diseases.5,16 Therefore, it is crucial to better understand the response of podocytes to injury. Under normal conditions, adult podocytes are terminally differentiated epithelial cells that have exited from the cell cycle.14 Nevertheless, stress stimuli, e.g., diabetic conditions or lupus nephritis, induce cell cycle re-entry in podocytes.11,17 Furthermore, animal models of podocyte injury like the passive Heymann nephritis model (PHN) of membranous nephropathy show increasing levels of cell cycle promoting cyclins and cyclin dependent kinases in podocytes. However, DNA synthesis and mitosis are very limited after injury.18 Despite studies showing re-entry of podocytes into the cell cycle,9,15,19-24 it is challenging to investigate consequences on podocyte survival in vivo. Therefore we here established an in vitro model for podocyte re-entry into cell cycle.

Using this in vitro model, we show for the first time a higher susceptibility of bi-nucleated podocytes to injury. Following bFGF stimulation of cell cycle re-entry, the number of dead podocytes (assessed by two different assays), doubled when exposed to PAN. Although the percentage of bi-nucleated podocytes was below 15% of all cells studied, up to 40% of dead cells were bi-nucleated. These results are consistent with bi-nucleated podocytes being more susceptible to death compared to cells with a single nucleus. However, we cannot exclude that podocytes that re-entered the cell cycle and were situated in G1, S or G2 phase are also more susceptible than quiescent podocytes. The use of cell cycle inhibitors for treatment of glomerular diseases is promising. For example, the cyclin dependent kinase inhibitor roscovitine prevented podocyte proliferation and improved renal function in a glomerulonephritis model.25 Furthermore, the G1-inhibitor rapamycin also prevented podocyte loss in a model of diabetic nephropathy.26

Bi- and multi-nucleated podocytes are described in a variety of human glomerular diseases.13,15 In a retrospective human renal biopsy study using 164 consecutive cases, multi-nucleated podocytes were identified in 7.4% of all investigated cases.15 However, it remained unclear if cell cycle re-entry limits or force the progression of glomerular disease? On the one hand re-entry in G1 phase resulting in consecutive podocyte hypertrophy can help to cover denuded areas of the basement membrane after cell loss and hereby sustain kidney function.7,27 Both human biopsy studies and animal models confirm hypertrophic podocytes in diseased kidneys to a certain extent.28-30 Surprisingly, using flow cytometry analysis, we did not detect a hypertrophic response after bFGF stimulation. Nevertheless, some podocytes continued to G2 phase with subsequent mitosis as demonstrated by bi- and multinucleated cells in vitro and in vivo. Several studies recently suggested that podocytes cannot simultaneously use their actin cytoskeleton for maintaining filtration function and forming the mitotic spindle.12 This incompatibility could result in aberrant mitosis with podocyte loss and progression of glomerular disease.14 Aberrant mitotis can result in asymmetric nuclear division or formation of multinuclear podocytes. Both phenomena could also be observed in our in vitro system particular after stimulation with bFGF. One of the indices that bi-nucleated podocytes impair the renal function is the association with heavy proteinuria and foot process effacement.31,32 Moreover, bi-nucleated podocytes were detected in the urine of patients with lupus nephritis33 and focal segmental glomerulosclerosis (FSGS).34 Both authors suggested that podocytes carrying nuclear abnormalities are more susceptible to injury and loss. Using our in vitro model we confirmed that nuclear abnormalities like asymmetric nuclear morphology or multinucleation notably sensitizes podocytes to injury induced cell death. However, in podocytes asymmetric nuclear division is not a prerequisite for an increased sensibility to injury. The majority of binucleated podocytes with regular nuclear morphology still showed a significantly increased sensitivity to injury.

In our study only bFGF and TGFβ induced cell cycle re-entry in vitro, consistent with former in vitro studies on immortalized podocytes. Wu et al. described a switch from G1/G0 to G2/M in podocytes stimulated with 4ng/ml TGFβ.35 However, in this study the induction of podocyte cell cycle re-entry was higher after stimulation with bFGF. Therefore, we focused on bFGF as proliferative stimulus for podocytes. Furthermore, microarray analysis studies investigating biopsies with chronic kidney disease showed upregulation of bFGF suggesting a role of bFGF for induction of cell cycle re-entry in vitro (Fig. S1).

Early studies described bFGF induced proliferation of primary rat podocytes in vitro, as assessed by measuring of cell numbers.36 Based on this study, Kriz et al. investigated long- term treatment of rats with bFGF over 13 weeks.31 Unexpected, high numbers of bi- and multi-nucleated podocytes were found in treated animals. Both observations could be confirmed in our in vitro experiments. Stimulation with bFGF was able to induce cell cycle re-entry dose-dependently, as assessed by induction of DNA-synthesis (Fig. 1) and increased numbers of bi-nucleated podocytes 24 and 48 h after stimulation (Fig. 2).

In contrast to earlier studies,36 we used a temperature sensitive podocyte cell line and several different read-outs for determination of cell cycle re-entry. Using real-time PCR we could confirm, that cell cycle promoting molecules like Ki67 were upregulated in podocytes by bFGF. In addition, we used immunofluorescence double staining to confirm that re-entry of the cell cycle was induced in differentiated podocytes and not in remaining non-differentiated podocytes. Indeed, all three proliferation markers were shown to be expressed in differentiated podocytes, expressing nephrin. Under permissive conditions podocytes appear much smaller and lack nephrin staining. The positive staining of the used proliferation markers underlined that differentiated podocyte pass the cell cycle from G1 to mitosis. Ki67 was expressed in different phases of cell cycle, peaking in mitotic phase but is lacking in the G0 phase.37 Later cell cycle events can be monitored by analysis of H3 phosphorylation, which starts at late G2 and peaks in prophase during mitosis.38

This study has some limitations. Stimulation of podocytes with bFGF did not induced cell cycle re-entry in all cells. However, the numbers of proliferating podocytes in vivo are also relatively low in diseased kidneys.15 Furthermore, the use of a podocyte cell line requires careful monitoring of the podocyte differentiation state to avoid false positive proliferation of non-differentiated cells. It remains unclear if puromycin induced injury mimics a meaningful setting in vivo. However, future studies will show if podocyte death can be also induced in binuclear podocytes by other stimuli like high glucose or osmotic stress.

In conclusion, using an in vitro model for investigation of podocyte cell cycle re-entry followed by puromycin aminonucleoside treatment, we could show for the first time that bi-nucleation, as sign of passing the cell cycle, sensitizes podocytes for cell death. In addition, the sensitivity was further increased in binucleated podocytes with asymmetric nuclear morphology and multinucleated podocytes. These data help to further validate the novel concept of podocyte loss by mitosis which may explain several phenomena of clinical medicine, experimental data, and human renal pathology. In addition, the in vitro model will be most likely useful for screening of podocyte protective drugs as potential new therapeutic strategies in the future.

Material and methods

Temperature-sensitive immortalized podocyte culture

In vitro experiments were performed utilizing temperature-sensitive, growth restricted conditionally immortalized mouse podocytes.39 Cells were grown on collagen type I-coated Primaria TC Cell Culture Flasks (Corning #353810) in RPMI 1640 (Sigma-Aldrich Chemie, R8758) containing 10% fetal bovine serum (FBS, Biochrom AG, S0615), 1% penicillin/streptomycin (Sigma-Aldrich Chemie, P0781), 1% HEPES (Sigma-Aldrich Chemie, H0887) buffer and 1% sodium pyruvate (Sigma-Aldrich Chemie, S8636). Under permissive conditions, cells proliferate in the presence of 50 U/ml gamma- interferon (Sigma-Aldrich Chemie, I4777) at 33°C. After proliferation, cells (passages 28-33) were switched to uncoated Culture Flasks without gamma- interferon at 37°C (non- permissive conditions). During the differentiation, podocytes increase in size and slow proliferation. After 4 days under growth- restrictive conditions, cells were re-plated on Primaria Cell Culture Dish at a density of 8000 cells/cm2. At day 9, culture medium was changed and the FBS fraction was reduced to 2% for 72 hours. Subsequently, cells accomplish differentiation after 12 days under non- permissive conditions.

Induction of cell cycle re-entry

For testing potential substances forcing podocytes to re-entry into the cell cycle we used stimuli that were described to induce stress in podocytes: bFGF,36 TGFβ,40 INFß,41 TNFα,40 EGF,36 and LPS.42 Differentiated podocytes were stimulated with different concentrations of bFGF (1, 10 and 20 ng, PeproTech, #450–33), TGFβ (2, 5, 10 and 20 ng, PeproTech, #100–21), INFβ (5, 25 and 50µg, Sigma-Aldrich Chemie, I9032), TNFα (1,10 and 50 ng, PeproTech, AF-315-01A), EGF (10, 30 and 60 nM, PeproTech, #315–09) and LPS (5, 25 and 50µg, Santa Cruz,sc-3535). After an incubation period of 24 and 48 hours, podocytes were trypsinized and collected in 70% methanol. In addition, culture medium was collected in order to assess cytotoxicity by LDH assay (Roche, #04744926001).

Cell cycle analysis by flow cytometry

Cell cycle was analyzed using flow cytometry and FlowJo-software. After fixation with 70% methanol, cells were frozen at −20°C for at least 24 hours. Subsequently, podocytes were washed with PBS (Sigma-Aldrich Chemie, D8537). For staining of DNA, RNA was digested by RNAse A (1mg/ml in PBS, Qiagen, #19101) for 30 min at 37°C. Afterwards, cells were strained with propidium iodide (0.5mM, Sigma Aldich, P8145) and analyzed by flow cytometry analysis using FlowJo-software (FLOWJO, LLC data analysis software, Ashland, USA). Percentages of G1, S and G2 cell cycle phase were determined using Dean-Jett-Fox model.

Real-time PCR

To evaluate changes of relative mRNA expression levels after bFGF stimulation differentiated podocytes were collected 24 h and 48 h after stimulation with 1, 10 or 20 ng/ml bFGF and PBS as control followed by isolation of total RNA using RNeasy Mini columns (Qiagen, #74106). Primers for 18 s (fw- TTGATTAAGTCCCTGCCCTTTGT; rev- CGATCCGAGGGCCTCACTA) were designed with the primer design software Primer Express 3 (Applied Biosystems, Weiterstadt, Germany) and synthesized (MWG-BIOTECH AG, Ebersberg, Germany) and Ki67 collected from literature (fw-CTGCCTGCGAAGAGAGCATC; rev-AGCTCCACTTCGCCTTTTGG).43 Primers were tested for target- specificity and amplification efficiency following standard quality protocols provided by Applied Biosystems (Weiterstadt, Germany). Reverse transcription reactions and Real-time PCR were performed using Power SYBR Green on a 7500 Fast Real time PCR system (both Applied Biosystems, Weiterstadt, Germany) according to the manufacturer's instructions. Real-time PCR data were analyzed using the SDS v1.3 software (Applied Biosystems). To compare the expression levels among the groups, the relative expression of target gene mRNA levels was calculated using the comparative delta Ct (threshold cycle number) method.44 Normalization was conducted against the endogenous 18 S rRNA levels applied to the resulting relative fold changes.

Immunofluorescence analysis on isolated podocytes

To evaluate modification of cell-cycle markers by immunofluorescence, cells were grown on µ- slides 8 well ibiTreat (ibidi, #80826). After proliferation on Primaria TC Cell Culture Flasks as described above, cells were re-plated on µ- slides at a density of 25000 cells/cm2. Subsequently, cells were stimulated with 10ng/ml bFGF after 12 days under growth- restrictive conditions. 48 hours after the stimulation, cells were fixed in 1% paraformaldehyde (PFA, Roth, #0335.1) for 20 minutes at 20°C. To identify cell cycle re-entry of differentiated podocytes, we used double immunostaining for nephrin (marker of differentiation, Acris, guinea pig anti-mouse BP5030) and Ki67 (Thermo Scientific, rabbit anti-mouse RM-9106), phospho-histone H3 (Cell Signaling Technology, rabbit anti-mouse #9701). After fixation, µ-slides were blocked with normal goat serum (NGS, Dianova, #005-000-121), Blotto (Biorad, #1706404) and anti- mouse CD16/ CD32 (eBioscience, #14-0161) for 30 minutes at 20°C to prevent non-specific binding. Afterwards µ-slides were incubated with primary antibodies for 24 hours at 4°C. As secondary antibody, we used the fluorochrome Alexa 488- (Thermo Scientific, goat anti-guinea pig, A11073) and Alexa 568-antibody (Thermo Scientific, donkey anti-rabbit, A10042). All antibodies were diluted in Pierce Immunostain Enhancer (Thermo Scientific, #46644) to amplify the signal.

Puromycin aminonucleoside (PAN) stimulation

In a second experimental design we investigated the susceptibility of stimulated podocytes to damage. After stimulation with bFGF (10 ng/ml), cells were incubated with 30 µg/ml puromycin aminonucleoside (PAN, Enzo, BLM-A260-0050) for 24 hours at 37°C. Afterwards culture medium was collected to quantify cytotoxicity by LDH assay (Roche, #04744926001). Additionally, cells were stained with trypan blue (Roth, CN76.2) to count living and dead cells. Both, trypan negative and positive bi-nucleated podocytes were counted to evaluate the percentage of trypan blue positive bi-nucleated podocytes.

Statistical analysis

After testing for normality using the Kolmogorov-Smirnov test, statistical significances (p < 0.05) were evaluated using Kruskal-Wallis Test followed by Dunn's multiple comparison test (GraphPad Prism software) or Mann-Whitney U rank-test for comparison of two groups. Results are shown as box plots, showing the 25 to 75 percentile within the box and minimum and maximum values as whiskers (Figs. 1–2). Means in graphs (Figs. 3–5) or mentioned in the text were shown as mean ± SEM.

Supplementary Material

1191710_Supplemental_Material.zip

Disclosure of potential conflicts of interest

No potential conflicts of interest were disclosed.

Acknowledgments

The present work was performed in (partial) fulfillment of the requirements for obtaining the “Dr. med.” Degree for M. Hagen from the Friedrich-Alexander-Universität (FAU) Erlangen-Nürnberg.

Funding

This work was also supported by an Emerging Fields Initiative for “Cell Cycle in Disease and Regeneration” from the FAU Erlangen-Nürnberg.

References

  • [1].Collins AJ, Kasiske B, Herzog C, Chavers B, Foley R, Gilbertson D, Grimm R, Liu J, Louis T, Manning W, et al.. Excerpts from the United States Renal Data System 2006 Annual Data Report. Am J Kidney Dis 2007; 49:A6-7, S1-296. [DOI] [PubMed] [Google Scholar]
  • [2].Collins AJ, Foley RN, Herzog C, Chavers BM, Gilbertson D, Ishani A, Kasiske BL, Liu J, Mau LW, McBean M, et al.. Excerpts from the US Renal Data System 2009 Annual Data Report. Am J Kidney Dis 2010; 55:S1-420, A6-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [3].Kriz W, Lemley KV. The role of the podocyte in glomerulosclerosis. Curr Opin Nephrol Hypertension 1999; 8:489-97; PMID:10491745; http://dx.doi.org/ 10.1097/00041552-199907000-00014 [DOI] [PubMed] [Google Scholar]
  • [4].Lemley KV, Lafayette RA, Safai M, Derby G, Blouch K, Squarer A, Myers BD. Podocytopenia and disease severity in IgA nephropathy. Kidney Int 2002; 61:1475-85; PMID:11918755; http://dx.doi.org/ 10.1046/j.1523-1755.2002.00269.x [DOI] [PubMed] [Google Scholar]
  • [5].Pagtalunan ME, Miller PL, Jumping-Eagle S, Nelson RG, Myers BD, Rennke HG, Coplon NS, Sun L, Meyer TW. Podocyte loss and progressive glomerular injury in type II diabetes. J Clin Invest 1997; 99:342-8; PMID:9006003; http://dx.doi.org/ 10.1172/JCI119163 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [6].Wang G, Lai FM, Kwan BC, Lai KB, Chow KM, Li PK, Szeto CC. Podocyte loss in human hypertensive nephrosclerosis. Am J Hypertension 2009; 22:300-6; PMID:19131934; http://dx.doi.org/ 10.1038/ajh.2008.360 [DOI] [PubMed] [Google Scholar]
  • [7].Pavenstadt H, Kriz W, Kretzler M. Cell biology of the glomerular podocyte. Physiological Rev 2003; 83:253-307; PMID:12506131; http://dx.doi.org/ 10.1152/physrev.00020.2002 [DOI] [PubMed] [Google Scholar]
  • [8].Combs HL, Shankland SJ, Setzer SV, Hudkins KL, Alpers CE. Expression of the cyclin kinase inhibitor, p27kip1, in developing and mature human kidney. Kidney Int 1998; 53:892-6; PMID:9551395; http://dx.doi.org/ 10.1111/j.1523-1755.1998.00842.x [DOI] [PubMed] [Google Scholar]
  • [9].Marshall CB, Shankland SJ. Cell cycle regulatory proteins in podocyte health and disease. Nephron Exp Nephrol 2007; 106:e51-9; PMID:17570940; http://dx.doi.org/ 10.1159/000101793 [DOI] [PubMed] [Google Scholar]
  • [10].Shankland SJ, Floege J, Thomas SE, Nangaku M, Hugo C, Pippin J, Henne K, Hockenberry DM, Johnson RJ, Couser WG. Cyclin kinase inhibitors are increased during experimental membranous nephropathy: potential role in limiting glomerular epithelial cell proliferation in vivo. Kidney Int 1997; 52:404-13; PMID:9263996; http://dx.doi.org/ 10.1038/ki.1997.347 [DOI] [PubMed] [Google Scholar]
  • [11].Lasagni L, Ballerini L, Angelotti ML, Parente E, Sagrinati C, Mazzinghi B, Peired A, Ronconi E, Becherucci F, Bani D, et al.. Notch activation differentially regulates renal progenitors proliferation and differentiation toward the podocyte lineage in glomerular disorders. Stem Cells (Dayton, Ohio) 2010; 28:1674-85; PMID:20680961 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [12].Lasagni L, Lazzeri E, Shankland SJ, Anders HJ, Romagnani P. Podocyte mitosis - a catastrophe. Curr Mol Med 2013; 13:13-23; PMID:23176147; http://dx.doi.org/ 10.2174/156652413804486250 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [13].Nagata M, Yamaguchi Y, Komatsu Y, Ito K. Mitosis and the presence of binucleate cells among glomerular podocytes in diseased human kidneys. Nephron 1995; 70:68-71; PMID:7617119; http://dx.doi.org/ 10.1159/000188546 [DOI] [PubMed] [Google Scholar]
  • [14].Liapis H, Romagnani P, Anders HJ. New insights into the pathology of podocyte loss: mitotic catastrophe. Am J Pathol 2013; 183:1364-74; PMID:24007883; http://dx.doi.org/ 10.1016/j.ajpath.2013.06.033 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [15].Mulay SR, Thomasova D, Ryu M, Kulkarni OP, Migliorini A, Bruns H, Grobmayr R, Lazzeri E, Lasagni L, Liapis H, et al.. Podocyte loss involves MDM2-driven mitotic catastrophe. J Pathol 2013; 230:322-35; PMID:23749457; http://dx.doi.org/ 10.1002/path.4193 [DOI] [PubMed] [Google Scholar]
  • [16].Xu L, Yang HC, Hao CM, Lin ST, Gu Y, Ma J. Podocyte number predicts progression of proteinuria in IgA nephropathy. Modern Pathol 2010; 23:1241-50 [DOI] [PubMed] [Google Scholar]
  • [17].Su H, Wan Q, Tian XJ, He FF, Gao P, Tang H, Ye C, Fan D, Chen S, Wang YM, et al.. MAD2B contributes to podocyte injury of diabetic nephropathy via inducing cyclin B1 and Skp2 accumulation. Am J Physiol Renal Physiol 2015; 308:F728-36; PMID:25651564; http://dx.doi.org/ 10.1152/ajprenal.00409.2014 [DOI] [PubMed] [Google Scholar]
  • [18].Shankland SJ, Pippin JW, Couser WG. Complement (C5b-9) induces glomerular epithelial cell DNA synthesis but not proliferation in vitro. Kidney Int 1999; 56:538-48; PMID:10432393 [DOI] [PubMed] [Google Scholar]
  • [19].Barisoni L, Mokrzycki M, Sablay L, Nagata M, Yamase H, Mundel P. Podocyte cell cycle regulation and proliferation in collapsing glomerulopathies. Kidney Int 2000; 58:137-43; PMID:10886558; http://dx.doi.org/ 10.1046/j.1523-1755.2000.00149.x [DOI] [PubMed] [Google Scholar]
  • [20].Bonsib SM, Horvath F Jr. Multinucleated podocytes in a child with nephrotic syndrome and Fanconi's syndrome: A unique clue to the diagnosis. Am J Kidney Dis 1999; 34:966-71; PMID:10561159; http://dx.doi.org/ 10.1016/S0272-6386(99)70060-0 [DOI] [PubMed] [Google Scholar]
  • [21].Griffin SV, Petermann AT, Durvasula RV, Shankland SJ. Podocyte proliferation and differentiation in glomerular disease: role of cell-cycle regulatory proteins. Nephrol, Dialysis, Transplantation 2003; 18 Suppl 6:vi8-13 [DOI] [PubMed] [Google Scholar]
  • [22].Petermann AT, Pippin J, Hiromura K, Monkawa T, Durvasula R, Couser WG, Kopp J, Shankland SJ. Mitotic cell cycle proteins increase in podocytes despite lack of proliferation. Kidney Int 2003; 63:113-22; PMID:12472774; http://dx.doi.org/ 10.1046/j.1523-1755.2003.00723.x [DOI] [PubMed] [Google Scholar]
  • [23].Srivastava T, Garola RE, Singh HK. Cell-cycle regulatory proteins in the podocyte in collapsing glomerulopathy in children. Kidney Int 2006; 70:529-35; PMID:16775597; http://dx.doi.org/ 10.1038/sj.ki.5001577 [DOI] [PubMed] [Google Scholar]
  • [24].Wang S, Kim JH, Moon KC, Hong HK, Lee HS. Cell-cycle mechanisms involved in podocyte proliferation in cellular lesion of focal segmental glomerulosclerosis. Am J Kidney Dis 2004; 43:19-27; PMID:14712423; http://dx.doi.org/ 10.1053/j.ajkd.2003.09.010 [DOI] [PubMed] [Google Scholar]
  • [25].Griffin SV, Krofft RD, Pippin JW, Shankland SJ. Limitation of podocyte proliferation improves renal function in experimental crescentic glomerulonephritis. Kidney Int 2005; 67:977-86; PMID:15698436; http://dx.doi.org/ 10.1111/j.1523-1755.2005.00161.x [DOI] [PubMed] [Google Scholar]
  • [26].Wittmann S, Daniel C, Stief A, Vogelbacher R, Amann K, Hugo C. Long-term treatment of sirolimus but not cyclosporine ameliorates diabetic nephropathy in the rat. Transplantation 2009; 87:1290-9; PMID:19424027; http://dx.doi.org/ 10.1097/TP.0b013e3181a192bd [DOI] [PubMed] [Google Scholar]
  • [27].Marshall CB, Shankland SJ. Cell cycle and glomerular disease: a mini review. Nephron Exp Nephrol 2006; 102:e39-48; PMID:16179806; http://dx.doi.org/ 10.1159/000088400 [DOI] [PubMed] [Google Scholar]
  • [28].Bhathena DB. Glomerular basement membrane length to podocyte ratio in human nephronopenia: implications for focal segmental glomerulosclerosis. Am J Kidney Dis 2003; 41:1179-88; PMID:12776269; http://dx.doi.org/ 10.1016/S0272-6386(03)00349-4 [DOI] [PubMed] [Google Scholar]
  • [29].Chen CA, Hwang JC, Guh JY, Chang JM, Lai YH, Chen HC. Reduced podocyte expression of alpha3beta1 integrins and podocyte depletion in patients with primary focal segmental glomerulosclerosis and chronic PAN-treated rats. J Lab Clin Med 2006; 147:74-82; PMID:16459165; http://dx.doi.org/ 10.1016/j.lab.2005.08.011 [DOI] [PubMed] [Google Scholar]
  • [30].Wiggins JE, Goyal M, Sanden SK, Wharram BL, Shedden KA, Misek DE, Kuick RD, Wiggins RC. Podocyte hypertrophy, “adaptation,” and “decompensation” associated with glomerular enlargement and glomerulosclerosis in the aging rat: prevention by calorie restriction. J Am Society Nephrol 2005; 16:2953-66; PMID:16120818 [DOI] [PubMed] [Google Scholar]
  • [31].Kriz W, Hahnel B, Rosener S, Elger M. Long-term treatment of rats with FGF-2 results in focal segmental glomerulosclerosis. Kidney Int 1995; 48:1435-50; PMID:8544400; http://dx.doi.org/ 10.1038/ki.1995.433 [DOI] [PubMed] [Google Scholar]
  • [32].Sasaki T, Hatta H, Osawa G. Cytokines and podocyte injury: the mechanism of fibroblast growth factor 2-induced podocyte injury. Nephrol, Dialysis, Transplantation 1999; 14 Suppl 1:33-4; http://dx.doi.org/ 10.1093/ndt/14.suppl_1.33 [DOI] [PubMed] [Google Scholar]
  • [33].Vogelmann SU, Nelson WJ, Myers BD, Lemley KV. Urinary excretion of viable podocytes in health and renal disease. Am J Physiol Renal Physiol 2003; 285:F40-8; PMID:12631553; http://dx.doi.org/ 10.1152/ajprenal.00404.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [34].Hara M, Yanagihara T, Kihara I. Urinary podocytes in primary focal segmental glomerulosclerosis. Nephron 2001; 89:342-7; PMID:11598401; http://dx.doi.org/ 10.1159/000046097 [DOI] [PubMed] [Google Scholar]
  • [35].Wu DT, Bitzer M, Ju W, Mundel P, Bottinger EP. TGF-β concentration specifies differential signaling profiles of growth arrest/differentiation and apoptosis in podocytes. J Am Society Nephrol 2005; 16:3211-21; PMID:16207831; http://dx.doi.org/ 10.1681/ASN.2004121055 [DOI] [PubMed] [Google Scholar]
  • [36].Takeuchi A, Yoshizawa N, Yamamoto M, Sawasaki Y, Oda T, Senoo A, Niwa H, Fuse Y. Basic fibroblast growth factor promotes proliferation of rat glomerular visceral epithelial cells in vitro. Am J Pathol 1992; 141:107-16; PMID:1632456 [PMC free article] [PubMed] [Google Scholar]
  • [37].Yuan JP, Wang LW, Qu AP, Chen JM, Xiang QM, Chen C, Sun SR, Pang DW, Liu J, Li Y. Quantum dots-based quantitative and in situ multiple imaging on ki67 and cytokeratin to improve ki67 assessment in breast cancer. PloS One 2015; 10:e0122734; PMID:25856425 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [38].Prigent C, Dimitrov S. Phosphorylation of serine 10 in histone H3, what for? J Cell Sci 2003; 116:3677-85; PMID:12917355; http://dx.doi.org/ 10.1242/jcs.00735 [DOI] [PubMed] [Google Scholar]
  • [39].Griffin SV, Hiromura K, Pippin J, Petermann AT, Blonski MJ, Krofft R, Takahashi S, Kulkarni AB, Shankland SJ. Cyclin-dependent kinase 5 is a regulator of podocyte differentiation, proliferation, and morphology. Am J Pathol 2004; 165:1175-85; PMID:15466384; http://dx.doi.org/ 10.1016/S0002-9440(10)63378-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [40].Liu Y, Wu J, Wu H, Wang T, Gan H, Zhang X, Liu Y, Li R, Zhao Z, Chen Q, et al.. UCH-L1 expression of podocytes in diseased glomeruli and in vitro. J Pathol 2009; 217:642-53; PMID:19214988; http://dx.doi.org/ 10.1002/path.2511 [DOI] [PubMed] [Google Scholar]
  • [41].Migliorini A, Angelotti ML, Mulay SR, Kulkarni OO, Demleitner J, Dietrich A, Sagrinati C, Ballerini L, Peired A, Shankland SJ, et al.. The antiviral cytokines IFN-α and IFN-β modulate parietal epithelial cells and promote podocyte loss: implications for IFN toxicity, viral glomerulonephritis, and glomerular regeneration. Am J Pathol 2013; 183:431-40; PMID:23747509; http://dx.doi.org/ 10.1016/j.ajpath.2013.04.017 [DOI] [PubMed] [Google Scholar]
  • [42].Srivastava T, Sharma M, Yew KH, Sharma R, Duncan RS, Saleem MA, McCarthy ET, Kats A, Cudmore PA, Alon US, et al.. LPS and PAN-induced podocyte injury in an in vitro model of minimal change disease: changes in TLR profile. J Cell Commun Signal 2013; 7:49-60; PMID:23161414; http://dx.doi.org/ 10.1007/s12079-012-0184-0 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [43].Zarrouki B, Benterki I, Fontes G, Peyot ML, Seda O, Prentki M, Poitout V. Epidermal growth factor receptor signaling promotes pancreatic β-cell proliferation in response to nutrient excess in rats through mTOR and FOXM1. Diabetes 2014; 63:982-93; PMID:24194502; http://dx.doi.org/ 10.2337/db13-0425 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [44].Dimmler A, Haas CS, Cho S, Hattler M, Forster C, Peters H, Schocklmann HO, Amann K. Laser capture microdissection and real-time PCR for analysis of glomerular endothelin-1 gene expression in mesangiolysis of rat anti-Thy 1.1 and murine Habu Snake Venom glomerulonephritis. Diagnostic Mole Pathol 2003; 12:108-17; PMID:12766616; http://dx.doi.org/ 10.1097/00019606-200306000-00007 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1191710_Supplemental_Material.zip
kccy-15-14-1191710-s001.zip (53.1KB, zip)

Articles from Cell Cycle are provided here courtesy of Taylor & Francis

RESOURCES